Skip to content

Latest commit

 

History

History
113 lines (97 loc) · 4.36 KB

README.md

File metadata and controls

113 lines (97 loc) · 4.36 KB
Raw

HFold_iterative

Description:

This software is still under development

Supported OS:

Linux, macOS

Installation:

Requirements: A compiler that supports C++11 standard (tested with g++ version 4.9.0 or higher), Pthreads, and CMake version 3.1 or greater.

CMake version 3.1 or greater must be installed in a way that HFold can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:

cmake --version

If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.

Mac:

Easiest way is to install homebrew and use that to install CMake.
To do so, run the following from a terminal to install homebrew:  

/usr/bin/ruby -e "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install)"  

When that finishes, run the following from a terminal to install CMake.    

brew install cmake

Linux:

Run from a terminal

wget http://www.cmake.org/files/v3.8/cmake-3.8.2.tar.gz
tar xzf cmake-3.8.2.tar.gz
cd cmake-3.8.2
./configure
make
make install

Linux instructions source

Steps for installation

  1. Download the repository and extract the files onto your system.
  2. From a command line in the root directory (where this README.md is) run
cmake -H. -Bbuild
cmake --build build

If you need to specify a specific compiler, such as g++, you can instead run something like

cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build

This can be useful if you are getting errors about your compiler not having C++11 features.

How to use:

Arguments:
    HFold_iterative:
        -s <sequence>
        -r <structure>
        -i </path/to/file>
        -o </path/to/file>

    Remarks:
        make sure the <arguments> are enclosed in "", for example -r "..().." instead of -r ..()..
        input file for -i must be .txt
        if -i is provided with just a file name without a path, it is assuming the file is in the diretory where the executable is called
        if -o is provided with just a file name without a path, the output file will be generated in the diretory where the executable is called
        if -o is provided with just a file name without a path, and if -i is provided, then the output file will be generated in the directory where the input file is located

Sequence requirements:
    containing only characters GCAUT

Structure requirements:
    -pseudoknot free
    -containing only characters ._(){}[]
    Remarks:
        Restricted structure symbols:
            () restricted base pair
            _ no restriction


Input file requirements:
        Line1: Sequence
        Line2: Structure
    sample:
        GCAACGAUGACAUACAUCGCUAGUCGACGC
        (____________________________)

Example:

assume you are in the directory where the HFold_iterative executable is loacted
./HFold_iterative -i "/home/username/Desktop/myinputfile.txt"
./HFold_iterative -i "/home/username/Desktop/myinputfile.txt" -o "outputfile.txt"
./HFold_iterative -i "/home/username/Desktop/myinputfile.txt" -o "/home/username/Desktop/some_folder/outputfile.txt"
./HFold_iterative -s "GCAACGAUGACAUACAUCGCUAGUCGACGC" -r "(____________________________)"
./HFold_iterative -s "GCAACGAUGACAUACAUCGCUAGUCGACGC" -r "(____________________________)" -o "outputfile.txt"
./HFold_iterative -s "GCAACGAUGACAUACAUCGCUAGUCGACGC" -r "(____________________________)" -o "/home/username/Desktop/some_folder/outputfile.txt"

Exit code:

0       success
1	    invalid argument error 
3	    thread error
4       i/o error
5       pipe error
error code with special meaning: http://tldp.org/LDP/abs/html/exitcodes.html
2	    Misuse of shell builtins (according to Bash documentation)
126	    Command invoked cannot execute
127	    "command not found"
128	    Invalid argument to exit	
128+n	Fatal error signal "n"
130	    Script terminated by Control-C
255	    Exit status out of range (range is 0-255)