From 519e93df4dfa0474a8dfe97dfe6693399b5db761 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 27 Jun 2019 09:28:12 +0200
Subject: [PATCH 001/126] Update requirements for importer

---
 scripts/importer/requirements.txt | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/scripts/importer/requirements.txt b/scripts/importer/requirements.txt
index 6bf362d48..be085d36e 100644
--- a/scripts/importer/requirements.txt
+++ b/scripts/importer/requirements.txt
@@ -1,3 +1,3 @@
-mysqlclient==1.3.13
-peewee==2.10.2
-psycopg2-binary==2.7.5
+mysqlclient==1.4.2.post1
+peewee==3.9.6
+psycopg2-binary==2.8.3

From 88d6455bc0fc13da1b3075034671708bb9db3e92 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Thu, 27 Jun 2019 10:46:53 +0200
Subject: [PATCH 002/126] Rename data.mate to mates

---
 backend/db.py         | 4 ++--
 sql/beacon_schema.sql | 2 +-
 sql/data_schema.sql   | 2 +-
 3 files changed, 4 insertions(+), 4 deletions(-)

diff --git a/backend/db.py b/backend/db.py
index 08cc6a998..14cf557ea 100644
--- a/backend/db.py
+++ b/backend/db.py
@@ -269,10 +269,10 @@ class Meta:
 
 class VariantMate(BaseModel):
     class Meta:
-        table_name = "mate"
+        table_name = "mates"
         schema = 'data'
 
-    dataset_version = ForeignKeyField(DatasetVersion, column_name="dataset_version", backref="mate")
+    dataset_version = ForeignKeyField(DatasetVersion, column_name="dataset_version", backref="mates")
     chrom = CharField(max_length=10)
     pos = IntegerField()
     ref = CharField()
diff --git a/sql/beacon_schema.sql b/sql/beacon_schema.sql
index 4b3ed0a05..52d4908b9 100644
--- a/sql/beacon_schema.sql
+++ b/sql/beacon_schema.sql
@@ -103,7 +103,7 @@ CREATE OR REPLACE VIEW beacon.beacon_mate_table AS
            dm.allele_freq as frequency,
            dm.mate_start - 1 as "end",
            'BND' as variantType
-     FROM data.mate AS dm
+     FROM data.mates AS dm
       JOIN beacon.available_datasets as av
         ON dm.dataset_version = av.id
       JOIN data.datasets as d
diff --git a/sql/data_schema.sql b/sql/data_schema.sql
index b7b2e9f0d..0d5de5b7e 100644
--- a/sql/data_schema.sql
+++ b/sql/data_schema.sql
@@ -173,7 +173,7 @@ CREATE TABLE IF NOT EXISTS data.variants (
 );
 
 -- For storing breakends
-CREATE TABLE IF NOT EXISTS data.mate (
+CREATE TABLE IF NOT EXISTS data.mates (
     id integer PRIMARY KEY GENERATED BY DEFAULT AS IDENTITY,
     dataset_version integer REFERENCES data.dataset_versions,
     chrom_id varchar(128),  -- column 3 in vcf

From 6154963d86c065bcb926a4e5510038b34733aa49 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 5 Aug 2019 09:20:08 +0200
Subject: [PATCH 003/126] Replace old error management with new the new errors
 for coverage.

---
 backend/modules/browser/browser_handlers.py | 8 +++++---
 1 file changed, 5 insertions(+), 3 deletions(-)

diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index 26da598b4..82069e263 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -115,9 +115,11 @@ def get(self, dataset:str, datatype:str, item:str, ds_version:str=None):
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
         try:
             ret = utils.get_coverage_pos(dataset, datatype, item, ds_version)
-        except ValueError:
-            logging.error('GetCoveragePos: unable to parse region ({})'.format(item))
-            self.send_error(status_code=400, reason='Unable to parse region')
+        except error.NotFoundError as err:
+            self.send_error(status_code=404, reason=str(err))
+            return
+        except (error.ParsingError, error.MalformedRequest) as err:
+            self.send_error(status_code=400, reason=str(err))
             return
 
         self.finish(ret)

From 76137769bfd08417a2164d4e8af76827a0cf1cd2 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 5 Aug 2019 09:21:18 +0200
Subject: [PATCH 004/126] Remove unnecessary whitespace.

---
 backend/modules/browser/browser_handlers.py | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index 82069e263..e782bb75e 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -241,12 +241,12 @@ def get(self, dataset:str, transcript:str, ds_version:str=None):
               }
 
         # Add transcript information
-        try: 
+        try:
             transcript = lookups.get_transcript(dataset, transcript_id, ds_version)
         except error.NotFoundError as err:
             self.send_error(status_code=404, reason=str(err))
             return
-        
+
         ret['transcript']['id'] = transcript['transcript_id']
         ret['transcript']['number_of_CDS'] = len([t for t in transcript['exons'] if t['feature_type'] == 'CDS'])
 

From dc1a4b716a1d49fde672e0c59ba2b06cd5594382 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 5 Aug 2019 11:24:57 +0200
Subject: [PATCH 005/126] More logging for Elixir login errors to allow
 debugging.

---
 backend/auth.py | 13 +++++++++----
 1 file changed, 9 insertions(+), 4 deletions(-)

diff --git a/backend/auth.py b/backend/auth.py
index 7f1586b1e..b22a038dd 100644
--- a/backend/auth.py
+++ b/backend/auth.py
@@ -55,10 +55,15 @@ async def get(self):
             user_token = await self.get_user_token(self.get_argument('code'))
             user       = await self.get_user(user_token["access_token"])
 
-            self.set_secure_cookie('access_token', user_token["access_token"])
-            self.set_secure_cookie('user', user["name"])
-            self.set_secure_cookie('email', user["email"])
-            self.set_secure_cookie('identity', user["sub"])
+            try:
+                self.set_secure_cookie('access_token', user_token["access_token"])
+                self.set_secure_cookie('user', user["name"])
+                self.set_secure_cookie('email', user["email"])
+                self.set_secure_cookie('identity', user["sub"])
+            except KeyError as err:
+                logging.error(f'ElixirLoginHandler: data missing ({err}); user: {user}, user_token: {user_token}')
+                self.redirect("/error")
+                return
 
             redirect = self.get_secure_cookie("login_redirect")
             self.clear_cookie("login_redirect")

From f444aabbf3b53c8cd2f161dba735654e533dc276 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 27 Jun 2019 13:09:57 +0200
Subject: [PATCH 006/126] Prepare travis script

---
 test/travis_script.sh | 38 ++++++++++++++++++++++++++++++++++----
 1 file changed, 34 insertions(+), 4 deletions(-)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index eae53190d..2049505af 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -3,6 +3,7 @@
 DBNAME=swefreq
 
 ## SETUP SETTINGS
+echo '>>> Preparing for testing: Fix settings.json file'
 cp settings_sample.json settings.json
 
 sed -i.tmp 's/"postgresHost" : "postgres host"/"postgresHost" : "127.0.0.1"/' settings.json
@@ -13,7 +14,8 @@ echo 'SETTINGS'
 cat settings.json
 echo '/SETTINGS'
 
-echo '>>> Test 1. The SQL Patch'
+
+echo '>>> Test 1: The SQL Patch'
 
 LATEST_RELEASE=$(git tag | grep '^v' | sort -V | tail -n 1)
 git show "$LATEST_RELEASE:sql/*_schema.sql" > master-schema.sql
@@ -27,17 +29,20 @@ DROP SCHEMA data;
 DROP SCHEMA users;
 __END__
 
-echo '>>> Test 2. Load the swefreq schema'
+
+echo '>>> Test 2: Load the swefreq schema'
 psql -U postgres -h 127.0.0.1 -p 5433 -f sql/data_schema.sql "$DBNAME"
 psql -U postgres -h 127.0.0.1 -p 5433 -f sql/user_schema.sql "$DBNAME"
 psql -U postgres -h 127.0.0.1 -p 5433 -f test/data/load_dummy_data.sql "$DBNAME"
 psql -U postgres -h 127.0.0.1 -p 5433 -f test/data/browser_test_data.sql "$DBNAME"
 
-echo '>>> Test 3. Check that the backend starts'
+
+echo '>>> Test 3: Check that the backend starts'
 
 (cd backend && ../test/01_daemon_starts.sh)
 
-echo '>>> Test 4. the backend API'
+
+echo '>>> Test 4: The backend'
 COVERAGE_FILE=.coverage_server coverage run backend/route.py --port=4000 --develop 1>http_log.txt 2>&1 &
 BACKEND_PID=$!
 
@@ -59,10 +64,14 @@ exit_handler () {
 
 trap exit_handler EXIT
 
+
+echo '>>> Test 4A: The backend API'
 RETURN_VALUE=0
 python backend/test.py -v
 RETURN_VALUE=$((RETURN_VALUE + $?))
 
+
+echo '>>> Test 4B: The browser backend'
 # test browser
 COVERAGE_FILE=.coverage_pytest PYTHONPATH=$PYTHONPATH:backend/ py.test backend/ --cov=backend/
 RETURN_VALUE=$((RETURN_VALUE + $?))
@@ -71,6 +80,27 @@ RETURN_VALUE=$((RETURN_VALUE + $?))
 curl localhost:4000/developer/quit
 sleep 2 # Lets wait a little bit so the server has stopped
 
+
+echo '>>> Prepare for test 5: Reset the database'
+psql -U postgres -h 127.0.0.1 -p 5433 "$DBNAME" <<__END__
+DROP SCHEMA data;
+DROP SCHEMA users;
+__END__
+
+psql -U postgres -h 127.0.0.1 -p 5433 -f sql/data_schema.sql "$DBNAME"
+psql -U postgres -h 127.0.0.1 -p 5433 -f sql/user_schema.sql "$DBNAME"
+
+
+echo '>>> Test 5. Importing data'
+# read reference data
+# insert sql data with studies etc
+# read vcf files
+# make pg_dump
+# compare to reference
+
+
+echo '>>> Finalising: Combine coverage'
+
 coverage combine .coverage_pytest .coverage_server
 
 if [ -f .coverage ]; then

From 2fc6553762c9c7760fc44892abd5c53bfd70079d Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 27 Jun 2019 13:19:16 +0200
Subject: [PATCH 007/126] Dataset etc sql file

---
 scripts/importer/tests/data/base_info.sql | 35 +++++++++++++++++++++++
 1 file changed, 35 insertions(+)
 create mode 100644 scripts/importer/tests/data/base_info.sql

diff --git a/scripts/importer/tests/data/base_info.sql b/scripts/importer/tests/data/base_info.sql
new file mode 100644
index 000000000..d049101b2
--- /dev/null
+++ b/scripts/importer/tests/data/base_info.sql
@@ -0,0 +1,35 @@
+SET statement_timeout = 0;
+SET lock_timeout = 0;
+SET idle_in_transaction_session_timeout = 0;
+SET client_encoding = 'UTF8';
+SET standard_conforming_strings = on;
+SELECT pg_catalog.set_config('search_path', '', false);
+SET check_function_bodies = false;
+SET client_min_messages = warning;
+SET row_security = off;
+
+COPY data.collections (id, study_name, ethnicity) FROM stdin;
+1	reg	undefined
+2	reg	undefined
+\.
+
+COPY data.studies (id, pi_name, pi_email, contact_name, contact_email, title, study_description, publication_date, ref_doi) FROM stdin;
+1	name	email	name	email	SweGen	\N	2001-01-01 00:00:00	doi
+2	name2	email2	name2	email2	SweGen2	\N	2001-01-02 00:00:00	doi
+\.
+
+COPY data.datasets (id, study, short_name, full_name, browser_uri, beacon_uri, beacon_description, avg_seq_depth, seq_type, seq_tech, seq_center, dataset_size) FROM stdin;
+1	1	Dataset 1	Dataset 1	url	\N	\N	0	type	method	place	0
+2	2	Dataset 2	Dataset 2	url	\N	\N	0	type	method	place	0
+\.
+
+COPY data.dataset_versions (id, dataset, reference_set, dataset_version, dataset_description, terms, available_from, ref_doi, data_contact_name, data_contact_link, num_variants, coverage_levels, portal_avail, file_access, beacon_access) FROM stdin;
+1	1	1	Version 1	desc	terms	2001-01-01 00:00:00	doi	place	email	\N	{1,5,10,15,20,25,30,50,100}	TRUE	REGISTERED	PUBLIC
+2	1	1	Version 2	desc	terms	2001-01-02 00:00:00	doi	place	email	\N	{1,5,10,15,20,25,30,50,100}	TRUE	REGISTERED	PUBLIC
+3	2	1	Version 1	desc	terms	2001-01-02 00:00:00	doi	place	email	\N	{1,5,10,15,20,25,30,50,100}	TRUE	REGISTERED	PUBLIC
+\.
+
+COPY data.sample_sets (id, dataset, collection, sample_size, phenotype) FROM stdin;
+1	1	1	0	Undefined
+2	2	1	0	Undefined
+\.

From a8ae8c6197a6911ae5e2bed8a8ef6130c225e069 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 27 Jun 2019 13:21:24 +0200
Subject: [PATCH 008/126] Vcf file from Beacon testing as dataset 2_1.

---
 scripts/importer/tests/data/dataset2_1.vcf | 265 +++++++++++++++++++++
 1 file changed, 265 insertions(+)
 create mode 100644 scripts/importer/tests/data/dataset2_1.vcf

diff --git a/scripts/importer/tests/data/dataset2_1.vcf b/scripts/importer/tests/data/dataset2_1.vcf
new file mode 100644
index 000000000..a3d3b9260
--- /dev/null
+++ b/scripts/importer/tests/data/dataset2_1.vcf
@@ -0,0 +1,265 @@
+##fileformat=VCFv4.1
+##FILTER=<ID=PASS,Description="All filters passed">
+##fileDate=20150218
+##reference=ftp://ftp.1000genomes.ebi.ac.uk//vol1/ftp/technical/reference/phase2_reference_assembly_sequence/hs37d5.fa.gz
+##source=1000GenomesPhase3Pipeline
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=243199373>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##contig=<ID=5,assembly=b37,length=180915260>
+##contig=<ID=6,assembly=b37,length=171115067>
+##contig=<ID=7,assembly=b37,length=159138663>
+##contig=<ID=8,assembly=b37,length=146364022>
+##contig=<ID=9,assembly=b37,length=141213431>
+##contig=<ID=10,assembly=b37,length=135534747>
+##contig=<ID=11,assembly=b37,length=135006516>
+##contig=<ID=12,assembly=b37,length=133851895>
+##contig=<ID=13,assembly=b37,length=115169878>
+##contig=<ID=14,assembly=b37,length=107349540>
+##contig=<ID=15,assembly=b37,length=102531392>
+##contig=<ID=16,assembly=b37,length=90354753>
+##contig=<ID=17,assembly=b37,length=81195210>
+##contig=<ID=18,assembly=b37,length=78077248>
+##contig=<ID=19,assembly=b37,length=59128983>
+##contig=<ID=20,assembly=b37,length=63025520>
+##contig=<ID=21,assembly=b37,length=48129895>
+##contig=<ID=22,assembly=b37,length=51304566>
+##contig=<ID=GL000191.1,assembly=b37,length=106433>
+##contig=<ID=GL000192.1,assembly=b37,length=547496>
+##contig=<ID=GL000193.1,assembly=b37,length=189789>
+##contig=<ID=GL000194.1,assembly=b37,length=191469>
+##contig=<ID=GL000195.1,assembly=b37,length=182896>
+##contig=<ID=GL000196.1,assembly=b37,length=38914>
+##contig=<ID=GL000197.1,assembly=b37,length=37175>
+##contig=<ID=GL000198.1,assembly=b37,length=90085>
+##contig=<ID=GL000199.1,assembly=b37,length=169874>
+##contig=<ID=GL000200.1,assembly=b37,length=187035>
+##contig=<ID=GL000201.1,assembly=b37,length=36148>
+##contig=<ID=GL000202.1,assembly=b37,length=40103>
+##contig=<ID=GL000203.1,assembly=b37,length=37498>
+##contig=<ID=GL000204.1,assembly=b37,length=81310>
+##contig=<ID=GL000205.1,assembly=b37,length=174588>
+##contig=<ID=GL000206.1,assembly=b37,length=41001>
+##contig=<ID=GL000207.1,assembly=b37,length=4262>
+##contig=<ID=GL000208.1,assembly=b37,length=92689>
+##contig=<ID=GL000209.1,assembly=b37,length=159169>
+##contig=<ID=GL000210.1,assembly=b37,length=27682>
+##contig=<ID=GL000211.1,assembly=b37,length=166566>
+##contig=<ID=GL000212.1,assembly=b37,length=186858>
+##contig=<ID=GL000213.1,assembly=b37,length=164239>
+##contig=<ID=GL000214.1,assembly=b37,length=137718>
+##contig=<ID=GL000215.1,assembly=b37,length=172545>
+##contig=<ID=GL000216.1,assembly=b37,length=172294>
+##contig=<ID=GL000217.1,assembly=b37,length=172149>
+##contig=<ID=GL000218.1,assembly=b37,length=161147>
+##contig=<ID=GL000219.1,assembly=b37,length=179198>
+##contig=<ID=GL000220.1,assembly=b37,length=161802>
+##contig=<ID=GL000221.1,assembly=b37,length=155397>
+##contig=<ID=GL000222.1,assembly=b37,length=186861>
+##contig=<ID=GL000223.1,assembly=b37,length=180455>
+##contig=<ID=GL000224.1,assembly=b37,length=179693>
+##contig=<ID=GL000225.1,assembly=b37,length=211173>
+##contig=<ID=GL000226.1,assembly=b37,length=15008>
+##contig=<ID=GL000227.1,assembly=b37,length=128374>
+##contig=<ID=GL000228.1,assembly=b37,length=129120>
+##contig=<ID=GL000229.1,assembly=b37,length=19913>
+##contig=<ID=GL000230.1,assembly=b37,length=43691>
+##contig=<ID=GL000231.1,assembly=b37,length=27386>
+##contig=<ID=GL000232.1,assembly=b37,length=40652>
+##contig=<ID=GL000233.1,assembly=b37,length=45941>
+##contig=<ID=GL000234.1,assembly=b37,length=40531>
+##contig=<ID=GL000235.1,assembly=b37,length=34474>
+##contig=<ID=GL000236.1,assembly=b37,length=41934>
+##contig=<ID=GL000237.1,assembly=b37,length=45867>
+##contig=<ID=GL000238.1,assembly=b37,length=39939>
+##contig=<ID=GL000239.1,assembly=b37,length=33824>
+##contig=<ID=GL000240.1,assembly=b37,length=41933>
+##contig=<ID=GL000241.1,assembly=b37,length=42152>
+##contig=<ID=GL000242.1,assembly=b37,length=43523>
+##contig=<ID=GL000243.1,assembly=b37,length=43341>
+##contig=<ID=GL000244.1,assembly=b37,length=39929>
+##contig=<ID=GL000245.1,assembly=b37,length=36651>
+##contig=<ID=GL000246.1,assembly=b37,length=38154>
+##contig=<ID=GL000247.1,assembly=b37,length=36422>
+##contig=<ID=GL000248.1,assembly=b37,length=39786>
+##contig=<ID=GL000249.1,assembly=b37,length=38502>
+##contig=<ID=MT,assembly=b37,length=16569>
+##contig=<ID=NC_007605,assembly=b37,length=171823>
+##contig=<ID=X,assembly=b37,length=155270560>
+##contig=<ID=Y,assembly=b37,length=59373566>
+##contig=<ID=hs37d5,assembly=b37,length=35477943>
+##ALT=<ID=CNV,Description="Copy Number Polymorphism">
+##ALT=<ID=DEL,Description="Deletion">
+##ALT=<ID=DUP,Description="Duplication">
+##ALT=<ID=INS:ME:ALU,Description="Insertion of ALU element">
+##ALT=<ID=INS:ME:LINE1,Description="Insertion of LINE1 element">
+##ALT=<ID=INS:ME:SVA,Description="Insertion of SVA element">
+##ALT=<ID=INS:MT,Description="Nuclear Mitochondrial Insertion">
+##ALT=<ID=INV,Description="Inversion">
+##ALT=<ID=CN0,Description="Copy number allele: 0 copies">
+##ALT=<ID=CN1,Description="Copy number allele: 1 copy">
+##ALT=<ID=CN2,Description="Copy number allele: 2 copies">
+##ALT=<ID=CN3,Description="Copy number allele: 3 copies">
+##ALT=<ID=CN4,Description="Copy number allele: 4 copies">
+##ALT=<ID=CN5,Description="Copy number allele: 5 copies">
+##ALT=<ID=CN6,Description="Copy number allele: 6 copies">
+##ALT=<ID=CN7,Description="Copy number allele: 7 copies">
+##ALT=<ID=CN8,Description="Copy number allele: 8 copies">
+##ALT=<ID=CN9,Description="Copy number allele: 9 copies">
+##ALT=<ID=CN10,Description="Copy number allele: 10 copies">
+##ALT=<ID=CN11,Description="Copy number allele: 11 copies">
+##ALT=<ID=CN12,Description="Copy number allele: 12 copies">
+##ALT=<ID=CN13,Description="Copy number allele: 13 copies">
+##ALT=<ID=CN14,Description="Copy number allele: 14 copies">
+##ALT=<ID=CN15,Description="Copy number allele: 15 copies">
+##ALT=<ID=CN16,Description="Copy number allele: 16 copies">
+##ALT=<ID=CN17,Description="Copy number allele: 17 copies">
+##ALT=<ID=CN18,Description="Copy number allele: 18 copies">
+##ALT=<ID=CN19,Description="Copy number allele: 19 copies">
+##ALT=<ID=CN20,Description="Copy number allele: 20 copies">
+##ALT=<ID=CN21,Description="Copy number allele: 21 copies">
+##ALT=<ID=CN22,Description="Copy number allele: 22 copies">
+##ALT=<ID=CN23,Description="Copy number allele: 23 copies">
+##ALT=<ID=CN24,Description="Copy number allele: 24 copies">
+##ALT=<ID=CN25,Description="Copy number allele: 25 copies">
+##ALT=<ID=CN26,Description="Copy number allele: 26 copies">
+##ALT=<ID=CN27,Description="Copy number allele: 27 copies">
+##ALT=<ID=CN28,Description="Copy number allele: 28 copies">
+##ALT=<ID=CN29,Description="Copy number allele: 29 copies">
+##ALT=<ID=CN30,Description="Copy number allele: 30 copies">
+##ALT=<ID=CN31,Description="Copy number allele: 31 copies">
+##ALT=<ID=CN32,Description="Copy number allele: 32 copies">
+##ALT=<ID=CN33,Description="Copy number allele: 33 copies">
+##ALT=<ID=CN34,Description="Copy number allele: 34 copies">
+##ALT=<ID=CN35,Description="Copy number allele: 35 copies">
+##ALT=<ID=CN36,Description="Copy number allele: 36 copies">
+##ALT=<ID=CN37,Description="Copy number allele: 37 copies">
+##ALT=<ID=CN38,Description="Copy number allele: 38 copies">
+##ALT=<ID=CN39,Description="Copy number allele: 39 copies">
+##ALT=<ID=CN40,Description="Copy number allele: 40 copies">
+##ALT=<ID=CN41,Description="Copy number allele: 41 copies">
+##ALT=<ID=CN42,Description="Copy number allele: 42 copies">
+##ALT=<ID=CN43,Description="Copy number allele: 43 copies">
+##ALT=<ID=CN44,Description="Copy number allele: 44 copies">
+##ALT=<ID=CN45,Description="Copy number allele: 45 copies">
+##ALT=<ID=CN46,Description="Copy number allele: 46 copies">
+##ALT=<ID=CN47,Description="Copy number allele: 47 copies">
+##ALT=<ID=CN48,Description="Copy number allele: 48 copies">
+##ALT=<ID=CN49,Description="Copy number allele: 49 copies">
+##ALT=<ID=CN50,Description="Copy number allele: 50 copies">
+##ALT=<ID=CN51,Description="Copy number allele: 51 copies">
+##ALT=<ID=CN52,Description="Copy number allele: 52 copies">
+##ALT=<ID=CN53,Description="Copy number allele: 53 copies">
+##ALT=<ID=CN54,Description="Copy number allele: 54 copies">
+##ALT=<ID=CN55,Description="Copy number allele: 55 copies">
+##ALT=<ID=CN56,Description="Copy number allele: 56 copies">
+##ALT=<ID=CN57,Description="Copy number allele: 57 copies">
+##ALT=<ID=CN58,Description="Copy number allele: 58 copies">
+##ALT=<ID=CN59,Description="Copy number allele: 59 copies">
+##ALT=<ID=CN60,Description="Copy number allele: 60 copies">
+##ALT=<ID=CN61,Description="Copy number allele: 61 copies">
+##ALT=<ID=CN62,Description="Copy number allele: 62 copies">
+##ALT=<ID=CN63,Description="Copy number allele: 63 copies">
+##ALT=<ID=CN64,Description="Copy number allele: 64 copies">
+##ALT=<ID=CN65,Description="Copy number allele: 65 copies">
+##ALT=<ID=CN66,Description="Copy number allele: 66 copies">
+##ALT=<ID=CN67,Description="Copy number allele: 67 copies">
+##ALT=<ID=CN68,Description="Copy number allele: 68 copies">
+##ALT=<ID=CN69,Description="Copy number allele: 69 copies">
+##ALT=<ID=CN70,Description="Copy number allele: 70 copies">
+##ALT=<ID=CN71,Description="Copy number allele: 71 copies">
+##ALT=<ID=CN72,Description="Copy number allele: 72 copies">
+##ALT=<ID=CN73,Description="Copy number allele: 73 copies">
+##ALT=<ID=CN74,Description="Copy number allele: 74 copies">
+##ALT=<ID=CN75,Description="Copy number allele: 75 copies">
+##ALT=<ID=CN76,Description="Copy number allele: 76 copies">
+##ALT=<ID=CN77,Description="Copy number allele: 77 copies">
+##ALT=<ID=CN78,Description="Copy number allele: 78 copies">
+##ALT=<ID=CN79,Description="Copy number allele: 79 copies">
+##ALT=<ID=CN80,Description="Copy number allele: 80 copies">
+##ALT=<ID=CN81,Description="Copy number allele: 81 copies">
+##ALT=<ID=CN82,Description="Copy number allele: 82 copies">
+##ALT=<ID=CN83,Description="Copy number allele: 83 copies">
+##ALT=<ID=CN84,Description="Copy number allele: 84 copies">
+##ALT=<ID=CN85,Description="Copy number allele: 85 copies">
+##ALT=<ID=CN86,Description="Copy number allele: 86 copies">
+##ALT=<ID=CN87,Description="Copy number allele: 87 copies">
+##ALT=<ID=CN88,Description="Copy number allele: 88 copies">
+##ALT=<ID=CN89,Description="Copy number allele: 89 copies">
+##ALT=<ID=CN90,Description="Copy number allele: 90 copies">
+##ALT=<ID=CN91,Description="Copy number allele: 91 copies">
+##ALT=<ID=CN92,Description="Copy number allele: 92 copies">
+##ALT=<ID=CN93,Description="Copy number allele: 93 copies">
+##ALT=<ID=CN94,Description="Copy number allele: 94 copies">
+##ALT=<ID=CN95,Description="Copy number allele: 95 copies">
+##ALT=<ID=CN96,Description="Copy number allele: 96 copies">
+##ALT=<ID=CN97,Description="Copy number allele: 97 copies">
+##ALT=<ID=CN98,Description="Copy number allele: 98 copies">
+##ALT=<ID=CN99,Description="Copy number allele: 99 copies">
+##ALT=<ID=CN100,Description="Copy number allele: 100 copies">
+##ALT=<ID=CN101,Description="Copy number allele: 101 copies">
+##ALT=<ID=CN102,Description="Copy number allele: 102 copies">
+##ALT=<ID=CN103,Description="Copy number allele: 103 copies">
+##ALT=<ID=CN104,Description="Copy number allele: 104 copies">
+##ALT=<ID=CN105,Description="Copy number allele: 105 copies">
+##ALT=<ID=CN106,Description="Copy number allele: 106 copies">
+##ALT=<ID=CN107,Description="Copy number allele: 107 copies">
+##ALT=<ID=CN108,Description="Copy number allele: 108 copies">
+##ALT=<ID=CN109,Description="Copy number allele: 109 copies">
+##ALT=<ID=CN110,Description="Copy number allele: 110 copies">
+##ALT=<ID=CN111,Description="Copy number allele: 111 copies">
+##ALT=<ID=CN112,Description="Copy number allele: 112 copies">
+##ALT=<ID=CN113,Description="Copy number allele: 113 copies">
+##ALT=<ID=CN114,Description="Copy number allele: 114 copies">
+##ALT=<ID=CN115,Description="Copy number allele: 115 copies">
+##ALT=<ID=CN116,Description="Copy number allele: 116 copies">
+##ALT=<ID=CN117,Description="Copy number allele: 117 copies">
+##ALT=<ID=CN118,Description="Copy number allele: 118 copies">
+##ALT=<ID=CN119,Description="Copy number allele: 119 copies">
+##ALT=<ID=CN120,Description="Copy number allele: 120 copies">
+##ALT=<ID=CN121,Description="Copy number allele: 121 copies">
+##ALT=<ID=CN122,Description="Copy number allele: 122 copies">
+##ALT=<ID=CN123,Description="Copy number allele: 123 copies">
+##ALT=<ID=CN124,Description="Copy number allele: 124 copies">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##INFO=<ID=CIEND,Number=2,Type=Integer,Description="Confidence interval around END for imprecise variants">
+##INFO=<ID=CIPOS,Number=2,Type=Integer,Description="Confidence interval around POS for imprecise variants">
+##INFO=<ID=CS,Number=1,Type=String,Description="Source call set.">
+##INFO=<ID=END,Number=1,Type=Integer,Description="End coordinate of this variant">
+##INFO=<ID=IMPRECISE,Number=0,Type=Flag,Description="Imprecise structural variation">
+##INFO=<ID=MC,Number=.,Type=String,Description="Merged calls.">
+##INFO=<ID=MEINFO,Number=4,Type=String,Description="Mobile element info of the form NAME,START,END<POLARITY; If there is only 5' OR 3' support for this call, will be NULL NULL for START and END">
+##INFO=<ID=MEND,Number=1,Type=Integer,Description="Mitochondrial end coordinate of inserted sequence">
+##INFO=<ID=MLEN,Number=1,Type=Integer,Description="Estimated length of mitochondrial insert">
+##INFO=<ID=MSTART,Number=1,Type=Integer,Description="Mitochondrial start coordinate of inserted sequence">
+##INFO=<ID=SVLEN,Number=.,Type=Integer,Description="SV length. It is only calculated for structural variation MEIs. For other types of SVs; one may calculate the SV length by INFO:END-START+1, or by finding the difference between lengthes of REF and ALT alleles">
+##INFO=<ID=SVTYPE,Number=1,Type=String,Description="Type of structural variant">
+##INFO=<ID=TSD,Number=1,Type=String,Description="Precise Target Site Duplication for bases, if unknown, value will be NULL">
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Total number of alternate alleles in called genotypes">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Estimated allele frequency in the range (0,1)">
+##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples with data">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=EAS_AF,Number=A,Type=Float,Description="Allele frequency in the EAS populations calculated from AC and AN, in the range (0,1)">
+##INFO=<ID=EUR_AF,Number=A,Type=Float,Description="Allele frequency in the EUR populations calculated from AC and AN, in the range (0,1)">
+##INFO=<ID=AFR_AF,Number=A,Type=Float,Description="Allele frequency in the AFR populations calculated from AC and AN, in the range (0,1)">
+##INFO=<ID=AMR_AF,Number=A,Type=Float,Description="Allele frequency in the AMR populations calculated from AC and AN, in the range (0,1)">
+##INFO=<ID=SAS_AF,Number=A,Type=Float,Description="Allele frequency in the SAS populations calculated from AC and AN, in the range (0,1)">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth; only low coverage data were counted towards the DP, exome data were not used">
+##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele. Format: AA|REF|ALT|IndelType. AA: Ancestral allele, REF:Reference Allele, ALT:Alternate Allele, IndelType:Type of Indel (REF, ALT and IndelType are only defined for indels)">
+##INFO=<ID=VT,Number=.,Type=String,Description="indicates what type of variant the line represents">
+##INFO=<ID=EX_TARGET,Number=0,Type=Flag,Description="indicates whether a variant is within the exon pull down target boundaries">
+##INFO=<ID=MULTI_ALLELIC,Number=0,Type=Flag,Description="indicates whether a site is multi-allelic">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	HG00096	HG00097	HG00099	HG00100	HG00101	HG00102	HG00103	HG00105	HG00106	HG00107	HG00108	HG00109	HG00110	HG00111	HG00112	HG00113	HG00114	HG00115	HG00116	HG00117	HG00118	HG00119	HG00120	HG00121	HG00122	HG00123	HG00125	HG00126	HG00127	HG00128	HG00129	HG00130	HG00131	HG00132	HG00133	HG00136	HG00137	HG00138	HG00139	HG00140	HG00141	HG00142	HG00143	HG00145	HG00146	HG00148	HG00149	HG00150	HG00151	HG00154	HG00155	HG00157	HG00158	HG00159	HG00160	HG00171	HG00173	HG00174	HG00176	HG00177	HG00178	HG00179	HG00180	HG00181	HG00182	HG00183	HG00185	HG00186	HG00187	HG00188	HG00189	HG00190	HG00231	HG00232	HG00233	HG00234	HG00235	HG00236	HG00237	HG00238	HG00239	HG00240	HG00242	HG00243	HG00244	HG00245	HG00246	HG00250	HG00251	HG00252	HG00253	HG00254	HG00255	HG00256	HG00257	HG00258	HG00259	HG00260	HG00261	HG00262	HG00263	HG00264	HG00265	HG00266	HG00267	HG00268	HG00269	HG00271	HG00272	HG00273	HG00274	HG00275	HG00276	HG00277	HG00278	HG00280	HG00281	HG00282	HG00284	HG00285	HG00288	HG00290	HG00304	HG00306	HG00308	HG00309	HG00310	HG00311	HG00313	HG00315	HG00318	HG00319	HG00320	HG00321	HG00323	HG00324	HG00325	HG00326	HG00327	HG00328	HG00329	HG00330	HG00331	HG00332	HG00334	HG00335	HG00336	HG00337	HG00338	HG00339	HG00341	HG00342	HG00343	HG00344	HG00345	HG00346	HG00349	HG00350	HG00351	HG00353	HG00355	HG00356	HG00357	HG00358	HG00360	HG00361	HG00362	HG00364	HG00365	HG00366	HG00367	HG00368	HG00369	HG00371	HG00372	HG00373	HG00375	HG00376	HG00378	HG00379	HG00380	HG00381	HG00382	HG00383	HG00384	HG00403	HG00404	HG00406	HG00407	HG00409	HG00410	HG00419	HG00421	HG00422	HG00428	HG00436	HG00437	HG00442	HG00443	HG00445	HG00446	HG00448	HG00449	HG00451	HG00452	HG00457	HG00458	HG00463	HG00464	HG00472	HG00473	HG00475	HG00476	HG00478	HG00479	HG00500	HG00513	HG00524	HG00525	HG00530	HG00531	HG00533	HG00534	HG00536	HG00537	HG00542	HG00543	HG00551	HG00553	HG00554	HG00556	HG00557	HG00559	HG00560	HG00565	HG00566	HG00580	HG00581	HG00583	HG00584	HG00589	HG00590	HG00592	HG00593	HG00595	HG00596	HG00598	HG00599	HG00607	HG00608	HG00610	HG00611	HG00613	HG00614	HG00619	HG00620	HG00622	HG00623	HG00625	HG00626	HG00628	HG00629	HG00631	HG00632	HG00634	HG00637	HG00638	HG00640	HG00641	HG00650	HG00651	HG00653	HG00654	HG00656	HG00657	HG00662	HG00663	HG00671	HG00672	HG00674	HG00675	HG00683	HG00684	HG00689	HG00690	HG00692	HG00693	HG00698	HG00699	HG00701	HG00704	HG00705	HG00707	HG00708	HG00717	HG00728	HG00729	HG00731	HG00732	HG00734	HG00736	HG00737	HG00739	HG00740	HG00742	HG00743	HG00759	HG00766	HG00844	HG00851	HG00864	HG00867	HG00879	HG00881	HG00956	HG00978	HG00982	HG01028	HG01029	HG01031	HG01046	HG01047	HG01048	HG01049	HG01051	HG01052	HG01054	HG01055	HG01058	HG01060	HG01061	HG01063	HG01064	HG01066	HG01067	HG01069	HG01070	HG01072	HG01073	HG01075	HG01077	HG01079	HG01080	HG01082	HG01083	HG01085	HG01086	HG01088	HG01089	HG01092	HG01094	HG01095	HG01097	HG01098	HG01101	HG01102	HG01104	HG01105	HG01107	HG01108	HG01110	HG01111	HG01112	HG01113	HG01119	HG01121	HG01122	HG01124	HG01125	HG01130	HG01131	HG01133	HG01134	HG01136	HG01137	HG01139	HG01140	HG01142	HG01148	HG01149	HG01161	HG01162	HG01164	HG01167	HG01168	HG01170	HG01171	HG01173	HG01174	HG01176	HG01177	HG01182	HG01183	HG01187	HG01188	HG01190	HG01191	HG01197	HG01198	HG01200	HG01204	HG01205	HG01241	HG01242	HG01247	HG01248	HG01250	HG01251	HG01253	HG01254	HG01256	HG01257	HG01259	HG01260	HG01269	HG01271	HG01272	HG01275	HG01277	HG01280	HG01281	HG01284	HG01286	HG01302	HG01303	HG01305	HG01308	HG01311	HG01312	HG01323	HG01325	HG01326	HG01334	HG01341	HG01342	HG01344	HG01345	HG01348	HG01350	HG01351	HG01353	HG01354	HG01356	HG01357	HG01359	HG01360	HG01362	HG01363	HG01365	HG01366	HG01369	HG01372	HG01374	HG01375	HG01377	HG01378	HG01383	HG01384	HG01389	HG01390	HG01392	HG01393	HG01395	HG01396	HG01398	HG01402	HG01403	HG01405	HG01412	HG01413	HG01414	HG01431	HG01432	HG01435	HG01437	HG01438	HG01440	HG01441	HG01443	HG01444	HG01447	HG01455	HG01456	HG01459	HG01461	HG01462	HG01464	HG01465	HG01468	HG01474	HG01479	HG01485	HG01486	HG01488	HG01489	HG01491	HG01492	HG01494	HG01495	HG01497	HG01498	HG01500	HG01501	HG01503	HG01504	HG01506	H
+22	16050075	rs587697622	A	G	100	PASS	AC=1;AF=0.000199681;AN=5008;NS=2504;DP=8012;EAS_AF=0;AMR_AF=0;AFR_AF=0;EUR_AF=0;SAS_AF=0.001;AA=.|||;VT=SNP	GT	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0
+22	16064513	rs587642978	A	AAGAATGGCCTAATAC	100	PASS	AC=21;AF=0.00419329;AN=5008;NS=2504;DP=26803;EAS_AF=0.0079;AMR_AF=0.0058;AFR_AF=0.0015;EUR_AF=0.003;SAS_AF=0.0041;VT=INDEL	GT	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0
+22	16497141	rs574946654	CTT	C	100	PASS	AC=4;AF=0.000798722;AN=5008;NS=2504;DP=19138;EAS_AF=0;AMR_AF=0.0014;AFR_AF=0.0023;EUR_AF=0;SAS_AF=0;VT=INDEL	GT	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	
+22	16517680	rs527791780	GACAA	G	100	PASS	AC=3;AF=0.000599042;AN=5008;NS=2504;DP=23980;EAS_AF=0;AMR_AF=0;AFR_AF=0.0023;EUR_AF=0;SAS_AF=0;VT=INDEL	GT	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0
+22	16539541	rs538489066	A	AC	100	PASS	AC=7;AF=0.00139776;AN=5008;NS=2504;DP=19363;EAS_AF=0;AMR_AF=0.0029;AFR_AF=0.0038;EUR_AF=0;SAS_AF=0;AA=|||unknown(ALL_OTHER_Ns);VT=INDEL	GT	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|
+22	16577044	rs374006257;rs200929253	TG	AG,T	100	PASS	AC=17,47;AF=0.00339457,0.00938498;AN=5008;NS=2504;DP=14269;EAS_AF=0.0149,0;AMR_AF=0,0.0014;AFR_AF=0,0.0348;EUR_AF=0.001,0;SAS_AF=0.001,0;VT=SNP,INDEL;MULTI_ALLELIC	GT	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	2|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	2|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	2|0	2|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|2	0|0	0|0	0|0	0|0	0|0	0|0
+22	16879601	rs371560503	T	TA,TAA	100	PASS	AC=314,116;AF=0.0626997,0.0231629;AN=5008;NS=2504;DP=18393;EAS_AF=0.0595,0.0188;AMR_AF=0.0994,0.013;AFR_AF=0.0023,0;EUR_AF=0.0417,0.0119;SAS_AF=0.1431,0.0777;VT=INDEL;MULTI_ALLELIC	GT	0|0	0|2	0|0	0|0	0|0	0|0	0|0	0|0	2|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|2	2|0	0|0	0|0	0|1	2|0	0|0	0|1	0|0	0|0	0|2	0|0	0|0	0|0	0|1	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	2|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|2	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	2|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|2	0|0	0|2	0|0	0|0	0|0	0|0	0|1	2|0	0|0	0|0	2|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	2|0	1|0	0|0	0|0	0|0	0|0	0|0	1|1	0|0	0|1	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	2|0	2|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|2	0|0	0|1	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|1	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	1|0	0|0	0|1	0|0	0|0	0|0	0|0	0|1	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|1	0|0	0|2	1|1	1|0	1|0	0|0	0|0	0|0	0|1	0|0	1|0	1|0	0|0	0|0	0|1	0|0	0|0	1|0	0|0	1|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	1|0	0|1	0|0	0|0	0|0	0|0	0|1	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	1|0	0|1	0|0	0|1	0|0	1|0	0|0	0|0	0|0	0|1	0|0	0|1	0|0	1|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|1	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	1|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|2	0|0	1|1	0|2	0|0	0|0	0|0	0|1	0|2	0|0	0|0	0|0	0|2	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|1	0|0	0|0	0|1	0|1	0|0	0|0	0|0	0|1	1|0	0|0	0|0	0|1	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	1|0	1|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	2|0	0|1	0|0	0|0	0|1	0|0	0|0	0|0	2|0	0|0	0|0	0|0	0|0	0|0	0|0	2|0	0|1	0|1	0|0	0|0	0|0	1|2	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|1	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|1	0|0	0|0	0|0	0|0	1|0	0|0	0|0	1|1	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|1	0|0	0|0	0|0	0|0	0|1	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	1|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|1	0|1	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|2	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|2	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	1|0	0|1	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|2	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0
+22	17302972	rs5994030	C	A	100	PASS	AC=2931;AF=0.585264;AN=5008;NS=2504;DP=14904;EAS_AF=0.5804;AMR_AF=0.6225;AFR_AF=0.6135;EUR_AF=0.5954;SAS_AF=0.5153;AA=.|||;VT=SNP	GT	0|0	0|1	0|0	0|1	1|1	1|1	1|0	0|0	0|1	1|0	0|1	1|0	1|1	0|1	1|1	0|0	1|1	1|1	0|0	1|1	1|1	1|0	0|0	0|1	1|0	1|1	1|1	1|1	1|1	0|1	1|0	1|0	1|1	1|1	1|1	1|0	0|0	1|0	1|1	0|0	0|1	1|1	1|1	0|0	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|0	1|1	0|1	1|1	1|1	0|0	1|0	1|0	0|1	0|0	1|1	1|0	0|1	1|1	1|1	0|1	1|1	0|1	1|0	0|0	1|1	1|1	0|0	1|0	0|1	1|0	1|0	1|0	1|1	0|1	0|0	0|1	1|0	1|1	0|1	1|1	1|0	1|0	1|1	1|1	1|0	0|1	0|1	1|1	1|1	1|1	1|1	0|1	1|0	0|1	1|1	1|1	1|0	0|0	1|0	0|0	1|0	1|1	0|0	1|1	1|1	1|1	1|1	1|0	1|0	1|0	1|0	1|1	0|1	1|0	1|1	1|1	1|1	1|0	0|0	1|1	1|0	1|1	0|0	1|0	1|0	1|1	1|0	0|1	1|1	1|0	1|1	1|0	0|0	1|0	1|1	1|0	0|1	1|1	1|1	0|1	1|1	1|0	1|1	1|0	1|0	1|0	1|0	0|1	1|0	1|1	0|1	1|1	1|1	0|1	0|1	0|1	1|0	1|1	1|1	0|0	1|1	1|1	1|1	0|1	0|1	1|1	1|1	1|0	1|1	0|1	1|1	1|0	0|1	0|1	1|1	1|0	1|1	0|1	0|1	1|1	0|0	1|1	0|0	1|0	0|0	0|1	0|0	0|0	0|1	1|1	1|0	1|1	1|1	1|0	1|0	1|1	1|1	0|1	1|0	0|1	1|0	0|0	1|1	1|1	0|1	1|0	0|1	0|1	0|1	1|1	1|1	1|1	1|1	0|1	0|0	0|1	1|0	1|1	1|0	0|1	1|0	1|0	1|0	1|0	0|1	1|0	0|0	0|0	1|0	0|0	1|0	1|1	1|0	1|0	1|1	1|1	0|0	1|1	1|1	1|0	0|1	1|0	0|0	0|1	0|1	0|0	1|1	1|1	0|0	0|1	0|0	1|1	0|1	1|1	0|0	1|1	1|1	1|0	1|0	1|1	0|1	0|1	1|1	1|1	1|0	0|0	0|1	1|0	1|0	0|1	0|0	0|1	1|0	0|1	1|1	1|1	1|0	1|0	0|1	0|1	0|1	1|0	1|0	1|1	1|1	0|0	0|0	1|0	1|1	1|0	0|1	1|1	1|1	1|0	0|0	1|1	0|0	1|1	1|1	1|1	1|1	0|1	1|0	1|0	0|0	1|0	1|0	1|1	1|0	0|1	0|1	1|0	0|1	1|1	1|1	1|0	1|1	1|1	0|1	1|1	0|1	0|1	0|1	0|1	1|1	1|1	1|1	1|0	1|1	0|1	0|0	1|1	0|1	1|1	1|0	1|0	1|0	1|1	0|1	0|1	1|0	1|1	1|1	1|0	1|0	1|1	1|0	1|0	0|0	0|1	0|0	0|1	0|1	1|1	1|1	0|1	1|0	0|1	1|1	1|0	1|1	0|0	0|1	1|1	0|1	1|0	1|0	1|0	1|1	0|1	0|1	0|0	1|0	1|1	0|1	1|1	1|0	0|1	1|0	1|1	0|1	1|0	0|1	1|1	1|0	1|1	1|1	1|1	0|0	1|1	1|1	0|1	0|0	0|1	1|1	0|1	0|1	1|0	0|1	0|1	1|1	1|0	1|1	1|1	0|1	1|1	1|0	1|0	0|1	0|1	1|1	0|1	1|1	0|1	1|1	1|1	1|1	1|1	0|1	0|1	1|1	1|0	1|1	0|0	0|1	1|0	1|1	0|1	1|0	0|1	1|1	0|0	1|1	0|0	0|0	1|0	1|1	1|0	1|0	1|1	0|0	0|0	1|1	0|0	1|0	1|1	1|1	1|1	1|1	1|0	1|0	1|1	1|0	1|0	1|1	1|1	0|0	0|1	1|0	0|0	1|1	0|1	1|1	1|0	0|0	1|0	0|1	1|0	0|0	1|1	1|1	1|0	0|1	0|0	1|0	0|1	1|1	1|1	1|0	0|0	1|1	1|1	0|1	0|1	1|1	1|1	0|1	1|1	1|0	1|1	1|1	0|1	0|1	1|0	1|0	0|1	1|1	1|0	0|1	0|1	0|0	1|0	1|1	0|0	1|1	1|0	0|0	1|0	0|1	1|0	0|0	1|1	1|0	1|0	1|0	1|1	1|1	1|0	0|1	0|0	0|1	1|1	1|0	0|1	0|1	1|1	1|1	0|0	1|0	1|1	1|1	0|1	1|1	1|1	1|0	0|0	0|1	0|1	1|1	1|1	1|1	0|0	0|1	1|0	0|1	1|1	0|0	0|1	1|0	0|0	1|1	1|1	1|1	0|1	0|1	1|0	1|0	1|0	1|0	0|0	1|0	1|0	1|1	0|1	1|0	1|0	1|1	0|1	1|1	1|1	1|1	1|0	1|0	1|0	1|0	0|1	0|0	1|0	0|1	0|0	1|0	1|0	0|1	0|0	1|0	0|0	0|0	0|1	0|0	0|1	0|1	1|1	1|0	0|0	1|1	1|1	1|1	0|1	0|1	0|1	1|0	0|1	1|0	1|1	0|1	0|1	0|1	1|1	1|0	0|0	0|1	1|0	1|1	1|1	1|0	0|0	1|0	1|1	1|1	1|0	1|1	0|1	0|0	0|1	1|0	0|1	1|1	1|0	0|1	0|1	0|1	1|0	0|1	0|1	1|0	1|1	0|0	0|1	1|0	1|1	1|1	1|1	1|1	1|1	1|0	1|0	0|1	1|0	0|1	1|1	1|1	1|1	1|1	0|1	0|1	0|1	1|0	1|1	1|0	1|0	1|1	1|0	1|0	0|1	0|1	1|0	1|1	1|0	1|0	1|1	1|1	0|0	0|0	0|0	0|0	0|1	0|0	1|1	0|1	0|1	1|1	1|1	0|0	1|0	1|1	0|1	1|0	1|1	1|1	1|1	1|1	0|0	1|1	0|0	1|1	0|1	1|1	0|1	1|0	1|1	0|1	0|1	0|1	1|1	0|0	1|1	0|1	1|1	1|1	1|1	0|0	1|1	0|1	1|1	1|0	1|1	1|0	1|1	1|0	0|0	0|1	0|1	1|1	1|1	1|0	0|1	1|0	1|0	0|1	0|0	0|0	1|1	1|1	1|0	1|1	1|0	1|0	0|1	1|0	1|1	0|1	0|1	1|0	1|1	1|1	0|0	0|1	1|0	1|1	1|1	0|1	1|1	1|1	0|1	1|1	1|1	1|0	0|1	1|1	0|0	1|0	0|1	0|1	0|1	1|1	1|1	1|0	1|1	1|0	1|0	0|1	0|0	0|1	0|1	0|0	0|1	1|0	1|1	0|1	0|0	1|1	1|1	1|0	1|0	1|0	0|1	1|1	0|1	1|1	1|1	1|1	1|0	1|0	0|0	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|0	0|1	0|1	1|1	1|0	1|0	1|1	0|1	1|1	0|0	1|0	0|0	0|1	0|0	0|0	0|1	0|1	0|0	0|0	1|1	0|0	1|0	1|1	0|0	1|1	1|0	1|1	0|0	0|1	1|1	0|1	1|1	0|1	0|0	0|0	1|1	0|0	1|0	0|1	1|1	1|1	1|0	0|1	1|1	1|0	1|1	0|0	0|1	0|1	0|1	1|0	0|1	0|0	0|0	1|1	0|0	0|0	1|1	1|0	0|0	0|0	0|1	0|0	0|1	1|1	1|1	0|1	0|1	0|1	1|1	0|1	1|1	0|0	0|1	0|1	1|1	1|0	1|1	0|1	0|0	0|1	1|1	0|0	1|1	1|1	1|1	1|1	0|0	0|1	1|0	0|0	0|1	0|1	0|0	1|0	1|1	1|1	1|0	0|1	1|1	0|1	1|0	1|0	1|1	0|0	0|1	0|1	1|1	1|1	0|0	1|1	1|1	0|0	1|0	0|0	1|1	0|0	0|1	0|1	1|1	0|1	1|0	1|0	1|0	0|1	1|0	1|0	1|0	1|1	0|0	0|1	1|1	1|0	1|0	0|0	1|1	1|1	1|0	1|1	1|1	0|1	0|0	1|0	0|0	1|1	1|0	0|1	1|1	0|1	1|1	0|1	1|1	1|1	1|1	0|0	0|0	1|0	1|0	0|0	0|1	0|1	1|0	1|1	1|1	1|1	1|0	0|1	0|0	1|1	0|1	1|0	1|1
+22	17300408	rs5748665	A	G	100	PASS	AC=4723;AF=0.943091;AN=5008;NS=2504;DP=17781;EAS_AF=0.9236;AMR_AF=0.9337;AFR_AF=0.9962;EUR_AF=0.9264;SAS_AF=0.9151;AA=.|||;VT=SNP	GT	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	0|0	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|0	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	0|0	1|1	1|0	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|0	1|0	1|1	1|0	0|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	0|1	1|1	1|0	1|1	1|1	1|0	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	0|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|0	1|1	1|1	0|1	1|1	1|1	1|1	1|0	0|1	1|1	1|0	1|1	0|0	0|1	1|0	1|1	1|1	1|0	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	0|1	1|1	0|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	0|0	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	0|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|0	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	0|1	1|1	1|1	1|1	1|0	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1
+22	17301526	rs5844283	ATACATAGTC	A	100	PASS	AC=2932;AF=0.585463;AN=5008;NS=2504;DP=5287;EAS_AF=0.5804;AMR_AF=0.6225;AFR_AF=0.6135;EUR_AF=0.5954;SAS_AF=0.5164;VT=INDEL	GT	0|0	0|1	0|0	0|1	1|1	1|1	1|0	0|0	0|1	1|0	0|1	1|0	1|1	0|1	1|1	0|0	1|1	1|1	0|0	1|1	1|1	1|0	0|0	0|1	1|0	1|1	1|1	1|1	1|1	0|1	1|0	1|0	1|1	1|1	1|1	1|0	0|0	1|0	1|1	0|0	0|1	1|1	1|1	0|0	1|1	1|0	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|0	1|1	0|1	1|1	1|1	0|0	1|0	1|0	0|1	0|0	1|1	1|0	0|1	1|1	1|1	0|1	1|1	0|1	1|0	0|0	1|1	1|1	0|0	1|0	0|1	1|0	1|0	1|0	1|1	0|1	0|0	0|1	1|0	1|1	0|1	1|1	1|0	1|0	1|1	1|1	1|0	0|1	0|1	1|1	1|1	1|1	1|1	0|1	1|0	0|1	1|1	1|1	1|0	0|0	1|0	0|0	1|0	1|1	0|0	1|1	1|1	1|1	1|1	1|0	1|0	1|0	1|0	1|1	0|1	1|0	1|1	1|1	1|1	1|0	0|0	1|1	1|0	1|1	0|0	1|0	1|0	1|1	1|0	0|1	1|1	1|0	1|1	1|0	0|0	1|0	1|1	1|0	0|1	1|1	1|1	0|1	1|1	1|0	1|1	1|0	1|0	1|0	1|0	0|1	1|0	1|1	0|1	1|1	1|1	0|1	0|1	0|1	1|0	1|1	1|1	0|0	1|1	1|1	1|1	0|1	0|1	1|1	1|1	1|0	1|1	0|1	1|1	1|0	0|1	0|1	1|1	1|0	1|1	0|1	0|1	1|1	0|0	1|1	0|0	1|0	0|0	0|1	0|0	0|0	0|1	1|1	1|0	1|1	1|1	1|0	1|0	1|1	1|1	0|1	1|0	0|1	1|0	0|0	1|1	1|1	0|1	1|0	0|1	0|1	0|1	1|1	1|1	1|1	1|1	0|1	0|0	0|1	1|0	1|1	1|0	0|1	1|0	1|0	1|0	1|0	0|1	1|0	0|0	0|0	1|0	0|0	1|0	1|1	1|0	1|0	1|1	1|1	0|0	1|1	1|1	1|0	0|1	1|0	0|0	0|1	0|1	0|0	1|1	1|1	0|0	0|1	0|0	1|1	0|1	1|1	0|0	1|1	1|1	1|0	1|0	1|1	0|1	0|1	1|1	1|1	1|0	0|0	0|1	1|0	1|0	0|1	0|0	0|1	1|0	0|1	1|1	1|1	1|0	1|0	0|1	0|1	0|1	1|0	1|0	1|1	1|1	0|0	0|0	1|0	1|1	1|0	0|1	1|1	1|1	1|0	0|0	1|1	0|0	1|1	1|1	1|1	1|1	0|1	1|0	1|0	0|0	1|0	1|0	1|1	1|0	0|1	0|1	1|0	0|1	1|1	1|1	1|0	1|1	1|1	0|1	1|1	0|1	0|1	0|1	0|1	1|1	1|1	1|1	1|0	1|1	0|1	0|0	1|1	0|1	1|1	1|0	1|0	1|0	1|1	0|1	0|1	1|0	1|1	1|1	1|0	1|0	1|1	1|0	1|0	0|0	0|1	0|0	0|1	0|1	1|1	1|1	0|1	1|0	0|1	1|1	1|0	1|1	0|0	0|1	1|1	0|1	1|0	1|0	1|0	1|1	0|1	0|1	0|0	1|0	1|1	0|1	1|1	1|0	0|1	1|0	1|1	0|1	1|0	0|1	1|1	1|0	1|1	1|1	1|1	0|0	1|1	1|1	0|1	0|0	0|1	1|1	0|1	0|1	1|0	0|1	0|1	1|1	1|0	1|1	1|1	0|1	1|1	1|0	1|0	0|1	0|1	1|1	0|1	1|1	0|1	1|1	1|1	1|1	1|1	0|1	0|1	1|1	1|0	1|1	0|0	0|1	1|0	1|1	0|1	1|0	0|1	1|1	0|0	1|1	0|0	0|0	1|0	1|1	1|0	1|0	1|1	0|0	0|0	1|1	0|0	1|0	1|1	1|1	1|1	1|1	1|0	1|0	1|1	1|0	1|0	1|1	1|1	0|0	0|1	1|0	0|0	1|1	0|1	1|1	1|0	0|0	1|0	0|1	1|0	0|0	1|1	1|1	1|0	0|1	0|0	1|0	0|1	1|1	1|1	1|0	0|0	1|1	1|1	0|1	0|1	1|1	1|1	0|1	1|1	1|0	1|1	1|1	0|1	0|1	1|0	1|0	0|1	1|1	1|0	0|1	0|1	0|0	1|0	1|1	0|0	1|1	1|0	0|0	1|0	0|1	1|0	0|0	1|1	1|0	1|0	1|0	1|1	1|1	1|0	0|1	0|0	0|1	1|1	1|0	0|1	0|1	1|1	1|1	0|0	1|0	1|1	1|1	0|1	1|1	1|1	1|0	0|0	0|1	0|1	1|1	1|1	1|1	0|0	0|1	1|0	0|1	1|1	0|0	0|1	1|0	0|0	1|1	1|1	1|1	0|1	0|1	1|0	1|0	1|0	1|0	0|0	1|0	1|0	1|1	0|1	1|0	1|0	1|1	0|1	1|1	1|1	1|1	1|0	1|0	1|0	1|0	0|1	0|0	1|0	0|1	0|0	1|0	1|0	0|1	0|0	1|0	0|0	0|0	0|1	0|0	0|1	0|1	1|1	1|0	0|0	1|1	1|1	1|1	0|1	0|1	0|1	1|0	0|1	1|0	1|1	0|1	0|1	0|1	1|1	1|0	0|0	0|1	1|0	1|1	1|1	1|0	0|0	1|0	1|1	1|1	1|0	1|1	0|1	0|0	0|1	1|0	0|1	1|1	1|0	0|1	0|1	0|1	1|0	0|1	0|1	1|0	1|1	0|0	0|1	1|0	1|1	1|1	1|1	1|1	1|1	1|0	1|0	0|1	1|0	0|1	1|1	1|1	1|1	1|1	0|1	0|1	0|1	1|0	1|1	1|0	1|0	1|1	1|0	1|0	0|1	0|1	1|0	1|1	1|0	1|0	1|1	1|1	0|0	0|0	0|0	0|0	0|1	0|0	1|1	0|1	0|1	1|1	1|1	0|0	1|0	1|1	0|1	1|0	1|1	1|1	1|1	1|1	0|0	1|1	0|0	1|1	0|1	1|1	0|1	1|0	1|1	0|1	0|1	0|1	1|1	0|0	1|1	0|1	1|1	1|1	1|1	0|0	1|1	0|1	1|1	1|0	1|1	1|0	1|1	1|0	0|0	0|1	0|1	1|1	1|1	1|0	0|1	1|0	1|0	0|1	0|0	0|0	1|1	1|1	1|0	1|1	1|0	1|0	0|1	1|0	1|1	0|1	0|1	1|0	1|1	1|1	0|0	0|1	1|0	1|1	1|1	0|1	1|1	1|1	0|1	1|1	1|1	1|0	0|1	1|1	0|0	1|0	0|1	0|1	0|1	1|1	1|1	1|0	1|1	1|0	1|0	0|1	0|0	0|1	0|1	0|0	0|1	1|0	1|1	0|1	0|0	1|1	1|1	1|0	1|0	1|0	0|1	1|1	0|1	1|1	1|1	1|1	1|0	1|0	0|0	1|1	1|1	1|1	1|1	1|1	0|1	1|1	1|0	0|1	0|1	1|1	1|0	1|0	1|1	0|1	1|1	0|0	1|0	0|0	0|1	0|0	0|0	0|1	0|1	0|0	0|0	1|1	0|0	1|0	1|1	0|0	1|1	1|0	1|1	0|0	0|1	1|1	0|1	1|1	0|1	0|0	0|0	1|1	0|0	1|0	0|1	1|1	1|1	1|0	0|1	1|1	1|0	1|1	0|0	0|1	0|1	0|1	1|0	0|1	0|0	0|0	1|1	0|0	0|0	1|1	1|0	0|0	0|0	0|1	0|0	0|1	1|1	1|1	0|1	0|1	0|1	1|1	0|1	1|1	0|0	0|1	0|1	1|1	1|0	1|1	0|1	0|0	0|1	1|1	0|0	1|1	1|1	1|1	1|1	0|0	0|1	1|0	0|0	0|1	0|1	0|0	1|0	1|1	1|1	1|0	0|1	1|1	0|1	1|0	1|0	1|1	0|0	0|1	0|1	1|1	1|1	0|0	1|1	1|1	0|0	1|0	0|0	1|1	0|0	0|1	0|1	1|1	0|1	1|0	1|0	1|0	0|1	1|0	1|0	1|0	1|1	0|0	0|1	1|1	1|0	1|0	0|0	1|1	1|1	1|0	1|1	1|1	0|1	0|0	1|0	0|0	1|1	1|0	0|1	1|1	0|1	1|1	0|1	1|1	1|1	1|1	0|0	0|0	1|0	1|0	0|0	0|1	0|1	1|0	1|1	1|1	1|1	1|0	0|1	0|0	1|1	0|1	1|0	1
+22	19617927	rs553611103;rs553611103;rs148427666	GTCT	GTCTTCT,GTCTTCTTCT,G	100	PASS	AC=118,17,182;AF=0.0235623,0.00339457,0.0363419;AN=5008;NS=2504;DP=24087;EAS_AF=0.0109,0,0.0873;AMR_AF=0.0461,0.0014,0.0231;AFR_AF=0.0182,0.0121,0.0098;EUR_AF=0.0268,0,0.0447;SAS_AF=0.0245,0,0.0204;VT=INDEL;MULTI_ALLELIC	GT	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|3	0|3	3|0	0|0	1|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	3|3	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|3	0|0	0|0	0|0	0|0	0|0	0|3	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|3	0|0	0|0	0|0	0|0	3|0	0|3	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|3	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|3	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|3	0|0	0|0	0|0	0|0	0|0	3|0	0|0	1|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|3	0|0	3|3	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|3	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|3	0|0	0|0	0|0	0|3	0|0	3|3	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	3|3	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	3|0	0|0	3|0	0|3	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	1|0	1|0	0|0	0|0	0|0	0|0	0|0	3|0	0|3	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	1|0	0|1	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|3	0|0	0|0	1|0	0|0	0|0	0|0	0|1	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|3	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|1	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|3	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|3	0|0	0|0	0|0	0|0	0|0	0|3	0|0	1|0	0|0	0|0	0|0	0|3	0|3	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	1|1	0|0	0|0	0|0	0|0	0|0	0|3	0|0	0|0	0|0	0|3	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|3	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|3	0|0	0|0	0|0	0|0	1|0	0|0	0|0	3|0	3|0	0|0	0|0	0|0	0|0	0|3	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|3	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|3	0|0	3|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	1|0	0|0	0|0	0|1	0|0	0|3	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	3|0	0|0	0|3	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|3	0|3	0|0	0|0	0|0	0|2	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|3	0|0	0|1	0|0	0|0	3|0	3|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|0	1|0	0|0	0|0	3|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	3|0	0|0	0|3	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|3	0|0	0|1	0|0	0|0	0|0	0|1	0|3	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|3	
+2	16577044	rs374006257;rs200929253	TG	AG,T	100	PASS	AC=17,47;AF=0.00339457,0.00938498;AN=5008;NS=2504;DP=14269;EAS_AF=0.0149,0;AMR_AF=0,0.0014;AFR_AF=0,0.0348;EUR_AF=0.001,0;SAS_AF=0.001,0;VT=SNP,INDEL;MULTI_ALLELIC	GT	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	2|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	2|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	2|0	2|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|2	0|0	0|0	0|0	0|0	0|0	0|0	

From 50376b6c63b9ad143474b0a08fcfeb8586a67fd4 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 27 Jun 2019 13:35:46 +0200
Subject: [PATCH 009/126] Coverage data for dataset 1_1 and 1_2.

---
 .../tests/data/dataset1_1_coverage.txt        | 26 +++++++++++++++++++
 .../tests/data/dataset1_2_coverage.txt        | 24 +++++++++++++++++
 2 files changed, 50 insertions(+)
 create mode 100644 scripts/importer/tests/data/dataset1_1_coverage.txt
 create mode 100644 scripts/importer/tests/data/dataset1_2_coverage.txt

diff --git a/scripts/importer/tests/data/dataset1_1_coverage.txt b/scripts/importer/tests/data/dataset1_1_coverage.txt
new file mode 100644
index 000000000..01547951f
--- /dev/null
+++ b/scripts/importer/tests/data/dataset1_1_coverage.txt
@@ -0,0 +1,26 @@
+#chrom	pos	mean	median	1	5	10	15	20	25	30	50	100
+22	46515890	37.84	37	1.00	1.00	1.00	1.00	0.99	0.96	0.86	0.08	0.00
+22	46515900	38.02	37	1.00	1.00	1.00	1.00	0.99	0.97	0.85	0.08	0.00
+22	46515910	37.97	38	1.00	1.00	1.00	1.00	0.99	0.96	0.85	0.09	0.00
+22	46515920	38.27	38	1.00	1.00	1.00	1.00	0.99	0.96	0.87	0.08	0.00
+22	46515930	38.40	38	1.00	1.00	1.00	1.00	0.99	0.96	0.86	0.10	0.00
+22	46515940	38.53	38	1.00	1.00	1.00	1.00	1.00	0.95	0.87	0.10	0.00
+22	46515950	38.05	38	1.00	1.00	1.00	1.00	0.99	0.94	0.87	0.11	0.00
+22	46515960	37.99	37	1.00	1.00	1.00	1.00	1.00	0.95	0.85	0.12	0.00
+22	46515970	37.90	37	1.00	1.00	1.00	1.00	0.99	0.96	0.86	0.11	0.00
+22	46515980	37.49	37	1.00	1.00	1.00	1.00	0.99	0.93	0.85	0.09	0.00
+22	46515990	37.91	37	1.00	1.00	1.00	1.00	0.99	0.95	0.83	0.10	0.00
+22	46516000	37.63	37	1.00	1.00	1.00	1.00	0.99	0.95	0.82	0.10	0.00
+22	46516010	37.70	37	1.00	1.00	1.00	1.00	0.99	0.95	0.83	0.09	0.00
+22	46516020	37.63	37	1.00	1.00	1.00	1.00	0.99	0.95	0.84	0.09	0.00
+22	46516030	37.88	37	1.00	1.00	1.00	1.00	0.99	0.96	0.86	0.08	0.00
+22	46516040	37.06	36	1.00	1.00	1.00	1.00	0.99	0.94	0.83	0.07	0.00
+22	46516050	36.34	36	1.00	1.00	1.00	1.00	0.99	0.93	0.80	0.06	0.00
+22	46516060	36.28	36	1.00	1.00	1.00	1.00	0.99	0.93	0.80	0.06	0.00
+22	46516070	35.86	35	1.00	1.00	1.00	1.00	0.99	0.94	0.78	0.06	0.00
+22	46516080	35.38	35	1.00	1.00	1.00	1.00	0.99	0.94	0.78	0.06	0.00
+22	46516090	35.19	34	1.00	1.00	1.00	1.00	0.99	0.93	0.76	0.06	0.00
+22	46516100	34.88	34	1.00	1.00	1.00	1.00	1.00	0.92	0.75	0.04	0.00
+22	46516110	35.14	35	1.00	1.00	1.00	1.00	0.99	0.92	0.78	0.05	0.00
+22	46516120	35.20	34	1.00	1.00	1.00	1.00	1.00	0.94	0.79	0.05	0.00
+22	46516130	35.28	35	1.00	1.00	1.00	1.00	0.99	0.93	0.76	0.05	0.00
diff --git a/scripts/importer/tests/data/dataset1_2_coverage.txt b/scripts/importer/tests/data/dataset1_2_coverage.txt
new file mode 100644
index 000000000..c137bd7b5
--- /dev/null
+++ b/scripts/importer/tests/data/dataset1_2_coverage.txt
@@ -0,0 +1,24 @@
+#chrom	pos	mean	median	1	5	10	15	20	25	30	50	100
+22	16364820	75.45	71.00	1.0000	1.0000	0.9990	0.9980	0.9980	0.9940	0.9760	0.7930	0.1700
+22	16364830	75.94	71.00	1.0000	1.0000	0.9990	0.9990	0.9980	0.9940	0.9780	0.8020	0.1790
+22	16364840	74.89	70.00	1.0000	1.0000	1.0000	0.9990	0.9970	0.9920	0.9770	0.7920	0.1670
+22	16364850	72.94	69.00	1.0000	1.0000	0.9990	0.9990	0.9970	0.9920	0.9760	0.7720	0.1570
+22	16364860	71.06	67.00	1.0000	1.0000	0.9990	0.9990	0.9970	0.9880	0.9740	0.7620	0.1440
+22	16364870	67.41	63.00	1.0000	1.0000	0.9990	0.9980	0.9970	0.9870	0.9690	0.7220	0.1120
+22	16364880	64.26	60.00	1.0000	1.0000	1.0000	0.9980	0.9940	0.9870	0.9580	0.6930	0.0800
+22	16364890	60.92	58.00	1.0000	1.0000	1.0000	0.9980	0.9950	0.9860	0.9570	0.6370	0.0560
+22	16364900	58.89	56.00	1.0000	1.0000	1.0000	0.9980	0.9950	0.9830	0.9530	0.6120	0.0420
+22	16364910	57.57	54.00	1.0000	1.0000	1.0000	0.9970	0.9940	0.9830	0.9460	0.5900	0.0370
+22	16364920	56.25	53.50	1.0000	1.0000	1.0000	0.9960	0.9910	0.9830	0.9380	0.5710	0.0300
+22	16364930	55.18	53.00	1.0000	1.0000	1.0000	0.9960	0.9910	0.9800	0.9440	0.5470	0.0250
+22	16364940	55.15	53.00	1.0000	1.0000	1.0000	0.9970	0.9910	0.9770	0.9550	0.5560	0.0260
+22	16364950	54.00	52.00	1.0000	1.0000	1.0000	0.9980	0.9910	0.9790	0.9560	0.5320	0.0190
+22	16364960	51.68	50.00	1.0000	1.0000	1.0000	0.9960	0.9900	0.9760	0.9410	0.4760	0.0140
+22	16364970	50.62	48.00	1.0000	1.0000	1.0000	0.9960	0.9890	0.9740	0.9280	0.4510	0.0110
+22	16364980	50.50	48.50	1.0000	1.0000	1.0000	0.9970	0.9900	0.9750	0.9390	0.4510	0.0100
+22	16364990	50.85	49.00	1.0000	1.0000	1.0000	0.9970	0.9930	0.9780	0.9420	0.4600	0.0100
+22	16365000	50.98	49.00	1.0000	1.0000	1.0000	0.9980	0.9920	0.9820	0.9420	0.4540	0.0100
+22	16365010	51.24	49.00	1.0000	1.0000	1.0000	0.9980	0.9920	0.9820	0.9510	0.4520	0.0110
+22	16365020	52.46	50.00	1.0000	1.0000	1.0000	0.9980	0.9920	0.9810	0.9570	0.4890	0.0100
+22	16365030	52.95	51.00	1.0000	1.0000	1.0000	0.9990	0.9930	0.9820	0.9590	0.5050	0.0110
+22	16365040	53.53	51.00	1.0000	1.0000	1.0000	0.9980	0.9950	0.9870	0.9600	0.5210	0.0120

From c50fc84f75fdc04d6e14c704b9a611ef9bbab492 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 27 Jun 2019 14:01:54 +0200
Subject: [PATCH 010/126] Dataset1_1 and Dataset1_2 vcf files.

---
 scripts/importer/tests/data/dataset1_1.vcf | 156 ++++++++++++++++++++
 scripts/importer/tests/data/dataset1_2.vcf | 160 +++++++++++++++++++++
 2 files changed, 316 insertions(+)
 create mode 100644 scripts/importer/tests/data/dataset1_1.vcf
 create mode 100644 scripts/importer/tests/data/dataset1_2.vcf

diff --git a/scripts/importer/tests/data/dataset1_1.vcf b/scripts/importer/tests/data/dataset1_1.vcf
new file mode 100644
index 000000000..eedf00c83
--- /dev/null
+++ b/scripts/importer/tests/data/dataset1_1.vcf
@@ -0,0 +1,156 @@
+##fileformat=VCFv4.1
+##FILTER=<ID=PASS,Description="All filters passed">
+##ALT=<ID=NON_REF,Description="Represents any possible alternative allele at this location">
+##FILTER=<ID=LowQual,Description="Low quality">
+##FILTER=<ID=VQSRTrancheINDEL99.00to99.20,Description="Truth sensitivity tranche level for INDEL model at VQS Lod: -0.9613 <= x < -0.7773">
+##FILTER=<ID=VQSRTrancheINDEL99.20to99.50,Description="Truth sensitivity tranche level for INDEL model at VQS Lod: -1.2935 <= x < -0.9613">
+##FILTER=<ID=VQSRTrancheINDEL99.50to99.70,Description="Truth sensitivity tranche level for INDEL model at VQS Lod: -1.6569 <= x < -1.2935">
+##FILTER=<ID=VQSRTrancheINDEL99.70to99.90,Description="Truth sensitivity tranche level for INDEL model at VQS Lod: -2.7091 <= x < -1.6569">
+##FILTER=<ID=VQSRTrancheINDEL99.90to100.00+,Description="Truth sensitivity tranche level for INDEL model at VQS Lod < -66.998">
+##FILTER=<ID=VQSRTrancheINDEL99.90to100.00,Description="Truth sensitivity tranche level for INDEL model at VQS Lod: -66.998 <= x < -2.7091">
+##FILTER=<ID=VQSRTrancheSNP99.70to99.90,Description="Truth sensitivity tranche level for SNP model at VQS Lod: -9.5353 <= x < -2.1305">
+##FILTER=<ID=VQSRTrancheSNP99.90to100.00+,Description="Truth sensitivity tranche level for SNP model at VQS Lod < -39970.6153">
+##FILTER=<ID=VQSRTrancheSNP99.90to100.00,Description="Truth sensitivity tranche level for SNP model at VQS Lod: -39970.6153 <= x < -9.5353">
+##GVCFBlock=minGQ=0(inclusive),maxGQ=1(exclusive)
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities">
+##INFO=<ID=CCC,Number=1,Type=Integer,Description="Number of called chromosomes">
+##INFO=<ID=ClippingRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref number of hard clipped bases">
+##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered">
+##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
+##INFO=<ID=END,Number=1,Type=Integer,Description="Stop position of the interval">
+##INFO=<ID=FS,Number=1,Type=Float,Description="Phred-scaled p-value using Fisher's exact test to detect strand bias">
+##INFO=<ID=GQ_MEAN,Number=1,Type=Float,Description="Mean of all GQ values">
+##INFO=<ID=GQ_STDDEV,Number=1,Type=Float,Description="Standard deviation of all GQ values">
+##INFO=<ID=HW,Number=1,Type=Float,Description="Phred-scaled p-value for Hardy-Weinberg violation">
+##INFO=<ID=HWP,Number=1,Type=Float,Description="P value from test of Hardy Weinberg Equilibrium">
+##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes">
+##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation">
+##INFO=<ID=MLEAC,Number=A,Type=Integer,Description="Maximum likelihood expectation (MLE) for the allele counts (not necessarily the same as the AC), for each ALT allele, in the same order as listed">
+##INFO=<ID=MLEAF,Number=A,Type=Float,Description="Maximum likelihood expectation (MLE) for the allele frequency (not necessarily the same as the AF), for each ALT allele, in the same order as listed">
+##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
+##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
+##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities">
+##INFO=<ID=NCC,Number=1,Type=Integer,Description="Number of no-called samples">
+##INFO=<ID=NEGATIVE_TRAIN_SITE,Number=0,Type=Flag,Description="This variant was used to build the negative training set of bad variants">
+##INFO=<ID=POSITIVE_TRAIN_SITE,Number=0,Type=Flag,Description="This variant was used to build the positive training set of good variants">
+##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
+##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias">
+##INFO=<ID=SOR,Number=1,Type=Float,Description="Symmetric Odds Ratio of 2x2 contingency table to detect strand bias">
+##INFO=<ID=VQSLOD,Number=1,Type=Float,Description="Log odds ratio of being a true variant versus being false under the trained gaussian mixture model">
+##INFO=<ID=culprit,Number=1,Type=String,Description="The annotation which was the worst performing in the Gaussian mixture model, likely the reason why the variant was filtered out">
+##contig=<ID=1,length=249250621,assembly=b37>
+##contig=<ID=2,length=243199373,assembly=b37>
+##contig=<ID=3,length=198022430,assembly=b37>
+##contig=<ID=4,length=191154276,assembly=b37>
+##contig=<ID=5,length=180915260,assembly=b37>
+##contig=<ID=6,length=171115067,assembly=b37>
+##contig=<ID=7,length=159138663,assembly=b37>
+##contig=<ID=8,length=146364022,assembly=b37>
+##contig=<ID=9,length=141213431,assembly=b37>
+##contig=<ID=10,length=135534747,assembly=b37>
+##contig=<ID=11,length=135006516,assembly=b37>
+##contig=<ID=12,length=133851895,assembly=b37>
+##contig=<ID=13,length=115169878,assembly=b37>
+##contig=<ID=14,length=107349540,assembly=b37>
+##contig=<ID=15,length=102531392,assembly=b37>
+##contig=<ID=16,length=90354753,assembly=b37>
+##contig=<ID=17,length=81195210,assembly=b37>
+##contig=<ID=18,length=78077248,assembly=b37>
+##contig=<ID=19,length=59128983,assembly=b37>
+##contig=<ID=20,length=63025520,assembly=b37>
+##contig=<ID=21,length=48129895,assembly=b37>
+##contig=<ID=22,length=51304566,assembly=b37>
+##contig=<ID=X,length=155270560,assembly=b37>
+##contig=<ID=Y,length=59373566,assembly=b37>
+##contig=<ID=MT,length=16569,assembly=b37>
+##contig=<ID=GL000207.1,length=4262,assembly=b37>
+##contig=<ID=GL000226.1,length=15008,assembly=b37>
+##contig=<ID=GL000229.1,length=19913,assembly=b37>
+##contig=<ID=GL000231.1,length=27386,assembly=b37>
+##contig=<ID=GL000210.1,length=27682,assembly=b37>
+##contig=<ID=GL000239.1,length=33824,assembly=b37>
+##contig=<ID=GL000235.1,length=34474,assembly=b37>
+##contig=<ID=GL000201.1,length=36148,assembly=b37>
+##contig=<ID=GL000247.1,length=36422,assembly=b37>
+##contig=<ID=GL000245.1,length=36651,assembly=b37>
+##contig=<ID=GL000197.1,length=37175,assembly=b37>
+##contig=<ID=GL000203.1,length=37498,assembly=b37>
+##contig=<ID=GL000246.1,length=38154,assembly=b37>
+##contig=<ID=GL000249.1,length=38502,assembly=b37>
+##contig=<ID=GL000196.1,length=38914,assembly=b37>
+##contig=<ID=GL000248.1,length=39786,assembly=b37>
+##contig=<ID=GL000244.1,length=39929,assembly=b37>
+##contig=<ID=GL000238.1,length=39939,assembly=b37>
+##contig=<ID=GL000202.1,length=40103,assembly=b37>
+##contig=<ID=GL000234.1,length=40531,assembly=b37>
+##contig=<ID=GL000232.1,length=40652,assembly=b37>
+##contig=<ID=GL000206.1,length=41001,assembly=b37>
+##contig=<ID=GL000240.1,length=41933,assembly=b37>
+##contig=<ID=GL000236.1,length=41934,assembly=b37>
+##contig=<ID=GL000241.1,length=42152,assembly=b37>
+##contig=<ID=GL000243.1,length=43341,assembly=b37>
+##contig=<ID=GL000242.1,length=43523,assembly=b37>
+##contig=<ID=GL000230.1,length=43691,assembly=b37>
+##contig=<ID=GL000237.1,length=45867,assembly=b37>
+##contig=<ID=GL000233.1,length=45941,assembly=b37>
+##contig=<ID=GL000204.1,length=81310,assembly=b37>
+##contig=<ID=GL000198.1,length=90085,assembly=b37>
+##contig=<ID=GL000208.1,length=92689,assembly=b37>
+##contig=<ID=GL000191.1,length=106433,assembly=b37>
+##contig=<ID=GL000227.1,length=128374,assembly=b37>
+##contig=<ID=GL000228.1,length=129120,assembly=b37>
+##contig=<ID=GL000214.1,length=137718,assembly=b37>
+##contig=<ID=GL000221.1,length=155397,assembly=b37>
+##contig=<ID=GL000209.1,length=159169,assembly=b37>
+##contig=<ID=GL000218.1,length=161147,assembly=b37>
+##contig=<ID=GL000220.1,length=161802,assembly=b37>
+##contig=<ID=GL000213.1,length=164239,assembly=b37>
+##contig=<ID=GL000211.1,length=166566,assembly=b37>
+##contig=<ID=GL000199.1,length=169874,assembly=b37>
+##contig=<ID=GL000217.1,length=172149,assembly=b37>
+##contig=<ID=GL000216.1,length=172294,assembly=b37>
+##contig=<ID=GL000215.1,length=172545,assembly=b37>
+##contig=<ID=GL000205.1,length=174588,assembly=b37>
+##contig=<ID=GL000219.1,length=179198,assembly=b37>
+##contig=<ID=GL000224.1,length=179693,assembly=b37>
+##contig=<ID=GL000223.1,length=180455,assembly=b37>
+##contig=<ID=GL000195.1,length=182896,assembly=b37>
+##contig=<ID=GL000212.1,length=186858,assembly=b37>
+##contig=<ID=GL000222.1,length=186861,assembly=b37>
+##contig=<ID=GL000200.1,length=187035,assembly=b37>
+##contig=<ID=GL000193.1,length=189789,assembly=b37>
+##contig=<ID=GL000194.1,length=191469,assembly=b37>
+##contig=<ID=GL000225.1,length=211173,assembly=b37>
+##contig=<ID=GL000192.1,length=547496,assembly=b37>
+##INFO=<ID=OLD_MULTIALLELIC,Number=1,Type=String,Description="Original chr:pos:ref:alt encoding">
+##INFO=<ID=OLD_VARIANT,Number=.,Type=String,Description="Original chr:pos:ref:alt encoding">
+##VEP="v95" time="2019-01-24 15:35:16" ensembl-funcgen=95.94439f4 ensembl-io=95.bd1a78d ensembl-variation=95.858de3e ensembl=95.4f83453 1000genomes="phase3" COSMIC="86" ClinVar="201810" ESP="20141103" HGMD-PUBLIC="20174" assembly="GRCh37.p13" dbSNP="151" gencode="GENCODE 19" genebuild="2011-04" gnomAD="170228" polyphen="2.2.2" refseq="01_2015" regbuild="1.0" sift="sift5.2.2"
+##INFO=<ID=CSQ,Number=.,Type=String,Description="Consequence annotations from Ensembl VEP. Format: Allele|Consequence|IMPACT|SYMBOL|Gene|Feature_type|Feature|BIOTYPE|EXON|INTRON|HGVSc|HGVSp|cDNA_position|CDS_position|Protein_position|Amino_acids|Codons|Existing_variation|ALLELE_NUM|DISTANCE|STRAND|FLAGS|VARIANT_CLASS|SYMBOL_SOURCE|HGNC_ID|CANONICAL|TSL|APPRIS|CCDS|ENSP|SWISSPROT|TREMBL|UNIPARC|REFSEQ_MATCH|SOURCE|GIVEN_REF|USED_REF|BAM_EDIT|GENE_PHENO|SIFT|PolyPhen|DOMAINS|miRNA|HGVS_OFFSET|AF|AFR_AF|AMR_AF|EAS_AF|EUR_AF|SAS_AF|AA_AF|EA_AF|gnomAD_AF|gnomAD_AFR_AF|gnomAD_AMR_AF|gnomAD_ASJ_AF|gnomAD_EAS_AF|gnomAD_FIN_AF|gnomAD_NFE_AF|gnomAD_OTH_AF|gnomAD_SAS_AF|MAX_AF|MAX_AF_POPS|CLIN_SIG|SOMATIC|PHENO|PUBMED|MOTIF_NAME|MOTIF_POS|HIGH_INF_POS|MOTIF_SCORE_CHANGE|LoF|LoF_filter|LoF_flags|LoF_info">
+##LoF=Loss-of-function annotation (HC = High Confidence; LC = Low Confidence)
+##LoF_filter=Reason for LoF not being HC
+##LoF_flags=Possible warning flags for LoF
+##LoF_info=Info used for LoF annotation
+##bcftools_normVersion=1.2+htslib-1.2.1
+##bcftools_normCommand=norm -m+any -Oz ACpop.vep.vcf.gz
+22	18118637	22:30786	A	G	212919	PASS	AC=600;AF=1;AN=600;BaseQRankSum=1.45;ClippingRankSum=1.24;DP=7320;FS=0;GQ_MEAN=69.99;GQ_STDDEV=18.61;HW=0;InbreedingCoeff=-0;MLEAC=600;MLEAF=1;MQ=60;MQ0=0;MQRankSum=-0.413;NCC=0;QD=29.98;ReadPosRankSum=0.867;SOR=0.162;VQSLOD=3.22;culprit=FS;CSQ=G|upstream_gene_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||||||||||rs4256048|1|2719|1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||||||||||rs4256048|1|2893|1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||||||||||rs4256048|1|2940|1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399781|processed_transcript||1/4|ENST00000399781.1:n.53-2231A>G|||||||rs4256048|1||1||SNV|HGNC|17164||||||||||Ensembl|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399782|protein_coding||1/6|ENST00000399782.1:c.-649-2231A>G|||||||rs4256048|1||1||SNV|HGNC|17164|||||ENSP00000382682|Q9BXK5||UPI000002A4BC||Ensembl|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000464649|processed_transcript||||||||||rs4256048|1|2886|1||SNV|HGNC|17164||||||||||Ensembl|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000493680|protein_coding||||||||||rs4256048|1|2901|1||SNV|HGNC|17164|||||ENSP00000434764|Q9BXK5||UPI000002A4BC||Ensembl|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||||||||||rs4256048|1|2870|1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||||||||||rs4256048|1|2886|1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||||||||||rs4256048|1|2870|1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||||||||||rs4256048|1|2713|1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||||||||||rs4256048|1|2713|1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||||||||||rs4256048|1|2713|1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||||||||||rs4256048|1|2713|1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||||||||||rs4256048|1|2713|1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||||||||||rs4256048|1|2713|1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||||||||||rs4256048|1|2713|1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||||||||||rs4256048|1|2713|1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||||||||||rs4256048|1|2713|1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||||||||||rs4256048|1|2713|1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||1/6|XM_005261231.1:c.-592-2231A>G|||||||rs4256048|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|upstream_gene_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261232.1|protein_coding||||||||||rs4256048|1|2713|1||SNV|EntrezGene|17164|||||XP_005261289.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||1/5|XM_005261233.1:c.-835-2231A>G|||||||rs4256048|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|A|A||||||||1|1|1|1|1|1||||||||||||1|AFR&AMR&EAS&EUR&SAS||||||||||||
+22	18159071	22:31233	CA	C	159520	PASS	AC=526;AF=0.877;AN=600;BaseQRankSum=0.213;ClippingRankSum=-0.194;DP=7580;FS=0.967;GQ_MEAN=87.66;GQ_STDDEV=54.47;HW=10.9;InbreedingCoeff=-0.1107;MLEAC=527;MLEAF=0.878;MQ=60;MQ0=0;MQRankSum=0.024;NCC=0;POSITIVE_TRAIN_SITE;QD=23.78;ReadPosRankSum=0.588;SOR=0.707;VQSLOD=3.21;culprit=FS;CSQ=-|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||2/6|ENST00000317582.5:c.122-6900del|||||||rs11343596|1||1||deletion|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||2/4|ENST00000337612.5:c.-138-6900del|||||||rs11343596|1||1||deletion|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||2/4|ENST00000355028.3:c.122-6900del|||||||rs11343596|1||1||deletion|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399781|processed_transcript||3/4|ENST00000399781.1:n.823-6900del|||||||rs11343596|1||1||deletion|HGNC|17164||||||||||Ensembl|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399782|protein_coding||3/6|ENST00000399782.1:c.122-6900del|||||||rs11343596|1||1||deletion|HGNC|17164|||||ENSP00000382682|Q9BXK5||UPI000002A4BC||Ensembl|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||1/4|ENST00000418951.2:c.122-6900del|||||||rs11343596|1||1||deletion|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000464649|processed_transcript||1/3|ENST00000464649.1:n.131-6900del|||||||rs11343596|1||1||deletion|HGNC|17164||||||||||Ensembl|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000493680|protein_coding||2/5|ENST00000493680.1:c.122-6900del|||||||rs11343596|1||1||deletion|HGNC|17164|||||ENSP00000434764|Q9BXK5||UPI000002A4BC||Ensembl|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||2/5|ENST00000498133.1:c.122-6900del|||||||rs11343596|1||1||deletion|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||2/3|ENST00000538149.1:c.84+20482del|||||||rs11343596|1||1||deletion|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||2/5|ENST00000543133.1:c.-208-6900del|||||||rs11343596|1||1||deletion|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||1/5|NM_001270726.1:c.194-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||1/4|NM_001270727.1:c.194-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||2/3|NM_001270728.1:c.121+20482del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||2/5|NM_001270729.1:c.-208-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||1/4|NM_001270730.1:c.-208-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||2/5|NM_001270731.1:c.-295-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||2/4|NM_001270732.1:c.122-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||2/4|NM_001270734.1:c.122-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||2/3|NM_001270735.1:c.122-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||2/6|NM_015367.3:c.122-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||NP_056182.2|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||2/4|NR_073068.1:n.287-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164||||||||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||1/4|NR_073069.1:n.172-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164||||||||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||2/6|XM_005261231.1:c.194-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261232.1|protein_coding||2/5|XM_005261232.1:c.122-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||XP_005261289.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||3/5|XM_005261233.1:c.122-6900del|||||||rs11343596|1||1||deletion|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|A|A|||||||8|||||||||||||||||||||||||||||||
+22	18159407	22:31235	T	C	253125	PASS	AC=524;AF=0.873;AN=600;BaseQRankSum=-2.616;ClippingRankSum=-0.155;DP=10409;FS=0;GQ_MEAN=164.99;GQ_STDDEV=123.97;HW=12;InbreedingCoeff=-0.1149;MLEAC=524;MLEAF=0.873;MQ=60;MQ0=0;MQRankSum=-0.121;NCC=0;POSITIVE_TRAIN_SITE;QD=24.69;ReadPosRankSum=0.347;SOR=0.713;VQSLOD=6.91;culprit=FS;CSQ=C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||2/6|ENST00000317582.5:c.122-6573T>C|||||||rs2535694|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||2/4|ENST00000337612.5:c.-138-6573T>C|||||||rs2535694|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||2/4|ENST00000355028.3:c.122-6573T>C|||||||rs2535694|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399781|processed_transcript||3/4|ENST00000399781.1:n.823-6573T>C|||||||rs2535694|1||1||SNV|HGNC|17164||||||||||Ensembl|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399782|protein_coding||3/6|ENST00000399782.1:c.122-6573T>C|||||||rs2535694|1||1||SNV|HGNC|17164|||||ENSP00000382682|Q9BXK5||UPI000002A4BC||Ensembl|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||1/4|ENST00000418951.2:c.122-6573T>C|||||||rs2535694|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000464649|processed_transcript||1/3|ENST00000464649.1:n.131-6573T>C|||||||rs2535694|1||1||SNV|HGNC|17164||||||||||Ensembl|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000493680|protein_coding||2/5|ENST00000493680.1:c.122-6573T>C|||||||rs2535694|1||1||SNV|HGNC|17164|||||ENSP00000434764|Q9BXK5||UPI000002A4BC||Ensembl|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||2/5|ENST00000498133.1:c.122-6573T>C|||||||rs2535694|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||2/3|ENST00000538149.1:c.84+20809T>C|||||||rs2535694|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||2/5|ENST00000543133.1:c.-208-6573T>C|||||||rs2535694|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||1/5|NM_001270726.1:c.194-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||1/4|NM_001270727.1:c.194-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||2/3|NM_001270728.1:c.121+20809T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||2/5|NM_001270729.1:c.-208-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||1/4|NM_001270730.1:c.-208-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||2/5|NM_001270731.1:c.-295-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||2/4|NM_001270732.1:c.122-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||2/4|NM_001270734.1:c.122-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||2/3|NM_001270735.1:c.122-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||2/6|NM_015367.3:c.122-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||2/4|NR_073068.1:n.287-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164||||||||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||1/4|NR_073069.1:n.172-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164||||||||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||2/6|XM_005261231.1:c.194-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261232.1|protein_coding||2/5|XM_005261232.1:c.122-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||XP_005261289.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||3/5|XM_005261233.1:c.122-6573T>C|||||||rs2535694|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|T|T||||||||0.8646|0.9281|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||
+22	18163136	22:31270	A	C	167770	PASS	AC=519;AF=0.868;AN=598;BaseQRankSum=0.67;ClippingRankSum=-0.34;DP=6358;FS=1.964;GQ_MEAN=88.4;GQ_STDDEV=77.33;HW=1.1;InbreedingCoeff=-0.0744;MLEAC=522;MLEAF=0.873;MQ=59.45;MQ0=0;MQRankSum=0.102;NCC=1;NEGATIVE_TRAIN_SITE;POSITIVE_TRAIN_SITE;QD=29.62;ReadPosRankSum=0.274;SOR=0.53;VQSLOD=0.808;culprit=FS;CSQ=C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||2/6|ENST00000317582.5:c.122-2844A>C|||||||rs9605381|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||2/4|ENST00000337612.5:c.-138-2844A>C|||||||rs9605381|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||2/4|ENST00000355028.3:c.122-2844A>C|||||||rs9605381|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399781|processed_transcript||3/4|ENST00000399781.1:n.823-2844A>C|||||||rs9605381|1||1||SNV|HGNC|17164||||||||||Ensembl|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399782|protein_coding||3/6|ENST00000399782.1:c.122-2844A>C|||||||rs9605381|1||1||SNV|HGNC|17164|||||ENSP00000382682|Q9BXK5||UPI000002A4BC||Ensembl|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||1/4|ENST00000418951.2:c.122-2844A>C|||||||rs9605381|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000464649|processed_transcript||1/3|ENST00000464649.1:n.131-2844A>C|||||||rs9605381|1||1||SNV|HGNC|17164||||||||||Ensembl|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000493680|protein_coding||2/5|ENST00000493680.1:c.122-2844A>C|||||||rs9605381|1||1||SNV|HGNC|17164|||||ENSP00000434764|Q9BXK5||UPI000002A4BC||Ensembl|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||2/5|ENST00000498133.1:c.122-2844A>C|||||||rs9605381|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||2/3|ENST00000538149.1:c.85-21873A>C|||||||rs9605381|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||2/5|ENST00000543133.1:c.-208-2844A>C|||||||rs9605381|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||1/5|NM_001270726.1:c.194-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||1/4|NM_001270727.1:c.194-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||2/3|NM_001270728.1:c.122-21873A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||2/5|NM_001270729.1:c.-208-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||1/4|NM_001270730.1:c.-208-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||2/5|NM_001270731.1:c.-295-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||2/4|NM_001270732.1:c.122-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||2/4|NM_001270734.1:c.122-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||2/3|NM_001270735.1:c.122-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||2/6|NM_015367.3:c.122-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||2/4|NR_073068.1:n.287-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||1/4|NR_073069.1:n.172-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||2/6|XM_005261231.1:c.194-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261232.1|protein_coding||2/5|XM_005261232.1:c.122-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||XP_005261289.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||3/5|XM_005261233.1:c.122-2844A>C|||||||rs9605381|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|A|A||||||||0.8524|0.885|0.8473|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||
+22	18163308	22:31280	G	A	49925.8	VQSRTrancheSNP99.70to99.90	AC=409;AF=0.746;AN=548;BaseQRankSum=0.573;ClippingRankSum=0.135;DP=3616;FS=3.907;GQ_MEAN=30.94;GQ_STDDEV=30.13;HW=137.2;InbreedingCoeff=0.256;MLEAC=455;MLEAF=0.83;MQ=58.52;MQ0=0;MQRankSum=0.289;NCC=26;NEGATIVE_TRAIN_SITE;QD=24.33;ReadPosRankSum=0.067;SOR=0.731;VQSLOD=-3.268;culprit=DP;CSQ=A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||2/6|ENST00000317582.5:c.122-2672G>A|||||||rs3994810|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||2/4|ENST00000337612.5:c.-138-2672G>A|||||||rs3994810|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||2/4|ENST00000355028.3:c.122-2672G>A|||||||rs3994810|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399781|processed_transcript||3/4|ENST00000399781.1:n.823-2672G>A|||||||rs3994810|1||1||SNV|HGNC|17164||||||||||Ensembl|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399782|protein_coding||3/6|ENST00000399782.1:c.122-2672G>A|||||||rs3994810|1||1||SNV|HGNC|17164|||||ENSP00000382682|Q9BXK5||UPI000002A4BC||Ensembl|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||1/4|ENST00000418951.2:c.122-2672G>A|||||||rs3994810|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000464649|processed_transcript||1/3|ENST00000464649.1:n.131-2672G>A|||||||rs3994810|1||1||SNV|HGNC|17164||||||||||Ensembl|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000493680|protein_coding||2/5|ENST00000493680.1:c.122-2672G>A|||||||rs3994810|1||1||SNV|HGNC|17164|||||ENSP00000434764|Q9BXK5||UPI000002A4BC||Ensembl|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||2/5|ENST00000498133.1:c.122-2672G>A|||||||rs3994810|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||2/3|ENST00000538149.1:c.85-21701G>A|||||||rs3994810|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||2/5|ENST00000543133.1:c.-208-2672G>A|||||||rs3994810|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||1/5|NM_001270726.1:c.194-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||1/4|NM_001270727.1:c.194-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||2/3|NM_001270728.1:c.122-21701G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||2/5|NM_001270729.1:c.-208-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||1/4|NM_001270730.1:c.-208-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||2/5|NM_001270731.1:c.-295-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||2/4|NM_001270732.1:c.122-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||2/4|NM_001270734.1:c.122-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||2/3|NM_001270735.1:c.122-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||2/6|NM_015367.3:c.122-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||2/4|NR_073068.1:n.287-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164||||||||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||1/4|NR_073069.1:n.172-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164||||||||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||2/6|XM_005261231.1:c.194-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261232.1|protein_coding||2/5|XM_005261232.1:c.122-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||XP_005261289.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||3/5|XM_005261233.1:c.122-2672G>A|||||||rs3994810|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|G|G||||||||||||||||||||||||||||||||||||||
+22	18167478	22:31314	T	C	84068	PASS	AC=365;AF=0.608;AN=600;BaseQRankSum=-1.48;ClippingRankSum=0.025;DP=5798;FS=0;GQ_MEAN=99.01;GQ_STDDEV=72.3;HW=1.6;InbreedingCoeff=0.0153;MLEAC=368;MLEAF=0.613;MQ=60;MQ0=0;MQRankSum=-0.045;NCC=0;POSITIVE_TRAIN_SITE;QD=19.03;ReadPosRankSum=0.143;SOR=0.641;VQSLOD=2.38;culprit=FS;CSQ=C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||3/6|ENST00000317582.5:c.229+1391T>C|||||||rs5747326|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||3/4|ENST00000337612.5:c.-31+1391T>C|||||||rs5747326|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||3/4|ENST00000355028.3:c.229+1391T>C|||||||rs5747326|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|upstream_gene_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399777|nonsense_mediated_decay||||||||||rs5747326|1|4362|1|cds_start_NF|SNV|HGNC|17164|||||ENSP00000382677|||UPI0001F77C70||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399781|processed_transcript||4/4|ENST00000399781.1:n.930+1391T>C|||||||rs5747326|1||1||SNV|HGNC|17164||||||||||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399782|protein_coding||4/6|ENST00000399782.1:c.229+1391T>C|||||||rs5747326|1||1||SNV|HGNC|17164|||||ENSP00000382682|Q9BXK5||UPI000002A4BC||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|splice_region_variant&intron_variant|LOW|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||3/4|ENST00000418951.2:c.*12+6T>C|||||||rs5747326|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000464649|processed_transcript||2/3|ENST00000464649.1:n.238+1391T>C|||||||rs5747326|1||1||SNV|HGNC|17164||||||||||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000493680|protein_coding||3/5|ENST00000493680.1:c.229+1391T>C|||||||rs5747326|1||1||SNV|HGNC|17164|||||ENSP00000434764|Q9BXK5||UPI000002A4BC||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||3/5|ENST00000498133.1:c.229+1391T>C|||||||rs5747326|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||2/3|ENST00000538149.1:c.85-17531T>C|||||||rs5747326|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||3/5|ENST00000543133.1:c.-101+1391T>C|||||||rs5747326|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||2/5|NM_001270726.1:c.301+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||2/4|NM_001270727.1:c.301+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||2/3|NM_001270728.1:c.122-17531T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||3/5|NM_001270729.1:c.-101+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||2/4|NM_001270730.1:c.-101+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||3/5|NM_001270731.1:c.-188+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||3/4|NM_001270732.1:c.229+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||3/4|NM_001270734.1:c.229+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||3/3|NM_001270735.1:c.229+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||3/6|NM_015367.3:c.229+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||3/4|NR_073068.1:n.394+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164||||||||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|splice_region_variant&intron_variant&non_coding_transcript_variant|LOW|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||3/4|NR_073069.1:n.377+6T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164||||||||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||3/6|XM_005261231.1:c.301+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261232.1|protein_coding||3/5|XM_005261232.1:c.229+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||XP_005261289.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||4/5|XM_005261233.1:c.229+1391T>C|||||||rs5747326|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|T|T|||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||,C|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000143556|promoter_flanking_region||||||||||rs5747326|1||||SNV|||||||||||||||||||||||0.7821|0.7133|0.8502|0.6501|0.7127|||0.713|0.7701|0.7356|0.6607|0.8534|0.6225|0.6667|0.677|0.7406|0.8534|gnomAD_EAS||||||||||||
+22	18184011	22:31473	G	A	289332	PASS	AC=524;AF=0.873;AN=600;BaseQRankSum=0.919;ClippingRankSum=0.106;DP=10746;FS=0;GQ_MEAN=170.44;GQ_STDDEV=125.89;HW=12;InbreedingCoeff=-0.1149;MLEAC=524;MLEAF=0.873;MQ=60;MQ0=0;MQRankSum=0.266;NCC=0;POSITIVE_TRAIN_SITE;QD=27.42;ReadPosRankSum=0.361;SOR=0.617;VQSLOD=3.7;culprit=FS;CSQ=A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||5/6|ENST00000317582.5:c.457-998G>A|||||||rs2587082|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||3/4|ENST00000337612.5:c.-30-998G>A|||||||rs2587082|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||4/4|ENST00000355028.3:c.386+12103G>A|||||||rs2587082|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399777|nonsense_mediated_decay||1/2|ENST00000399777.1:c.70-998G>A|||||||rs2587082|1||1|cds_start_NF|SNV|HGNC|17164|||||ENSP00000382677|||UPI0001F77C70||Ensembl|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399782|protein_coding||6/6|ENST00000399782.1:c.457-998G>A|||||||rs2587082|1||1||SNV|HGNC|17164|||||ENSP00000382682|Q9BXK5||UPI000002A4BC||Ensembl|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||4/4|ENST00000418951.2:c.*169+12103G>A|||||||rs2587082|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000479296|processed_transcript||1/1|ENST00000479296.1:n.474-998G>A|||||||rs2587082|1||1||SNV|HGNC|17164||||||||||Ensembl|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000493680|protein_coding||5/5|ENST00000493680.1:c.457-998G>A|||||||rs2587082|1||1||SNV|HGNC|17164|||||ENSP00000434764|Q9BXK5||UPI000002A4BC||Ensembl|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||4/5|ENST00000498133.1:c.*63-998G>A|||||||rs2587082|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||2/3|ENST00000538149.1:c.85-998G>A|||||||rs2587082|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||4/5|ENST00000543133.1:c.-30-998G>A|||||||rs2587082|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||4/5|NM_001270726.1:c.529-998G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||4/4|NM_001270727.1:c.528+5035G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||2/3|NM_001270728.1:c.122-998G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||4/5|NM_001270729.1:c.-30-998G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||3/4|NM_001270730.1:c.-30-998G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||4/5|NM_001270731.1:c.-30-998G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||3/4|NM_001270732.1:c.230-998G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||4/4|NM_001270734.1:c.386+12103G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||3/3|NM_001270735.1:c.229+17924G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||5/6|NM_015367.3:c.457-998G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||4/4|NR_073068.1:n.551+12103G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164||||||||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||4/4|NR_073069.1:n.534+12103G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164||||||||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||5/6|XM_005261231.1:c.529-998G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261232.1|protein_coding||5/5|XM_005261232.1:c.457-998G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||XP_005261289.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,A|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||4/5|XM_005261233.1:c.230-998G>A|||||||rs2587082|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|G|G||||||||0.8586|0.9085|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||
+22	18184290	22:31475	T	C	242253	PASS	AC=524;AF=0.873;AN=600;BaseQRankSum=-2.561;ClippingRankSum=-0.19;DP=10394;FS=0.846;GQ_MEAN=158.54;GQ_STDDEV=113.22;HW=12;InbreedingCoeff=-0.1149;MLEAC=524;MLEAF=0.873;MQ=60;MQ0=0;MQRankSum=-0.06;NCC=0;POSITIVE_TRAIN_SITE;QD=24.06;ReadPosRankSum=0.315;SOR=0.858;VQSLOD=3.93;culprit=SOR;CSQ=C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||5/6|ENST00000317582.5:c.457-719T>C|||||||rs2587083|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||3/4|ENST00000337612.5:c.-30-719T>C|||||||rs2587083|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||4/4|ENST00000355028.3:c.386+12382T>C|||||||rs2587083|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399777|nonsense_mediated_decay||1/2|ENST00000399777.1:c.70-719T>C|||||||rs2587083|1||1|cds_start_NF|SNV|HGNC|17164|||||ENSP00000382677|||UPI0001F77C70||Ensembl|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399782|protein_coding||6/6|ENST00000399782.1:c.457-719T>C|||||||rs2587083|1||1||SNV|HGNC|17164|||||ENSP00000382682|Q9BXK5||UPI000002A4BC||Ensembl|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||4/4|ENST00000418951.2:c.*169+12382T>C|||||||rs2587083|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000479296|processed_transcript||1/1|ENST00000479296.1:n.474-719T>C|||||||rs2587083|1||1||SNV|HGNC|17164||||||||||Ensembl|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000493680|protein_coding||5/5|ENST00000493680.1:c.457-719T>C|||||||rs2587083|1||1||SNV|HGNC|17164|||||ENSP00000434764|Q9BXK5||UPI000002A4BC||Ensembl|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||4/5|ENST00000498133.1:c.*63-719T>C|||||||rs2587083|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||2/3|ENST00000538149.1:c.85-719T>C|||||||rs2587083|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||4/5|ENST00000543133.1:c.-30-719T>C|||||||rs2587083|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||4/5|NM_001270726.1:c.529-719T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||4/4|NM_001270727.1:c.528+5314T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||2/3|NM_001270728.1:c.122-719T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||4/5|NM_001270729.1:c.-30-719T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||3/4|NM_001270730.1:c.-30-719T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||4/5|NM_001270731.1:c.-30-719T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||3/4|NM_001270732.1:c.230-719T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||4/4|NM_001270734.1:c.386+12382T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||3/3|NM_001270735.1:c.229+18203T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||5/6|NM_015367.3:c.457-719T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||4/4|NR_073068.1:n.551+12382T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164||||||||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||4/4|NR_073069.1:n.534+12382T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164||||||||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||5/6|XM_005261231.1:c.529-719T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261232.1|protein_coding||5/5|XM_005261232.1:c.457-719T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||XP_005261289.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||4/5|XM_005261233.1:c.230-719T>C|||||||rs2587083|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|T|T|||||||||0.9864|0.8545|0.9375|0.8151|0.7628||||||||||||0.9864|AFR||||||||||||
+22	18191951	22:31517	A	G	190711	PASS	AC=531;AF=0.885;AN=600;BaseQRankSum=-1.061;ClippingRankSum=0.158;DP=8191;FS=0;GQ_MEAN=110.31;GQ_STDDEV=78.83;HW=8.4;InbreedingCoeff=-0.0972;MLEAC=531;MLEAF=0.885;MQ=59.4;MQ0=0;MQRankSum=0.035;NCC=0;POSITIVE_TRAIN_SITE;QD=24.2;ReadPosRankSum=0.246;SOR=0.613;VQSLOD=3.94;culprit=FS;CSQ=G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||6/6|ENST00000317582.5:c.600+6799A>G|||||||rs2535711|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||4/4|ENST00000337612.5:c.114+6799A>G|||||||rs2535711|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||4/4|ENST00000355028.3:c.387-17492A>G|||||||rs2535711|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399777|nonsense_mediated_decay||2/2|ENST00000399777.1:c.*98+6799A>G|||||||rs2535711|1||1|cds_start_NF|SNV|HGNC|17164|||||ENSP00000382677|||UPI0001F77C70||Ensembl|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||4/4|ENST00000418951.2:c.*170-17492A>G|||||||rs2535711|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000485631|processed_transcript||1/1|ENST00000485631.1:n.116+2360A>G|||||||rs2535711|1||1||SNV|HGNC|17164||||||||||Ensembl|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||5/5|ENST00000498133.1:c.*206+6799A>G|||||||rs2535711|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||3/3|ENST00000538149.1:c.228+6799A>G|||||||rs2535711|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||5/5|ENST00000543133.1:c.114+6799A>G|||||||rs2535711|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||5/5|NM_001270726.1:c.672+6799A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||4/4|NM_001270727.1:c.528+12975A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||3/3|NM_001270728.1:c.265+6799A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||5/5|NM_001270729.1:c.114+6799A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||4/4|NM_001270730.1:c.114+6799A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||5/5|NM_001270731.1:c.114+6799A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||4/4|NM_001270732.1:c.373+6799A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270733.1|protein_coding||1/1|NM_001270733.1:c.-241+2360A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||NP_001257662.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||4/4|NM_001270734.1:c.387-17492A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||3/3|NM_001270735.1:c.230-17492A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||6/6|NM_015367.3:c.600+6799A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||4/4|NR_073068.1:n.552-17492A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||4/4|NR_073069.1:n.535-17492A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||6/6|XM_005261231.1:c.672+6799A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||5/5|XM_005261233.1:c.373+6799A>G|||||||rs2535711|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|A|A|||||||||0.9289|0.853|0.9375|0.8151|0.7618||||||||||||0.9375|EAS||||||||||||
+22	18192136	22:31518	A	G	238291	PASS	AC=531;AF=0.885;AN=600;BaseQRankSum=-2.317;ClippingRankSum=-0.205;DP=9824;FS=0;GQ_MEAN=142.78;GQ_STDDEV=109.18;HW=8.4;InbreedingCoeff=-0.0972;MLEAC=531;MLEAF=0.885;MQ=60;MQ0=0;MQRankSum=-0.037;NCC=0;POSITIVE_TRAIN_SITE;QD=25.06;ReadPosRankSum=0.154;SOR=0.624;VQSLOD=4.27;culprit=FS;CSQ=G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||6/6|ENST00000317582.5:c.600+6984A>G|||||||rs2535712|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||4/4|ENST00000337612.5:c.114+6984A>G|||||||rs2535712|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||4/4|ENST00000355028.3:c.387-17307A>G|||||||rs2535712|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399777|nonsense_mediated_decay||2/2|ENST00000399777.1:c.*98+6984A>G|||||||rs2535712|1||1|cds_start_NF|SNV|HGNC|17164|||||ENSP00000382677|||UPI0001F77C70||Ensembl|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||4/4|ENST00000418951.2:c.*170-17307A>G|||||||rs2535712|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000485631|processed_transcript||1/1|ENST00000485631.1:n.116+2545A>G|||||||rs2535712|1||1||SNV|HGNC|17164||||||||||Ensembl|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||5/5|ENST00000498133.1:c.*206+6984A>G|||||||rs2535712|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||3/3|ENST00000538149.1:c.228+6984A>G|||||||rs2535712|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||5/5|ENST00000543133.1:c.114+6984A>G|||||||rs2535712|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||5/5|NM_001270726.1:c.672+6984A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||4/4|NM_001270727.1:c.528+13160A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||3/3|NM_001270728.1:c.265+6984A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||5/5|NM_001270729.1:c.114+6984A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||4/4|NM_001270730.1:c.114+6984A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||5/5|NM_001270731.1:c.114+6984A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||4/4|NM_001270732.1:c.373+6984A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270733.1|protein_coding||1/1|NM_001270733.1:c.-241+2545A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||NP_001257662.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||4/4|NM_001270734.1:c.387-17307A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||3/3|NM_001270735.1:c.230-17307A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||6/6|NM_015367.3:c.600+6984A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||4/4|NR_073068.1:n.552-17307A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||4/4|NR_073069.1:n.535-17307A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||6/6|XM_005261231.1:c.672+6984A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||5/5|XM_005261233.1:c.373+6984A>G|||||||rs2535712|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|A|A||||||||0.8582|0.907|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||
+22	18193560	22:31532	A	G	181696	PASS	AC=529;AF=0.882;AN=600;BaseQRankSum=-0.965;ClippingRankSum=0.107;DP=7200;FS=0;GQ_MEAN=105.35;GQ_STDDEV=81.44;HW=9.4;InbreedingCoeff=-0.1017;MLEAC=530;MLEAF=0.883;MQ=60;MQ0=0;MQRankSum=-0.047;NCC=0;POSITIVE_TRAIN_SITE;QD=26.27;ReadPosRankSum=0.35;SOR=0.737;VQSLOD=3.52;culprit=FS;CSQ=G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||6/6|ENST00000317582.5:c.600+8408A>G|||||||rs4819462|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||4/4|ENST00000337612.5:c.114+8408A>G|||||||rs4819462|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||4/4|ENST00000355028.3:c.387-15883A>G|||||||rs4819462|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399777|nonsense_mediated_decay||2/2|ENST00000399777.1:c.*98+8408A>G|||||||rs4819462|1||1|cds_start_NF|SNV|HGNC|17164|||||ENSP00000382677|||UPI0001F77C70||Ensembl|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||4/4|ENST00000418951.2:c.*170-15883A>G|||||||rs4819462|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000485631|processed_transcript||1/1|ENST00000485631.1:n.116+3969A>G|||||||rs4819462|1||1||SNV|HGNC|17164||||||||||Ensembl|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||5/5|ENST00000498133.1:c.*206+8408A>G|||||||rs4819462|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||3/3|ENST00000538149.1:c.228+8408A>G|||||||rs4819462|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||5/5|ENST00000543133.1:c.114+8408A>G|||||||rs4819462|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||5/5|NM_001270726.1:c.672+8408A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||4/4|NM_001270727.1:c.528+14584A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||3/3|NM_001270728.1:c.265+8408A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||5/5|NM_001270729.1:c.114+8408A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||4/4|NM_001270730.1:c.114+8408A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||5/5|NM_001270731.1:c.114+8408A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||4/4|NM_001270732.1:c.373+8408A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270733.1|protein_coding||1/1|NM_001270733.1:c.-241+3969A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||NP_001257662.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||4/4|NM_001270734.1:c.387-15883A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||3/3|NM_001270735.1:c.230-15883A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||6/6|NM_015367.3:c.600+8408A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||4/4|NR_073068.1:n.552-15883A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||4/4|NR_073069.1:n.535-15883A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||6/6|XM_005261231.1:c.672+8408A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||5/5|XM_005261233.1:c.373+8408A>G|||||||rs4819462|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|A|A|||||||||0.9092|0.8501|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||
+22	18197172	22:31561	G	C	192554	PASS	AC=522;AF=0.87;AN=600;BaseQRankSum=-1.623;ClippingRankSum=-0.075;DP=7689;FS=0;GQ_MEAN=115.53;GQ_STDDEV=96.12;HW=7.4;InbreedingCoeff=-0.1035;MLEAC=523;MLEAF=0.872;MQ=60;MQ0=0;MQRankSum=0.026;NCC=0;POSITIVE_TRAIN_SITE;QD=25.84;ReadPosRankSum=0.416;SOR=0.621;VQSLOD=3.47;culprit=FS;CSQ=C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||6/6|ENST00000317582.5:c.600+12020G>C|||||||rs5992098|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||4/4|ENST00000337612.5:c.114+12020G>C|||||||rs5992098|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||4/4|ENST00000355028.3:c.387-12271G>C|||||||rs5992098|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399777|nonsense_mediated_decay||2/2|ENST00000399777.1:c.*98+12020G>C|||||||rs5992098|1||1|cds_start_NF|SNV|HGNC|17164|||||ENSP00000382677|||UPI0001F77C70||Ensembl|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||4/4|ENST00000418951.2:c.*170-12271G>C|||||||rs5992098|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000485631|processed_transcript||1/1|ENST00000485631.1:n.116+7581G>C|||||||rs5992098|1||1||SNV|HGNC|17164||||||||||Ensembl|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||5/5|ENST00000498133.1:c.*206+12020G>C|||||||rs5992098|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||3/3|ENST00000538149.1:c.228+12020G>C|||||||rs5992098|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||5/5|ENST00000543133.1:c.114+12020G>C|||||||rs5992098|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||5/5|NM_001270726.1:c.672+12020G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||4/4|NM_001270727.1:c.529-12271G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||3/3|NM_001270728.1:c.265+12020G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||5/5|NM_001270729.1:c.114+12020G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||4/4|NM_001270730.1:c.114+12020G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||5/5|NM_001270731.1:c.114+12020G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||4/4|NM_001270732.1:c.373+12020G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270733.1|protein_coding||1/1|NM_001270733.1:c.-241+7581G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||NP_001257662.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||4/4|NM_001270734.1:c.387-12271G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||3/3|NM_001270735.1:c.230-12271G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||6/6|NM_015367.3:c.600+12020G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||4/4|NR_073068.1:n.552-12271G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164||||||||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||4/4|NR_073069.1:n.535-12271G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164||||||||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||6/6|XM_005261231.1:c.672+12020G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||5/5|XM_005261233.1:c.373+12020G>C|||||||rs5992098|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|G|G|||||||||0.9092|0.8516|0.9375|0.8121|0.7628||||||||||||0.9375|EAS||||||||||||
+22	18198327	22:31607	C	G	244937	PASS	AC=524;AF=0.873;AN=600;BaseQRankSum=0.217;ClippingRankSum=0.168;DP=9590;FS=0.858;GQ_MEAN=144.45;GQ_STDDEV=106.27;HW=12;InbreedingCoeff=-0.1149;MLEAC=524;MLEAF=0.873;MQ=60;MQ0=0;MQRankSum=-0.029;NCC=0;POSITIVE_TRAIN_SITE;QD=26.7;ReadPosRankSum=0.491;SOR=0.644;VQSLOD=4.19;culprit=QD;CSQ=G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||6/6|ENST00000317582.5:c.601-11116C>G|||||||rs2109659|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||4/4|ENST00000337612.5:c.115-11116C>G|||||||rs2109659|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||4/4|ENST00000355028.3:c.387-11116C>G|||||||rs2109659|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399777|nonsense_mediated_decay||2/2|ENST00000399777.1:c.*99-11116C>G|||||||rs2109659|1||1|cds_start_NF|SNV|HGNC|17164|||||ENSP00000382677|||UPI0001F77C70||Ensembl|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||4/4|ENST00000418951.2:c.*170-11116C>G|||||||rs2109659|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000485631|processed_transcript||1/1|ENST00000485631.1:n.116+8736C>G|||||||rs2109659|1||1||SNV|HGNC|17164||||||||||Ensembl|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||5/5|ENST00000498133.1:c.*207-11116C>G|||||||rs2109659|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||3/3|ENST00000538149.1:c.229-11116C>G|||||||rs2109659|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||5/5|ENST00000543133.1:c.115-11116C>G|||||||rs2109659|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||5/5|NM_001270726.1:c.673-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||4/4|NM_001270727.1:c.529-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||3/3|NM_001270728.1:c.266-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||5/5|NM_001270729.1:c.115-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||4/4|NM_001270730.1:c.115-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||5/5|NM_001270731.1:c.115-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||4/4|NM_001270732.1:c.374-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270733.1|protein_coding||1/1|NM_001270733.1:c.-241+8736C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||NP_001257662.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||4/4|NM_001270734.1:c.387-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||3/3|NM_001270735.1:c.230-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||6/6|NM_015367.3:c.601-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||4/4|NR_073068.1:n.552-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164||||||||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||4/4|NR_073069.1:n.535-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164||||||||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||6/6|XM_005261231.1:c.673-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||5/5|XM_005261233.1:c.374-11116C>G|||||||rs2109659|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|C|C||||||||0.8648|0.9289|0.853|0.9375|0.8151|0.7628||||||||||||0.9375|EAS||||||||||||
+22	18201526	22:31631	G	C	264315	PASS	AC=524;AF=0.873;AN=600;BaseQRankSum=0.35;ClippingRankSum=-0.161;DP=9775;FS=0;GQ_MEAN=152.14;GQ_STDDEV=114.04;HW=12;InbreedingCoeff=-0.1149;MLEAC=524;MLEAF=0.873;MQ=60;MQ0=0;MQRankSum=0.084;NCC=0;POSITIVE_TRAIN_SITE;QD=27.91;ReadPosRankSum=0.299;SOR=0.745;VQSLOD=6.05;culprit=FS;CSQ=C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||6/6|ENST00000317582.5:c.601-7917G>C|||||||rs2587092|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||4/4|ENST00000337612.5:c.115-7917G>C|||||||rs2587092|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||4/4|ENST00000355028.3:c.387-7917G>C|||||||rs2587092|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399777|nonsense_mediated_decay||2/2|ENST00000399777.1:c.*99-7917G>C|||||||rs2587092|1||1|cds_start_NF|SNV|HGNC|17164|||||ENSP00000382677|||UPI0001F77C70||Ensembl|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||4/4|ENST00000418951.2:c.*170-7917G>C|||||||rs2587092|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000485631|processed_transcript||1/1|ENST00000485631.1:n.117-7917G>C|||||||rs2587092|1||1||SNV|HGNC|17164||||||||||Ensembl|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||5/5|ENST00000498133.1:c.*207-7917G>C|||||||rs2587092|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||3/3|ENST00000538149.1:c.229-7917G>C|||||||rs2587092|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||5/5|ENST00000543133.1:c.115-7917G>C|||||||rs2587092|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||5/5|NM_001270726.1:c.673-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||4/4|NM_001270727.1:c.529-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||3/3|NM_001270728.1:c.266-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||5/5|NM_001270729.1:c.115-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||4/4|NM_001270730.1:c.115-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||5/5|NM_001270731.1:c.115-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||4/4|NM_001270732.1:c.374-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270733.1|protein_coding||1/1|NM_001270733.1:c.-240-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||NP_001257662.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||4/4|NM_001270734.1:c.387-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||3/3|NM_001270735.1:c.230-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||6/6|NM_015367.3:c.601-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||4/4|NR_073068.1:n.552-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164||||||||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||4/4|NR_073069.1:n.535-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164||||||||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||6/6|XM_005261231.1:c.673-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,C|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||5/5|XM_005261233.1:c.374-7917G>C|||||||rs2587092|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|G|G|||||||||0.907|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||
+22	18202129	22:31644	A	G	248026	PASS	AC=524;AF=0.873;AN=600;BaseQRankSum=-0.422;ClippingRankSum=-0.022;DP=9481;FS=1.761;GQ_MEAN=141.64;GQ_STDDEV=111.09;HW=12;InbreedingCoeff=-0.1149;MLEAC=524;MLEAF=0.873;MQ=60;MQ0=0;MQRankSum=0.022;NCC=0;POSITIVE_TRAIN_SITE;QD=28.72;ReadPosRankSum=0.345;SOR=0.612;VQSLOD=3.03;culprit=FS;CSQ=G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||6/6|ENST00000317582.5:c.601-7314A>G|||||||rs2535676|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||4/4|ENST00000337612.5:c.115-7314A>G|||||||rs2535676|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||4/4|ENST00000355028.3:c.387-7314A>G|||||||rs2535676|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399777|nonsense_mediated_decay||2/2|ENST00000399777.1:c.*99-7314A>G|||||||rs2535676|1||1|cds_start_NF|SNV|HGNC|17164|||||ENSP00000382677|||UPI0001F77C70||Ensembl|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||4/4|ENST00000418951.2:c.*170-7314A>G|||||||rs2535676|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000485631|processed_transcript||1/1|ENST00000485631.1:n.117-7314A>G|||||||rs2535676|1||1||SNV|HGNC|17164||||||||||Ensembl|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||5/5|ENST00000498133.1:c.*207-7314A>G|||||||rs2535676|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||3/3|ENST00000538149.1:c.229-7314A>G|||||||rs2535676|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||5/5|ENST00000543133.1:c.115-7314A>G|||||||rs2535676|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||5/5|NM_001270726.1:c.673-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||4/4|NM_001270727.1:c.529-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||3/3|NM_001270728.1:c.266-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||5/5|NM_001270729.1:c.115-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||4/4|NM_001270730.1:c.115-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||5/5|NM_001270731.1:c.115-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||4/4|NM_001270732.1:c.374-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270733.1|protein_coding||1/1|NM_001270733.1:c.-240-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||NP_001257662.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||4/4|NM_001270734.1:c.387-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||3/3|NM_001270735.1:c.230-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||6/6|NM_015367.3:c.601-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||4/4|NR_073068.1:n.552-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||4/4|NR_073069.1:n.535-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||6/6|XM_005261231.1:c.673-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||5/5|XM_005261233.1:c.374-7314A>G|||||||rs2535676|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|A|A|||||||||0.9864|0.8545|0.9375|0.8151|0.7638||||||||||||0.9864|AFR||||||||||||
+22	18202207	22:31646	A	G	265777	PASS	AC=524;AF=0.873;AN=600;BaseQRankSum=0.321;ClippingRankSum=-0.139;DP=11034;FS=0.814;GQ_MEAN=159.7;GQ_STDDEV=119.14;HW=12;InbreedingCoeff=-0.1149;MLEAC=524;MLEAF=0.873;MQ=60;MQ0=0;MQRankSum=-0.116;NCC=0;POSITIVE_TRAIN_SITE;QD=26.43;ReadPosRankSum=0.601;SOR=0.536;VQSLOD=3.05;culprit=QD;CSQ=G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000317582|protein_coding||6/6|ENST00000317582.5:c.601-7236A>G|||||||rs2535677|1||1||SNV|HGNC|17164|YES|||CCDS13746.1|ENSP00000318883|Q9BXK5|B2RB43|UPI000004F301||Ensembl|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000337612|protein_coding||4/4|ENST00000337612.5:c.115-7236A>G|||||||rs2535677|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000338932|Q9BXK5||UPI00001A3E35||Ensembl|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000355028|protein_coding||4/4|ENST00000355028.3:c.387-7236A>G|||||||rs2535677|1||1||SNV|HGNC|17164||||CCDS59447.1|ENSP00000347133||E9PDD6|UPI0000246DFE||Ensembl|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000399777|nonsense_mediated_decay||2/2|ENST00000399777.1:c.*99-7236A>G|||||||rs2535677|1||1|cds_start_NF|SNV|HGNC|17164|||||ENSP00000382677|||UPI0001F77C70||Ensembl|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000418951|protein_coding||4/4|ENST00000418951.2:c.*170-7236A>G|||||||rs2535677|1||1||SNV|HGNC|17164|||||ENSP00000410019||Q8IZP5|UPI00000740D0||Ensembl|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000485631|processed_transcript||1/1|ENST00000485631.1:n.117-7236A>G|||||||rs2535677|1||1||SNV|HGNC|17164||||||||||Ensembl|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000498133|nonsense_mediated_decay||5/5|ENST00000498133.1:c.*207-7236A>G|||||||rs2535677|1||1||SNV|HGNC|17164|||||ENSP00000436321||F2Z2C3|UPI000155D5B6||Ensembl|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000538149|protein_coding||3/3|ENST00000538149.1:c.229-7236A>G|||||||rs2535677|1||1||SNV|HGNC|17164|||||ENSP00000441344||B7Z238|UPI0001914B19||Ensembl|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|ENSG00000099968|Transcript|ENST00000543133|protein_coding||5/5|ENST00000543133.1:c.115-7236A>G|||||||rs2535677|1||1||SNV|HGNC|17164||||CCDS59448.1|ENSP00000437667|Q9BXK5||UPI00001A3E35||Ensembl|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270726.1|protein_coding||5/5|NM_001270726.1:c.673-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||NP_001257655.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270727.1|protein_coding||4/4|NM_001270727.1:c.529-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||NP_001257656.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270728.1|protein_coding||3/3|NM_001270728.1:c.266-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||NP_001257657.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270729.1|protein_coding||5/5|NM_001270729.1:c.115-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||NP_001257658.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270730.1|protein_coding||4/4|NM_001270730.1:c.115-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||NP_001257659.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270731.1|protein_coding||5/5|NM_001270731.1:c.115-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||NP_001257660.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270732.1|protein_coding||4/4|NM_001270732.1:c.374-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||NP_001257661.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270733.1|protein_coding||1/1|NM_001270733.1:c.-240-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||NP_001257662.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270734.1|protein_coding||4/4|NM_001270734.1:c.387-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||NP_001257663.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_001270735.1|protein_coding||3/3|NM_001270735.1:c.230-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||NP_001257664.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|NM_015367.3|protein_coding||6/6|NM_015367.3:c.601-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||NP_056182.2|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073068.1|misc_RNA||4/4|NR_073068.1:n.552-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|BCL2L13|23786|Transcript|NR_073069.1|misc_RNA||4/4|NR_073069.1:n.535-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164||||||||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261231.1|protein_coding||6/6|XM_005261231.1:c.673-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|YES||||XP_005261288.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||,G|intron_variant|MODIFIER|BCL2L13|23786|Transcript|XM_005261233.1|protein_coding||5/5|XM_005261233.1:c.374-7236A>G|||||||rs2535677|1||1||SNV|EntrezGene|17164|||||XP_005261290.1|||||RefSeq|A|A||||||||0.859|0.9092|0.8516|0.9375|0.8121|0.7638||||||||||||0.9375|EAS||||||||||||
+22	18225318	22:31882	C	T	149858	PASS	AC=513;AF=0.855;AN=600;BaseQRankSum=1.66;ClippingRankSum=-0.321;DP=6030;FS=0;GQ_MEAN=86.35;GQ_STDDEV=63.53;HW=0;InbreedingCoeff=-0.0357;MLEAC=515;MLEAF=0.858;MQ=60;MQ0=0;MQRankSum=-0.181;NCC=0;POSITIVE_TRAIN_SITE;QD=26.1;ReadPosRankSum=0.144;SOR=0.713;VQSLOD=3.16;culprit=FS;CSQ=T|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000317361|protein_coding||3/5|ENST00000317361.7:c.361+1251G>A|||||||rs181399|1||-1||SNV|HGNC|1050|YES|||CCDS13747.1|ENSP00000318822|P55957|B2ZP79&B1PL87&A8ASI8|UPI00001D69F1||Ensembl|C|C|||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000342111|protein_coding||3/6|ENST00000342111.5:c.223+1251G>A|||||||rs181399|1||-1||SNV|HGNC|1050|||||ENSP00000344594|P55957||UPI00001B5F92||Ensembl|C|C|||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000399765|protein_coding||1/3|ENST00000399765.1:c.-65-3064G>A|||||||rs181399|1||-1||SNV|HGNC|1050||||CCDS13749.1|ENSP00000382667|P55957|B2ZP79|UPI00001D69F2||Ensembl|C|C|||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000399767|protein_coding||2/4|ENST00000399767.1:c.-66+1251G>A|||||||rs181399|1||-1||SNV|HGNC|1050||||CCDS13749.1|ENSP00000382669|P55957|B2ZP79|UPI00001D69F2||Ensembl|C|C|||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000399774|protein_coding||3/5|ENST00000399774.3:c.223+1251G>A|||||||rs181399|1||-1||SNV|HGNC|1050||||CCDS13748.1|ENSP00000382674|P55957|B2ZP79&B1PL87&A8ASI8|UPI0000001637||Ensembl|C|C|||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant&non_coding_transcript_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000473439|processed_transcript||2/3|ENST00000473439.1:n.326+1251G>A|||||||rs181399|1||-1||SNV|HGNC|1050||||||||||Ensembl|C|C|||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|upstream_gene_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000494097|retained_intron||||||||||rs181399|1|1358|-1||SNV|HGNC|1050||||||||||Ensembl|C|C|||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant&non_coding_transcript_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000550946|retained_intron||3/5|ENST00000550946.1:n.313+1251G>A|||||||rs181399|1||-1||SNV|HGNC|1050||||||||||Ensembl|C|C|||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000551952|protein_coding||3/5|ENST00000551952.1:c.223+1251G>A|||||||rs181399|1||-1||SNV|HGNC|1050||||CCDS13748.1|ENSP00000449236|P55957|B2ZP79&B1PL87&A8ASI8|UPI0000001637||Ensembl|C|C|||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant&non_coding_transcript_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000552886|processed_transcript||2/2|ENST00000552886.1:n.289+1251G>A|||||||rs181399|1||-1||SNV|HGNC|1050||||||||||Ensembl|C|C|||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|637|Transcript|NM_001196.3|protein_coding||3/5|NM_001196.3:c.223+1251G>A|||||||rs181399|1||-1||SNV|EntrezGene|1050|||||NP_001187.1|||||RefSeq|C|C|OK||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|637|Transcript|NM_001244567.1|protein_coding||3/5|NM_001244567.1:c.223+1251G>A|||||||rs181399|1||-1||SNV|EntrezGene|1050|||||NP_001231496.1|||||RefSeq|C|C|OK||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|637|Transcript|NM_001244569.1|protein_coding||2/4|NM_001244569.1:c.-65-3064G>A|||||||rs181399|1||-1||SNV|EntrezGene|1050|||||NP_001231498.1|||||RefSeq|C|C|OK||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|637|Transcript|NM_001244570.1|protein_coding||1/3|NM_001244570.1:c.-65-3064G>A|||||||rs181399|1||-1||SNV|EntrezGene|1050|||||NP_001231499.1|||||RefSeq|C|C|OK||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|637|Transcript|NM_001244572.1|protein_coding||1/3|NM_001244572.1:c.-65-3064G>A|||||||rs181399|1||-1||SNV|EntrezGene|1050|||||NP_001231501.1|||||RefSeq|C|C|OK||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|637|Transcript|NM_197966.2|protein_coding||3/5|NM_197966.2:c.361+1251G>A|||||||rs181399|1||-1||SNV|EntrezGene|1050|YES||||NP_932070.1|||||RefSeq|C|C|OK||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant|MODIFIER|BID|637|Transcript|NM_197967.2|protein_coding||2/4|NM_197967.2:c.-66+1251G>A|||||||rs181399|1||-1||SNV|EntrezGene|1050|||||NP_932071.1|||||RefSeq|C|C|OK||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|intron_variant&non_coding_transcript_variant|MODIFIER|BID|637|Transcript|XR_244338.1|misc_RNA||3/6|XR_244338.1:n.390+1251G>A|||||||rs181399|1||-1||SNV|EntrezGene|1050||||||||||RefSeq|C|C|||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000301067|CTCF_binding_site||||||||||rs181399|1||||SNV|||||||||||||||||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS||||||||||||,T|TF_binding_site_variant|MODIFIER|||MotifFeature|ENSM00523333330|||||||||||rs181399|1||1||SNV|||||||||||||||||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS|||||ENSM00523333330|14|N|-0.025||||,T|TF_binding_site_variant|MODIFIER|||MotifFeature|ENSM00523966268|||||||||||rs181399|1||1||SNV|||||||||||||||||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS|||||ENSM00523966268|4|N|-0.005||||,T|TF_binding_site_variant|MODIFIER|||MotifFeature|ENSM00525592001|||||||||||rs181399|1||1||SNV|||||||||||||||||||||||0.8094|0.8256|0.9365|0.8022|0.7822||||||||||||0.9365|EAS|||||ENSM00525592001|1|N|-0.027||||
+22	18229774	22:31915	T	C	221760	PASS	AC=517;AF=0.862;AN=600;BaseQRankSum=-1.026;ClippingRankSum=0.254;DP=9401;FS=0;GQ_MEAN=141.85;GQ_STDDEV=102.66;HW=0.2;InbreedingCoeff=-0.0207;MLEAC=517;MLEAF=0.862;MQ=60;MQ0=0;MQRankSum=-0.021;NCC=0;POSITIVE_TRAIN_SITE;QD=24.32;ReadPosRankSum=0.19;SOR=0.695;VQSLOD=7.22;culprit=FS;CSQ=C|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000317361|protein_coding||2/5|ENST00000317361.7:c.151-2995A>G|||||||rs181402|1||-1||SNV|HGNC|1050|YES|||CCDS13747.1|ENSP00000318822|P55957|B2ZP79&B1PL87&A8ASI8|UPI00001D69F1||Ensembl|T|T||||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000342111|protein_coding||2/6|ENST00000342111.5:c.13-2995A>G|||||||rs181402|1||-1||SNV|HGNC|1050|||||ENSP00000344594|P55957||UPI00001B5F92||Ensembl|T|T||||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000399765|protein_coding||1/3|ENST00000399765.1:c.-65-7520A>G|||||||rs181402|1||-1||SNV|HGNC|1050||||CCDS13749.1|ENSP00000382667|P55957|B2ZP79|UPI00001D69F2||Ensembl|T|T||||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000399767|protein_coding||1/4|ENST00000399767.1:c.-276-2995A>G|||||||rs181402|1||-1||SNV|HGNC|1050||||CCDS13749.1|ENSP00000382669|P55957|B2ZP79|UPI00001D69F2||Ensembl|T|T||||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000399774|protein_coding||2/5|ENST00000399774.3:c.13-2995A>G|||||||rs181402|1||-1||SNV|HGNC|1050||||CCDS13748.1|ENSP00000382674|P55957|B2ZP79&B1PL87&A8ASI8|UPI0000001637||Ensembl|T|T||||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000473439|processed_transcript||1/3|ENST00000473439.1:n.116-2995A>G|||||||rs181402|1||-1||SNV|HGNC|1050||||||||||Ensembl|T|T||||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000550946|retained_intron||2/5|ENST00000550946.1:n.103-2995A>G|||||||rs181402|1||-1||SNV|HGNC|1050||||||||||Ensembl|T|T||||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000551952|protein_coding||2/5|ENST00000551952.1:c.13-2995A>G|||||||rs181402|1||-1||SNV|HGNC|1050||||CCDS13748.1|ENSP00000449236|P55957|B2ZP79&B1PL87&A8ASI8|UPI0000001637||Ensembl|T|T||||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BID|ENSG00000015475|Transcript|ENST00000552886|processed_transcript||1/2|ENST00000552886.1:n.79-2995A>G|||||||rs181402|1||-1||SNV|HGNC|1050||||||||||Ensembl|T|T||||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|637|Transcript|NM_001196.3|protein_coding||2/5|NM_001196.3:c.13-2995A>G|||||||rs181402|1||-1||SNV|EntrezGene|1050|||||NP_001187.1|||||RefSeq|T|T|OK|||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|637|Transcript|NM_001244567.1|protein_coding||2/5|NM_001244567.1:c.13-2995A>G|||||||rs181402|1||-1||SNV|EntrezGene|1050|||||NP_001231496.1|||||RefSeq|T|T|OK|||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|637|Transcript|NM_001244569.1|protein_coding||2/4|NM_001244569.1:c.-66+3097A>G|||||||rs181402|1||-1||SNV|EntrezGene|1050|||||NP_001231498.1|||||RefSeq|T|T|OK|||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|637|Transcript|NM_001244570.1|protein_coding||1/3|NM_001244570.1:c.-65-7520A>G|||||||rs181402|1||-1||SNV|EntrezGene|1050|||||NP_001231499.1|||||RefSeq|T|T|OK|||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|637|Transcript|NM_001244572.1|protein_coding||1/3|NM_001244572.1:c.-65-7520A>G|||||||rs181402|1||-1||SNV|EntrezGene|1050|||||NP_001231501.1|||||RefSeq|T|T|OK|||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|637|Transcript|NM_197966.2|protein_coding||2/5|NM_197966.2:c.151-2995A>G|||||||rs181402|1||-1||SNV|EntrezGene|1050|YES||||NP_932070.1|||||RefSeq|T|T|OK|||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant|MODIFIER|BID|637|Transcript|NM_197967.2|protein_coding||1/4|NM_197967.2:c.-276-2995A>G|||||||rs181402|1||-1||SNV|EntrezGene|1050|||||NP_932071.1|||||RefSeq|T|T|OK|||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||,C|intron_variant&non_coding_transcript_variant|MODIFIER|BID|637|Transcript|XR_244338.1|misc_RNA||2/6|XR_244338.1:n.180-2995A>G|||||||rs181402|1||-1||SNV|EntrezGene|1050||||||||||RefSeq|T|T||||||||0.8552|0.9009|0.83|0.9385|0.8012|0.7812||||||||||||0.9385|EAS||||||||||||
diff --git a/scripts/importer/tests/data/dataset1_2.vcf b/scripts/importer/tests/data/dataset1_2.vcf
new file mode 100644
index 000000000..e573e4b81
--- /dev/null
+++ b/scripts/importer/tests/data/dataset1_2.vcf
@@ -0,0 +1,160 @@
+##ALT=<ID=NON_REF,Description="Represents any possible alternative allele at this location">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
+##contig=<ID=10,length=135534747,assembly=b37>
+##contig=<ID=11,length=135006516,assembly=b37>
+##contig=<ID=12,length=133851895,assembly=b37>
+##contig=<ID=13,length=115169878,assembly=b37>
+##contig=<ID=14,length=107349540,assembly=b37>
+##contig=<ID=15,length=102531392,assembly=b37>
+##contig=<ID=16,length=90354753,assembly=b37>
+##contig=<ID=17,length=81195210,assembly=b37>
+##contig=<ID=18,length=78077248,assembly=b37>
+##contig=<ID=19,length=59128983,assembly=b37>
+##contig=<ID=1,length=249250621,assembly=b37>
+##contig=<ID=20,length=63025520,assembly=b37>
+##contig=<ID=21,length=48129895,assembly=b37>
+##contig=<ID=22,length=51304566,assembly=b37>
+##contig=<ID=2,length=243199373,assembly=b37>
+##contig=<ID=3,length=198022430,assembly=b37>
+##contig=<ID=4,length=191154276,assembly=b37>
+##contig=<ID=5,length=180915260,assembly=b37>
+##contig=<ID=6,length=171115067,assembly=b37>
+##contig=<ID=7,length=159138663,assembly=b37>
+##contig=<ID=8,length=146364022,assembly=b37>
+##contig=<ID=9,length=141213431,assembly=b37>
+##contig=<ID=GL000191.1,length=106433,assembly=b37>
+##contig=<ID=GL000192.1,length=547496,assembly=b37>
+##contig=<ID=GL000193.1,length=189789,assembly=b37>
+##contig=<ID=GL000194.1,length=191469,assembly=b37>
+##contig=<ID=GL000195.1,length=182896,assembly=b37>
+##contig=<ID=GL000196.1,length=38914,assembly=b37>
+##contig=<ID=GL000197.1,length=37175,assembly=b37>
+##contig=<ID=GL000198.1,length=90085,assembly=b37>
+##contig=<ID=GL000199.1,length=169874,assembly=b37>
+##contig=<ID=GL000200.1,length=187035,assembly=b37>
+##contig=<ID=GL000201.1,length=36148,assembly=b37>
+##contig=<ID=GL000202.1,length=40103,assembly=b37>
+##contig=<ID=GL000203.1,length=37498,assembly=b37>
+##contig=<ID=GL000204.1,length=81310,assembly=b37>
+##contig=<ID=GL000205.1,length=174588,assembly=b37>
+##contig=<ID=GL000206.1,length=41001,assembly=b37>
+##contig=<ID=GL000207.1,length=4262,assembly=b37>
+##contig=<ID=GL000208.1,length=92689,assembly=b37>
+##contig=<ID=GL000209.1,length=159169,assembly=b37>
+##contig=<ID=GL000210.1,length=27682,assembly=b37>
+##contig=<ID=GL000211.1,length=166566,assembly=b37>
+##contig=<ID=GL000212.1,length=186858,assembly=b37>
+##contig=<ID=GL000213.1,length=164239,assembly=b37>
+##contig=<ID=GL000214.1,length=137718,assembly=b37>
+##contig=<ID=GL000215.1,length=172545,assembly=b37>
+##contig=<ID=GL000216.1,length=172294,assembly=b37>
+##contig=<ID=GL000217.1,length=172149,assembly=b37>
+##contig=<ID=GL000218.1,length=161147,assembly=b37>
+##contig=<ID=GL000219.1,length=179198,assembly=b37>
+##contig=<ID=GL000220.1,length=161802,assembly=b37>
+##contig=<ID=GL000221.1,length=155397,assembly=b37>
+##contig=<ID=GL000222.1,length=186861,assembly=b37>
+##contig=<ID=GL000223.1,length=180455,assembly=b37>
+##contig=<ID=GL000224.1,length=179693,assembly=b37>
+##contig=<ID=GL000225.1,length=211173,assembly=b37>
+##contig=<ID=GL000226.1,length=15008,assembly=b37>
+##contig=<ID=GL000227.1,length=128374,assembly=b37>
+##contig=<ID=GL000228.1,length=129120,assembly=b37>
+##contig=<ID=GL000229.1,length=19913,assembly=b37>
+##contig=<ID=GL000230.1,length=43691,assembly=b37>
+##contig=<ID=GL000231.1,length=27386,assembly=b37>
+##contig=<ID=GL000232.1,length=40652,assembly=b37>
+##contig=<ID=GL000233.1,length=45941,assembly=b37>
+##contig=<ID=GL000234.1,length=40531,assembly=b37>
+##contig=<ID=GL000235.1,length=34474,assembly=b37>
+##contig=<ID=GL000236.1,length=41934,assembly=b37>
+##contig=<ID=GL000237.1,length=45867,assembly=b37>
+##contig=<ID=GL000238.1,length=39939,assembly=b37>
+##contig=<ID=GL000239.1,length=33824,assembly=b37>
+##contig=<ID=GL000240.1,length=41933,assembly=b37>
+##contig=<ID=GL000241.1,length=42152,assembly=b37>
+##contig=<ID=GL000242.1,length=43523,assembly=b37>
+##contig=<ID=GL000243.1,length=43341,assembly=b37>
+##contig=<ID=GL000244.1,length=39929,assembly=b37>
+##contig=<ID=GL000245.1,length=36651,assembly=b37>
+##contig=<ID=GL000246.1,length=38154,assembly=b37>
+##contig=<ID=GL000247.1,length=36422,assembly=b37>
+##contig=<ID=GL000248.1,length=39786,assembly=b37>
+##contig=<ID=GL000249.1,length=38502,assembly=b37>
+##contig=<ID=MT,length=16569,assembly=b37>
+##contig=<ID=X,length=155270560,assembly=b37>
+##contig=<ID=Y,length=59373566,assembly=b37>
+##fileformat=VCFv4.2
+##FILTER=<ID=LowQual,Description="Low quality">
+##FILTER=<ID=PASS,Description="All filters passed">
+##FILTER=<ID=VQSRTrancheINDEL99.00to99.90,Description="Truth sensitivity tranche level for INDEL model at VQS Lod: -19.77 <= x < -1.6736">
+##FILTER=<ID=VQSRTrancheINDEL99.90to100.00+,Description="Truth sensitivity tranche level for INDEL model at VQS Lod < -39990.101">
+##FILTER=<ID=VQSRTrancheINDEL99.90to100.00,Description="Truth sensitivity tranche level for INDEL model at VQS Lod: -39990.101 <= x < -19.77">
+##FILTER=<ID=VQSRTrancheSNP99.00to99.90,Description="Truth sensitivity tranche level for SNP model at VQS Lod: -24.2897 <= x < 1.7686">
+##FILTER=<ID=VQSRTrancheSNP99.90to100.00+,Description="Truth sensitivity tranche level for SNP model at VQS Lod < -39999.2143">
+##FILTER=<ID=VQSRTrancheSNP99.90to100.00,Description="Truth sensitivity tranche level for SNP model at VQS Lod: -39999.2143 <= x < -24.2897">
+##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=MIN_DP,Number=1,Type=Integer,Description="Minimum DP observed within the GVCF block">
+##FORMAT=<ID=PGT,Number=1,Type=String,Description="Physical phasing haplotype information, describing how the alternate alleles are phased in relation to one another">
+##FORMAT=<ID=PID,Number=1,Type=String,Description="Physical phasing ID information, where each unique ID within a given sample (but not across samples) connects records within a phasing group">
+##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">
+##FORMAT=<ID=RGQ,Number=1,Type=Integer,Description="Unconditional reference genotype confidence, encoded as a phred quality -10*log10 p(genotype call is wrong)">
+##FORMAT=<ID=SB,Number=4,Type=Integer,Description="Per-sample component statistics which comprise the Fisher's Exact Test to detect strand bias.">
+##GVCFBlock=minGQ=0(inclusive),maxGQ=1(exclusive)
+##INFO=<ID=AC_Adj,Number=A,Type=Integer,Description="Adjusted Allele Counts">
+##INFO=<ID=AC_Hemi,Number=A,Type=Integer,Description="Allele counts in hemizygous genotypes">
+##INFO=<ID=AC_Het,Number=A,Type=Integer,Description="Allele counts in heterozygous genotypes">
+##INFO=<ID=AC_Hom,Number=A,Type=Integer,Description="Allele counts in homozygous genotypes">
+##INFO=<ID=AC_KGA,Number=A,Type=Integer,Description="Other Allele Counts">
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
+##INFO=<ID=AN_Adj,Number=1,Type=Integer,Description="Adjusted Chromosome Count">
+##INFO=<ID=AN_KGA,Number=1,Type=Integer,Description="Other Chromosome Count">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities">
+##INFO=<ID=ClippingRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref number of hard clipped bases">
+##INFO=<ID=CSQ,Number=.,Type=String,Description="Consequence annotations from Ensembl VEP. Format: Allele|Consequence|IMPACT|SYMBOL|Gene|Feature_type|Feature|BIOTYPE|EXON|INTRON|HGVSc|HGVSp|cDNA_position|CDS_position|Protein_position|Amino_acids|Codons|Existing_variation|ALLELE_NUM|DISTANCE|STRAND|FLAGS|VARIANT_CLASS|SYMBOL_SOURCE|HGNC_ID|CANONICAL|TSL|APPRIS|CCDS|ENSP|SWISSPROT|TREMBL|UNIPARC|GENE_PHENO|SIFT|PolyPhen|DOMAINS|HGVS_OFFSET|GMAF|AFR_MAF|AMR_MAF|EAS_MAF|EUR_MAF|SAS_MAF|AA_MAF|EA_MAF|ExAC_MAF|ExAC_Adj_MAF|ExAC_AFR_MAF|ExAC_AMR_MAF|ExAC_EAS_MAF|ExAC_FIN_MAF|ExAC_NFE_MAF|ExAC_OTH_MAF|ExAC_SAS_MAF|CLIN_SIG|SOMATIC|PHENO|PUBMED|MOTIF_NAME|MOTIF_POS|HIGH_INF_POS|MOTIF_SCORE_CHANGE|LoF|LoF_filter|LoF_flags|LoF_info">
+##INFO=<ID=culprit,Number=1,Type=String,Description="The annotation which was the worst performing in the Gaussian mixture model, likely the reason why the variant was filtered out">
+##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered">
+##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
+##INFO=<ID=END,Number=1,Type=Integer,Description="Stop position of the interval">
+##INFO=<ID=ExcessHet,Number=1,Type=Float,Description="Phred-scaled p-value for exact test of excess heterozygosity">
+##INFO=<ID=FS,Number=1,Type=Float,Description="Phred-scaled p-value using Fisher's exact test to detect strand bias">
+##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes">
+##INFO=<ID=Hemi_KGA,Number=A,Type=Integer,Description="Other Hemizygous Counts">
+##INFO=<ID=Het_KGA,Number=A,Type=Integer,Description="Other Heterozygous Counts">
+##INFO=<ID=Hom_KGA,Number=A,Type=Integer,Description="Other Homozygous Counts">
+##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation">
+##INFO=<ID=MLEAC,Number=A,Type=Integer,Description="Maximum likelihood expectation (MLE) for the allele counts (not necessarily the same as the AC), for each ALT allele, in the same order as listed">
+##INFO=<ID=MLEAF,Number=A,Type=Float,Description="Maximum likelihood expectation (MLE) for the allele frequency (not necessarily the same as the AF), for each ALT allele, in the same order as listed">
+##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
+##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
+##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities">
+##INFO=<ID=NEGATIVE_TRAIN_SITE,Number=0,Type=Flag,Description="This variant was used to build the negative training set of bad variants">
+##INFO=<ID=POSITIVE_TRAIN_SITE,Number=0,Type=Flag,Description="This variant was used to build the positive training set of good variants">
+##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
+##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias">
+##INFO=<ID=SOR,Number=1,Type=Float,Description="Symmetric Odds Ratio of 2x2 contingency table to detect strand bias">
+##INFO=<ID=VQSLOD,Number=1,Type=Float,Description="Log odds of being a true variant versus being false under the trained gaussian mixture model">
+##LoF_filter=Reason for LoF not being HC
+##LoF_flags=Possible warning flags for LoF
+##LoF_info=Info used for LoF annotation
+##LoF=Loss-of-function annotation (HC = High Confidence; LC = Low Confidence)
+##reference=file:///sw/data/uppnex/reference/biodata/GATK/ftp.broadinstitute.org/bundle/2.8/b37/human_g1k_v37.fasta
+##VEP=v84 db=. polyphen=2.2.2 genebuild=2011-04 dbSNP=144 gencode=GENCODE 19 regbuild=13 HGMD-PUBLIC=20152 sift=sift5.2.2 assembly=GRCh37.p13 COSMIC=71 ClinVar=201507 ESP=20141103
+22	16263767	rs2716251	G	A	568432	VQSRTrancheSNP99.90to100.00	AC=1377;AF=0.689;AN=2000;BaseQRankSum=-0.027;ClippingRankSum=-0.044;DB;DP=36470;ExcessHet=2.14748e+09;FS=83.243;MLEAC=1380;MLEAF=0.69;MQ=37.4;MQ0=0;MQRankSum=-4.06;QD=15.79;ReadPosRankSum=0.17;SOR=3.693;VQSLOD=-41.68;culprit=FS;AC_Het=605;AC_Hom=772;AC_Hemi=0;AN_Adj=2000;AN_KGA=2000;AC_Adj=1377;AC_KGA=1377;Hom_KGA=772;Het_KGA=605;Hemi_KGA=0;CSQ=A|intron_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000343518|protein_coding||9/10|ENST00000343518.6:c.1520+3162C>T|||||||rs2154837|1||-1||SNV|HGNC|133|YES|||CCDS46658.1|ENSP00000340610|POTEH_HUMAN||UPI0000E5A425||||||||||||||||||||||||||||||||||,A|intron_variant&NMD_transcript_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000452800|nonsense_mediated_decay||10/11|ENST00000452800.1:c.*696+3162C>T|||||||rs2154837|1||-1|cds_start_NF|SNV|HGNC|133|||||ENSP00000442107||H0YG78_HUMAN|UPI000204A808||||||||||||||||||||||||||||||||||
+22	16283300	rs200045958	G	A	512760	VQSRTrancheSNP99.90to100.00	AC=1347;AF=0.678;AN=1986;BaseQRankSum=1.45;ClippingRankSum=0.062;DB;DP=31551;ExcessHet=2.14748e+09;FS=0;InbreedingCoeff=-0.3905;MLEAC=1349;MLEAF=0.679;MQ=26.1;MQ0=0;MQRankSum=-0.491;QD=16.48;ReadPosRankSum=0.668;SOR=0.706;VQSLOD=-49.54;culprit=MQ;AC_Het=601;AC_Hom=746;AC_Hemi=0;AN_Adj=1986;AN_KGA=1986;AC_Adj=1347;AC_KGA=1347;Hom_KGA=746;Het_KGA=601;Hemi_KGA=0;CSQ=A|downstream_gene_variant|MODIFIER|POTEH-AS1|ENSG00000236666|Transcript|ENST00000422014|antisense||||||||||rs200045958&rs8138383|1|4698|1||SNV|HGNC|40058|YES|||||||||||||G:0.3051|A:0.5862&A:0.5862|A:0.7118&A:0.7118|A:0.7827&A:0.7827|A:0.6849&A:0.6849|A:0.7495&A:0.7495|||||||||||||||||||||||,A|intron_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000343518|protein_coding||1/10|ENST00000343518.6:c.633-708C>T|||||||rs200045958&rs8138383|1||-1||SNV|HGNC|133|YES|||CCDS46658.1|ENSP00000340610|POTEH_HUMAN||UPI0000E5A425||||||G:0.3051|A:0.5862&A:0.5862|A:0.7118&A:0.7118|A:0.7827&A:0.7827|A:0.6849&A:0.6849|A:0.7495&A:0.7495|||||||||||||||||||||||,A|intron_variant&NMD_transcript_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000452800|nonsense_mediated_decay||1/11|ENST00000452800.1:c.465-708C>T|||||||rs200045958&rs8138383|1||-1|cds_start_NF|SNV|HGNC|133|||||ENSP00000442107||H0YG78_HUMAN|UPI000204A808||||||G:0.3051|A:0.5862&A:0.5862|A:0.7118&A:0.7118|A:0.7827&A:0.7827|A:0.6849&A:0.6849|A:0.7495&A:0.7495|||||||||||||||||||||||
+22	16285350	rs116260054	G	C	174358	VQSRTrancheSNP99.90to100.00	AC=976;AF=0.587;AN=1662;BaseQRankSum=1.63;ClippingRankSum=-0.045;DB;DP=16983;ExcessHet=0.1397;FS=180.887;MLEAC=975;MLEAF=0.587;MQ=40.44;MQ0=0;MQRankSum=-2.69;QD=12.92;ReadPosRankSum=0.58;SOR=9.706;VQSLOD=-23780;culprit=FS;AC_Het=364;AC_Hom=612;AC_Hemi=0;AN_Adj=1662;AN_KGA=1662;AC_Adj=976;AC_KGA=976;Hom_KGA=612;Het_KGA=364;Hemi_KGA=0;CSQ=C|intron_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000343518|protein_coding||1/10|ENST00000343518.6:c.632+1904C>G|||||||rs116260054|1||-1||SNV|HGNC|133|YES|||CCDS46658.1|ENSP00000340610|POTEH_HUMAN||UPI0000E5A425||||||C:0.2977|C:0.4697|C:0.2133|C:0.1855|C:0.2266|C:0.3139|||||||||||||||||||||||,C|intron_variant&NMD_transcript_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000452800|nonsense_mediated_decay||1/11|ENST00000452800.1:c.464+1904C>G|||||||rs116260054|1||-1|cds_start_NF|SNV|HGNC|133|||||ENSP00000442107||H0YG78_HUMAN|UPI000204A808||||||C:0.2977|C:0.4697|C:0.2133|C:0.1855|C:0.2266|C:0.3139|||||||||||||||||||||||
+22	16286239	rs201077540	A	G	391206	VQSRTrancheSNP99.90to100.00	AC=975;AF=0.488;AN=1998;BaseQRankSum=-0.39;ClippingRankSum=-0.12;DB;DP=43446;ExcessHet=2.14748e+09;FS=19.445;InbreedingCoeff=-0.368;MLEAC=988;MLEAF=0.494;MQ=36.03;MQ0=0;MQRankSum=-1.85;QD=11.26;ReadPosRankSum=0.196;SOR=1.746;VQSLOD=-26.92;culprit=MQ;AC_Het=671;AC_Hom=304;AC_Hemi=0;AN_Adj=1998;AN_KGA=1998;AC_Adj=975;AC_KGA=975;Hom_KGA=304;Het_KGA=671;Hemi_KGA=0;CSQ=G|intron_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000343518|protein_coding||1/10|ENST00000343518.6:c.632+1015T>C|||||||rs62224837|1||-1||SNV|HGNC|133|YES|||CCDS46658.1|ENSP00000340610|POTEH_HUMAN||UPI0000E5A425||||||||||||||||||||||||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000452800|nonsense_mediated_decay||1/11|ENST00000452800.1:c.464+1015T>C|||||||rs62224837|1||-1|cds_start_NF|SNV|HGNC|133|||||ENSP00000442107||H0YG78_HUMAN|UPI000204A808||||||||||||||||||||||||||||||||||
+22	16288255	rs371907891	T	C,TGCCAAGCCAAGCAAAGAAC	605667	VQSRTrancheINDEL99.90to100.00	AC=989,1;AF=0.495,0.0005;AN=2000;BaseQRankSum=-0.618;ClippingRankSum=-0.041;DB;DP=78349;ExcessHet=2.14748e+09;FS=112.401;InbreedingCoeff=-4.4727;MLEAC=990,1;MLEAF=0.495,0.0005;MQ=47.54;MQ0=0;MQRankSum=-4.794;QD=7.93;ReadPosRankSum=0.83;SOR=9.019;VQSLOD=-20.53;culprit=FS;AC_Het=985,1;AC_Hom=4,0;AC_Hemi=0,0;AN_Adj=2000;AN_KGA=2000;AC_Adj=989,1;AC_KGA=989,1;Hom_KGA=4,0;Het_KGA=985,1;Hemi_KGA=0,0;CSQ=C|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000452800|nonsense_mediated_decay||||||||||rs371907891|1|538|-1|cds_start_NF|indel|HGNC|133|||||ENSP00000442107||H0YG78_HUMAN|UPI000204A808||||||||||||||||||||||||||||||||||,TGCCAAGCCAAGCAAAGAAC|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000452800|nonsense_mediated_decay||||||||||rs371907891|2|538|-1|cds_start_NF|indel|HGNC|133|||||ENSP00000442107||H0YG78_HUMAN|UPI000204A808||||||||||||||||||||||||||||||||||,C|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000343518|protein_coding||||||||||rs371907891|1|318|-1||indel|HGNC|133|YES|||CCDS46658.1|ENSP00000340610|POTEH_HUMAN||UPI0000E5A425||||||||||||||||||||||||||||||||||,TGCCAAGCCAAGCAAAGAAC|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000343518|protein_coding||||||||||rs371907891|2|318|-1||indel|HGNC|133|YES|||CCDS46658.1|ENSP00000340610|POTEH_HUMAN||UPI0000E5A425||||||||||||||||||||||||||||||||||
+22	16288538	rs62224840	T	C,TGGCGTGCGCGCGC,*	1.44549e+06	PASS	AC=1212,584,2;AF=0.614,0.296,0.001013;AN=1974;BaseQRankSum=-0.687;ClippingRankSum=0.208;DB;DP=59434;ExcessHet=39.4521;FS=2.597;MLEAC=1212,584,2;MLEAF=0.614,0.296,0.001013;MQ=55.58;MQ0=0;MQRankSum=-0.484;NEGATIVE_TRAIN_SITE;QD=33.83;ReadPosRankSum=0.883;SOR=0.341;VQSLOD=-1.577;culprit=FS;AC_Het=700,578,2;AC_Hom=512,6,0;AC_Hemi=0,0,0;AN_Adj=1974;AN_KGA=1974;AC_Adj=1212,584,2;AC_KGA=1212,584,2;Hom_KGA=512,6,0;Het_KGA=700,578,2;Hemi_KGA=0,0,0;CSQ=C|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000452800|nonsense_mediated_decay||||||||||rs62224840|1|821|-1|cds_start_NF|sequence_alteration|HGNC|133|||||ENSP00000442107||H0YG78_HUMAN|UPI000204A808||||||||||||||||||||||||||||||||||,TGGCGTGCGCGCGC|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000452800|nonsense_mediated_decay||||||||||rs62224840|2|821|-1|cds_start_NF|sequence_alteration|HGNC|133|||||ENSP00000442107||H0YG78_HUMAN|UPI000204A808||||||||||||||||||||||||||||||||||,C|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000343518|protein_coding||||||||||rs62224840|1|601|-1||sequence_alteration|HGNC|133|YES|||CCDS46658.1|ENSP00000340610|POTEH_HUMAN||UPI0000E5A425||||||||||||||||||||||||||||||||||,TGGCGTGCGCGCGC|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000343518|protein_coding||||||||||rs62224840|2|601|-1||sequence_alteration|HGNC|133|YES|||CCDS46658.1|ENSP00000340610|POTEH_HUMAN||UPI0000E5A425||||||||||||||||||||||||||||||||||
+22	16288742	rs76462367	G	C	1.00504e+06	VQSRTrancheSNP99.00to99.90	AC=1334;AF=0.702;AN=1900;BaseQRankSum=-0.389;ClippingRankSum=-0.06;DB;DP=35702;ExcessHet=2.14748e+09;FS=2.885;InbreedingCoeff=-0.287;MLEAC=1359;MLEAF=0.715;MQ=53.32;MQ0=0;MQRankSum=-2.757;NEGATIVE_TRAIN_SITE;QD=30.51;ReadPosRankSum=0.231;SOR=0.944;VQSLOD=-3.356;culprit=MQRankSum;AC_Het=490;AC_Hom=844;AC_Hemi=0;AN_Adj=1900;AN_KGA=1900;AC_Adj=1334;AC_KGA=1334;Hom_KGA=844;Het_KGA=490;Hemi_KGA=0;CSQ=C|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000343518|protein_coding||||||||||rs76462367|1|805|-1||SNV|HGNC|133|YES|||CCDS46658.1|ENSP00000340610|POTEH_HUMAN||UPI0000E5A425||||||G:0.2065|C:0.8964|C:0.7695|C:0.6776|C:0.7803|C:0.8047|||||||||||||||||||||||,C|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000452800|nonsense_mediated_decay||||||||||rs76462367|1|1025|-1|cds_start_NF|SNV|HGNC|133|||||ENSP00000442107||H0YG78_HUMAN|UPI000204A808||||||G:0.2065|C:0.8964|C:0.7695|C:0.6776|C:0.7803|C:0.8047|||||||||||||||||||||||
+22	16288776	rs67775324	A	G	1.0032e+06	VQSRTrancheSNP99.00to99.90	AC=1320;AF=0.7;AN=1886;BaseQRankSum=-2.381;ClippingRankSum=-0.051;DB;DP=39005;ExcessHet=138.447;FS=1.301;InbreedingCoeff=-0.2566;MLEAC=1351;MLEAF=0.716;MQ=52.63;MQ0=0;MQRankSum=-3.055;NEGATIVE_TRAIN_SITE;QD=28.38;ReadPosRankSum=-0.224;SOR=0.798;VQSLOD=-3.749;culprit=MQRankSum;AC_Het=470;AC_Hom=850;AC_Hemi=0;AN_Adj=1886;AN_KGA=1886;AC_Adj=1320;AC_KGA=1320;Hom_KGA=850;Het_KGA=470;Hemi_KGA=0;CSQ=G|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000452800|nonsense_mediated_decay||||||||||rs67775324|1|1059|-1|cds_start_NF|SNV|HGNC|133|||||ENSP00000442107||H0YG78_HUMAN|UPI000204A808||||||||||||||||||||||||||||||||||,G|upstream_gene_variant|MODIFIER|POTEH|ENSG00000198062|Transcript|ENST00000343518|protein_coding||||||||||rs67775324|1|839|-1||SNV|HGNC|133|YES|||CCDS46658.1|ENSP00000340610|POTEH_HUMAN||UPI0000E5A425||||||||||||||||||||||||||||||||||
+22	16364923	rs5771604	C	A	967564	VQSRTrancheSNP99.00to99.90	AC=1057;AF=0.529;AN=2000;BaseQRankSum=0.642;ClippingRankSum=-0.058;DB;DP=50352;ExcessHet=2.14748e+09;FS=8.487;MLEAC=1060;MLEAF=0.53;MQ=53.71;MQ0=0;MQRankSum=-3.951;NEGATIVE_TRAIN_SITE;QD=19.96;ReadPosRankSum=-0.32;SOR=1.241;VQSLOD=-5.859;culprit=MQRankSum;AC_Het=835;AC_Hom=222;AC_Hemi=0;AN_Adj=2000;AN_KGA=2000;AC_Adj=1057;AC_KGA=1057;Hom_KGA=222;Het_KGA=835;Hemi_KGA=0;CSQ=A|downstream_gene_variant|MODIFIER|LA16c-2F2.5|ENSG00000226474|Transcript|ENST00000440999|unprocessed_pseudogene||||||||||rs5771604|1|2362|1||SNV|Clone_based_vega_gene||YES|||||||||||||C:0.4599|A:0.8442|A:0.4582|A:0.3363|A:0.4612|A:0.4785|||||||||||||||||||||||,A|non_coding_transcript_exon_variant&non_coding_transcript_variant|MODIFIER|NEK2P2|ENSG00000231565|Transcript|ENST00000438441|processed_pseudogene|1/1||ENST00000438441.1:n.57C>A||57|||||rs5771604|1||1||SNV|HGNC|37816|YES|||||||||||||C:0.4599|A:0.8442|A:0.4582|A:0.3363|A:0.4612|A:0.4785|||||||||||||||||||||||
+22	16365289	rs141818524	G	A	344637	VQSRTrancheSNP99.90to100.00	AC=1662;AF=0.833;AN=1996;BaseQRankSum=-0.392;ClippingRankSum=0;DB;DP=17926;ExcessHet=0.0975;FS=22.413;MLEAC=1678;MLEAF=0.841;MQ=32.1;MQ0=0;MQRankSum=-3.254;QD=20.78;ReadPosRankSum=0.504;SOR=1.911;VQSLOD=-32.66;culprit=MQ;AC_Het=256;AC_Hom=1406;AC_Hemi=0;AN_Adj=1996;AN_KGA=1996;AC_Adj=1662;AC_KGA=1662;Hom_KGA=1406;Het_KGA=256;Hemi_KGA=0;CSQ=A|downstream_gene_variant|MODIFIER|LA16c-2F2.5|ENSG00000226474|Transcript|ENST00000440999|unprocessed_pseudogene||||||||||rs1153411|1|2728|1||SNV|Clone_based_vega_gene||YES|||||||||||||G:0.2520|A:0.9191|A:0.6888|A:0.6895|A:0.6899|A:0.6789|||||||||||||||||||||||,A|non_coding_transcript_exon_variant&non_coding_transcript_variant|MODIFIER|NEK2P2|ENSG00000231565|Transcript|ENST00000438441|processed_pseudogene|1/1||ENST00000438441.1:n.423G>A||423|||||rs1153411|1||1||SNV|HGNC|37816|YES|||||||||||||G:0.2520|A:0.9191|A:0.6888|A:0.6895|A:0.6899|A:0.6789|||||||||||||||||||||||
+22	16370229	rs371958062	G	A	858332	VQSRTrancheSNP99.90to100.00	AC=974;AF=0.487;AN=2000;BaseQRankSum=-0.428;ClippingRankSum=0.059;DB;DP=77999;ExcessHet=2.14748e+09;FS=3.256;MLEAC=978;MLEAF=0.489;MQ=32.13;MQ0=0;MQRankSum=-1.564;QD=11.19;ReadPosRankSum=0.623;SOR=0.973;VQSLOD=-44.14;culprit=MQ;AC_Het=974;AC_Hom=0;AC_Hemi=0;AN_Adj=2000;AN_KGA=2000;AC_Adj=974;AC_KGA=974;Hom_KGA=0;Het_KGA=974;Hemi_KGA=0;CSQ=A|downstream_gene_variant|MODIFIER|NEK2P2|ENSG00000231565|Transcript|ENST00000438441|processed_pseudogene||||||||||rs371958062|1|4025|1||SNV|HGNC|37816|YES|||||||||||||||||||||||||||||||||||||||||,A|upstream_gene_variant|MODIFIER|LA16c-2F2.8|ENSG00000230471|Transcript|ENST00000428118|lincRNA||||||||||rs371958062|1|2852|1||SNV|Clone_based_vega_gene||YES|||||||||||||||||||||||||||||||||||||||||
+22	29461622	rs783	G	A	715011	PASS	AC=1247;AF=0.624;AN=2000;BaseQRankSum=2.44;ClippingRankSum=-0.031;DB;DP=36991;ExcessHet=4.4124;FS=0;MLEAC=1247;MLEAF=0.624;MQ=60;MQ0=0;MQRankSum=0.023;POSITIVE_TRAIN_SITE;QD=22.28;ReadPosRankSum=0.313;SOR=0.685;VQSLOD=22.38;culprit=MQ;AC_Het=475;AC_Hom=772;AC_Hemi=0;AN_Adj=2000;AN_KGA=2000;AC_Adj=1247;AC_KGA=1247;Hom_KGA=772;Het_KGA=475;Hemi_KGA=0;CSQ=A|upstream_gene_variant|MODIFIER|C22orf31|ENSG00000100249|Transcript|ENST00000216071|protein_coding||||||||||rs783|1|3790|-1||SNV|HGNC|26931|YES|||CCDS13848.1|ENSP00000216071|CV031_HUMAN||UPI0000073FE0||||||G:0.4289|A:0.5681|A:0.4654|A:0.5466|A:0.664|A:0.5798|||||||||||||||||||||||,A|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001731804|promoter_flanking_region||||||||||rs783|1||||SNV||||||||||||||||G:0.4289|A:0.5681|A:0.4654|A:0.5466|A:0.664|A:0.5798|||||||||||||||||||||||

From f99e1e429060575b920935a35db125c85cdda7a2 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Fri, 28 Jun 2019 09:20:09 +0200
Subject: [PATCH 011/126] Relevant genes/transcripts from Gencode 19 extracted.

---
 scripts/importer/tests/data/gencode.gtf | 374 ++++++++++++++++++++++++
 1 file changed, 374 insertions(+)
 create mode 100644 scripts/importer/tests/data/gencode.gtf

diff --git a/scripts/importer/tests/data/gencode.gtf b/scripts/importer/tests/data/gencode.gtf
new file mode 100644
index 000000000..d1aaf3e27
--- /dev/null
+++ b/scripts/importer/tests/data/gencode.gtf
@@ -0,0 +1,374 @@
+chr22	HAVANA	gene	16256441	16287937	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENSG00000198062.10"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH"; level 1; tag "ncRNA_host"; havana_gene "OTTHUMG00000140314.5";
+chr22	HAVANA	transcript	16256441	16287717	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16287254	16287717	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 1; exon_id "ENSE00001781695.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	CDS	16287254	16287717	.	-	0	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 1; exon_id "ENSE00001781695.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16282478	16282592	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 2; exon_id "ENSE00001746577.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	CDS	16282478	16282592	.	-	1	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 2; exon_id "ENSE00001746577.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16282145	16282318	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 3; exon_id "ENSE00001788239.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	CDS	16282145	16282318	.	-	0	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 3; exon_id "ENSE00001788239.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16280334	16280589	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 4; exon_id "ENSE00001593346.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	CDS	16280434	16280589	.	-	0	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 4; exon_id "ENSE00001593346.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	stop_codon	16280431	16280433	.	-	0	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 4; exon_id "ENSE00001593346.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16279195	16279301	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 5; exon_id "ENSE00003460670.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16277748	16277885	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 6; exon_id "ENSE00003669720.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16275207	16275277	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 7; exon_id "ENSE00003508115.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16269873	16269943	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 8; exon_id "ENSE00003515936.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16268137	16268181	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 9; exon_id "ENSE00003572616.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16266929	16267095	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 10; exon_id "ENSE00003639659.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16258185	16258303	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 11; exon_id "ENSE00003480843.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	exon	16256441	16256677	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; exon_number 12; exon_id "ENSE00001732273.1"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	UTR	16280334	16280433	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	UTR	16279195	16279301	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	UTR	16277748	16277885	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	UTR	16275207	16275277	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	UTR	16269873	16269943	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	UTR	16268137	16268181	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	UTR	16266929	16267095	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	UTR	16258185	16258303	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	UTR	16256441	16256677	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000452800.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "POTEH-002"; level 2; protein_id "ENSP00000442107.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000340296.2";
+chr22	HAVANA	transcript	16256441	16287937	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	exon	16287254	16287937	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 1; exon_id "ENSE00001413705.2"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	CDS	16287254	16287885	.	-	0	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 1; exon_id "ENSE00001413705.2"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	start_codon	16287883	16287885	.	-	0	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 1; exon_id "ENSE00001413705.2"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	exon	16282478	16282592	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 2; exon_id "ENSE00001746577.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	CDS	16282478	16282592	.	-	1	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 2; exon_id "ENSE00001746577.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	exon	16282145	16282318	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 3; exon_id "ENSE00001788239.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	CDS	16282145	16282318	.	-	0	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 3; exon_id "ENSE00001788239.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	exon	16279195	16279301	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 4; exon_id "ENSE00003639359.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	CDS	16279195	16279301	.	-	0	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 4; exon_id "ENSE00003639359.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	exon	16277748	16277885	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 5; exon_id "ENSE00003623625.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	CDS	16277748	16277885	.	-	1	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 5; exon_id "ENSE00003623625.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	exon	16275207	16275277	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 6; exon_id "ENSE00003533849.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	CDS	16275207	16275277	.	-	1	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 6; exon_id "ENSE00003533849.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	exon	16269873	16269943	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 7; exon_id "ENSE00003535920.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	CDS	16269873	16269943	.	-	2	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 7; exon_id "ENSE00003535920.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	exon	16268137	16268181	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 8; exon_id "ENSE00003539333.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	CDS	16268137	16268181	.	-	0	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 8; exon_id "ENSE00003539333.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	exon	16266929	16267095	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 9; exon_id "ENSE00003523951.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	CDS	16266929	16267095	.	-	0	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 9; exon_id "ENSE00003523951.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	exon	16258185	16258303	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 10; exon_id "ENSE00003563151.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	CDS	16258189	16258303	.	-	1	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 10; exon_id "ENSE00003563151.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	stop_codon	16258186	16258188	.	-	0	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 10; exon_id "ENSE00003563151.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	exon	16256441	16256677	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; exon_number 11; exon_id "ENSE00001732273.1"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	UTR	16287886	16287937	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	UTR	16258185	16258188	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	UTR	16256441	16256677	.	-	.	gene_id "ENSG00000198062.10"; transcript_id "ENST00000343518.6"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "POTEH"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "POTEH-001"; level 1; protein_id "ENSP00000340610.6"; tag "basic"; tag "appris_principal"; tag "exp_conf"; tag "CCDS"; ccdsid "CCDS46658.1"; havana_gene "OTTHUMG00000140314.5"; havana_transcript "OTTHUMT00000276918.4";
+chr22	HAVANA	gene	16274560	16278602	.	+	.	gene_id "ENSG00000236666.1"; transcript_id "ENSG00000236666.1"; gene_type "antisense"; gene_status "NOVEL"; gene_name "POTEH-AS1"; transcript_type "antisense"; transcript_status "NOVEL"; transcript_name "POTEH-AS1"; level 2; havana_gene "OTTHUMG00000140316.1";
+chr22	HAVANA	transcript	16274560	16278602	.	+	.	gene_id "ENSG00000236666.1"; transcript_id "ENST00000422014.1"; gene_type "antisense"; gene_status "NOVEL"; gene_name "POTEH-AS1"; transcript_type "antisense"; transcript_status "KNOWN"; transcript_name "POTEH-AS1-001"; level 2; tag "basic"; havana_gene "OTTHUMG00000140316.1"; havana_transcript "OTTHUMT00000276920.1";
+chr22	HAVANA	exon	16274560	16275003	.	+	.	gene_id "ENSG00000236666.1"; transcript_id "ENST00000422014.1"; gene_type "antisense"; gene_status "NOVEL"; gene_name "POTEH-AS1"; transcript_type "antisense"; transcript_status "KNOWN"; transcript_name "POTEH-AS1-001"; exon_number 1; exon_id "ENSE00001671032.1"; level 2; tag "basic"; havana_gene "OTTHUMG00000140316.1"; havana_transcript "OTTHUMT00000276920.1";
+chr22	HAVANA	exon	16276481	16278602	.	+	.	gene_id "ENSG00000236666.1"; transcript_id "ENST00000422014.1"; gene_type "antisense"; gene_status "NOVEL"; gene_name "POTEH-AS1"; transcript_type "antisense"; transcript_status "KNOWN"; transcript_name "POTEH-AS1-001"; exon_number 2; exon_id "ENSE00001600878.1"; level 2; tag "basic"; havana_gene "OTTHUMG00000140316.1"; havana_transcript "OTTHUMT00000276920.1";
+chr22	HAVANA	gene	16362385	16362561	.	+	.	gene_id "ENSG00000226474.1"; transcript_id "ENSG00000226474.1"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "LA16c-2F2.5"; transcript_type "pseudogene"; transcript_status "KNOWN"; transcript_name "LA16c-2F2.5"; level 2; havana_gene "OTTHUMG00000140338.2";
+chr22	HAVANA	transcript	16362385	16362561	.	+	.	gene_id "ENSG00000226474.1"; transcript_id "ENST00000440999.1"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "LA16c-2F2.5"; transcript_type "unprocessed_pseudogene"; transcript_status "KNOWN"; transcript_name "LA16c-2F2.5-001"; level 2; ont "PGO:0000005"; havana_gene "OTTHUMG00000140338.2"; havana_transcript "OTTHUMT00000276962.2";
+chr22	HAVANA	exon	16362385	16362561	.	+	.	gene_id "ENSG00000226474.1"; transcript_id "ENST00000440999.1"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "LA16c-2F2.5"; transcript_type "unprocessed_pseudogene"; transcript_status "KNOWN"; transcript_name "LA16c-2F2.5-001"; exon_number 1; exon_id "ENSE00001689749.1"; level 2; ont "PGO:0000005"; havana_gene "OTTHUMG00000140338.2"; havana_transcript "OTTHUMT00000276962.2";
+chr22	HAVANA	gene	16364867	16366204	.	+	.	gene_id "ENSG00000231565.1"; transcript_id "ENSG00000231565.1"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "NEK2P2"; transcript_type "pseudogene"; transcript_status "KNOWN"; transcript_name "NEK2P2"; level 1; tag "pseudo_consens"; havana_gene "OTTHUMG00000140351.1";
+chr22	HAVANA	transcript	16364867	16366204	.	+	.	gene_id "ENSG00000231565.1"; transcript_id "ENST00000438441.1"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "NEK2P2"; transcript_type "processed_pseudogene"; transcript_status "KNOWN"; transcript_name "NEK2P2-001"; level 1; ont "PGO:0000004"; tag "pseudo_consens"; havana_gene "OTTHUMG00000140351.1"; havana_transcript "OTTHUMT00000276998.1";
+chr22	HAVANA	exon	16364867	16366204	.	+	.	gene_id "ENSG00000231565.1"; transcript_id "ENST00000438441.1"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "NEK2P2"; transcript_type "processed_pseudogene"; transcript_status "KNOWN"; transcript_name "NEK2P2-001"; exon_number 1; exon_id "ENSE00001642903.1"; level 1; ont "PGO:0000004"; tag "pseudo_consens"; havana_gene "OTTHUMG00000140351.1"; havana_transcript "OTTHUMT00000276998.1";
+chr22	HAVANA	gene	16373081	16377055	.	+	.	gene_id "ENSG00000230471.1"; transcript_id "ENSG00000230471.1"; gene_type "lincRNA"; gene_status "NOVEL"; gene_name "LA16c-2F2.8"; transcript_type "lincRNA"; transcript_status "NOVEL"; transcript_name "LA16c-2F2.8"; level 1; havana_gene "OTTHUMG00000140353.1";
+chr22	HAVANA	transcript	16373081	16377055	.	+	.	gene_id "ENSG00000230471.1"; transcript_id "ENST00000428118.1"; gene_type "lincRNA"; gene_status "NOVEL"; gene_name "LA16c-2F2.8"; transcript_type "lincRNA"; transcript_status "KNOWN"; transcript_name "LA16c-2F2.8-001"; level 1; tag "basic"; tag "exp_conf"; havana_gene "OTTHUMG00000140353.1"; havana_transcript "OTTHUMT00000277001.1";
+chr22	HAVANA	exon	16373081	16373121	.	+	.	gene_id "ENSG00000230471.1"; transcript_id "ENST00000428118.1"; gene_type "lincRNA"; gene_status "NOVEL"; gene_name "LA16c-2F2.8"; transcript_type "lincRNA"; transcript_status "KNOWN"; transcript_name "LA16c-2F2.8-001"; exon_number 1; exon_id "ENSE00001619071.1"; level 1; tag "basic"; tag "exp_conf"; havana_gene "OTTHUMG00000140353.1"; havana_transcript "OTTHUMT00000277001.1";
+chr22	HAVANA	exon	16373830	16373911	.	+	.	gene_id "ENSG00000230471.1"; transcript_id "ENST00000428118.1"; gene_type "lincRNA"; gene_status "NOVEL"; gene_name "LA16c-2F2.8"; transcript_type "lincRNA"; transcript_status "KNOWN"; transcript_name "LA16c-2F2.8-001"; exon_number 2; exon_id "ENSE00001719006.1"; level 1; tag "basic"; tag "exp_conf"; havana_gene "OTTHUMG00000140353.1"; havana_transcript "OTTHUMT00000277001.1";
+chr22	HAVANA	exon	16375449	16377055	.	+	.	gene_id "ENSG00000230471.1"; transcript_id "ENST00000428118.1"; gene_type "lincRNA"; gene_status "NOVEL"; gene_name "LA16c-2F2.8"; transcript_type "lincRNA"; transcript_status "KNOWN"; transcript_name "LA16c-2F2.8-001"; exon_number 3; exon_id "ENSE00001598108.1"; level 1; tag "basic"; tag "exp_conf"; havana_gene "OTTHUMG00000140353.1"; havana_transcript "OTTHUMT00000277001.1";
+chr22	HAVANA	gene	18111621	18213388	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENSG00000099968.13"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13"; level 1; havana_gene "OTTHUMG00000150088.3";
+chr22	HAVANA	transcript	18111621	18178975	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399781.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "BCL2L13-008"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316191.1";
+chr22	HAVANA	exon	18111621	18111672	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399781.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "BCL2L13-008"; exon_number 1; exon_id "ENSE00001540168.1"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316191.1";
+chr22	HAVANA	exon	18120868	18121466	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399781.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "BCL2L13-008"; exon_number 2; exon_id "ENSE00001540171.1"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316191.1";
+chr22	HAVANA	exon	18138428	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399781.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "BCL2L13-008"; exon_number 3; exon_id "ENSE00003461313.1"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316191.1";
+chr22	HAVANA	exon	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399781.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "BCL2L13-008"; exon_number 4; exon_id "ENSE00003637389.1"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316191.1";
+chr22	HAVANA	exon	18178907	18178975	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399781.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "BCL2L13-008"; exon_number 5; exon_id "ENSE00001540167.1"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316191.1";
+chr22	HAVANA	transcript	18111682	18185194	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	exon	18111682	18111771	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 1; exon_id "ENSE00001540172.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	exon	18120868	18121466	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 2; exon_id "ENSE00001540171.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	exon	18138428	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 3; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	CDS	18138478	18138598	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 3; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	start_codon	18138478	18138480	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 3; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	exon	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 4; exon_id "ENSE00003693073.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	CDS	18165980	18166087	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 4; exon_id "ENSE00003693073.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	exon	18171752	18171908	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 5; exon_id "ENSE00003591214.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	CDS	18171752	18171908	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 5; exon_id "ENSE00003591214.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	exon	18178907	18178976	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 6; exon_id "ENSE00003497481.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	CDS	18178907	18178976	.	+	1	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 6; exon_id "ENSE00003497481.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	exon	18185009	18185194	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 7; exon_id "ENSE00001540169.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	CDS	18185009	18185155	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 7; exon_id "ENSE00001540169.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	stop_codon	18185156	18185158	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; exon_number 7; exon_id "ENSE00001540169.1"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	UTR	18111682	18111771	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	UTR	18120868	18121466	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	UTR	18138428	18138477	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	UTR	18185156	18185194	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399782.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-002"; level 2; protein_id "ENSP00000382682.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316185.2";
+chr22	HAVANA	transcript	18121356	18211487	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	exon	18121356	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 1; exon_id "ENSE00001898002.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	exon	18138428	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	CDS	18138478	18138598	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	start_codon	18138478	18138480	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	exon	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 3; exon_id "ENSE00003693073.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	CDS	18165980	18166087	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 3; exon_id "ENSE00003693073.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	exon	18171752	18171908	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 4; exon_id "ENSE00003591214.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	CDS	18171752	18171908	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 4; exon_id "ENSE00003591214.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	exon	18178907	18178976	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 5; exon_id "ENSE00003497481.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	CDS	18178907	18178976	.	+	1	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 5; exon_id "ENSE00003497481.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	exon	18185009	18185152	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 6; exon_id "ENSE00003546934.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	CDS	18185009	18185152	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 6; exon_id "ENSE00003546934.1"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	exon	18209443	18211487	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 7; exon_id "ENSE00001680488.2"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	CDS	18209443	18210297	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 7; exon_id "ENSE00001680488.2"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	stop_codon	18210298	18210300	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; exon_number 7; exon_id "ENSE00001680488.2"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	UTR	18121356	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	UTR	18138428	18138477	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	UTR	18210298	18211487	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000317582.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-001"; level 2; protein_id "ENSP00000318883.5"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316184.1";
+chr22	HAVANA	transcript	18121507	18211465	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	exon	18121507	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; exon_number 1; exon_id "ENSE00001412972.2"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	exon	18138428	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	CDS	18138478	18138598	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	start_codon	18138478	18138480	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	exon	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; exon_number 3; exon_id "ENSE00003693073.1"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	CDS	18165980	18166087	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; exon_number 3; exon_id "ENSE00003693073.1"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	exon	18178907	18178976	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; exon_number 4; exon_id "ENSE00003460053.1"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	CDS	18178907	18178911	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; exon_number 4; exon_id "ENSE00003460053.1"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	stop_codon	18178912	18178914	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; exon_number 4; exon_id "ENSE00003460053.1"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	exon	18185009	18185152	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; exon_number 5; exon_id "ENSE00003503185.1"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	exon	18209443	18211465	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; exon_number 6; exon_id "ENSE00003520084.1"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	UTR	18121507	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	UTR	18138428	18138477	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	UTR	18178912	18178976	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	UTR	18185009	18185152	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	HAVANA	UTR	18209443	18211465	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000498133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-003"; level 2; protein_id "ENSP00000436321.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316186.2";
+chr22	ENSEMBL	transcript	18121507	18211465	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18121507	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; exon_number 1; exon_id "ENSE00001412972.2"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18138428	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; exon_number 2; exon_id "ENSE00003461313.1"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; exon_number 3; exon_id "ENSE00003637389.1"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18178907	18178976	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; exon_number 4; exon_id "ENSE00003555903.1"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18185009	18185152	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; exon_number 5; exon_id "ENSE00003600296.1"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	CDS	18185039	18185152	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; exon_number 5; exon_id "ENSE00003600296.1"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	start_codon	18185039	18185041	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; exon_number 5; exon_id "ENSE00003600296.1"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18209443	18211465	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; exon_number 6; exon_id "ENSE00003626534.1"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	CDS	18209443	18210297	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; exon_number 6; exon_id "ENSE00003626534.1"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	stop_codon	18210298	18210300	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; exon_number 6; exon_id "ENSE00003626534.1"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18121507	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18138428	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18178907	18178976	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18185009	18185038	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18210298	18211465	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000543133.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-204"; level 3; protein_id "ENSP00000437667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	HAVANA	transcript	18121523	18175161	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000464649.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BCL2L13-009"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316192.1";
+chr22	HAVANA	exon	18121523	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000464649.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BCL2L13-009"; exon_number 1; exon_id "ENSE00001845131.1"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316192.1";
+chr22	HAVANA	exon	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000464649.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BCL2L13-009"; exon_number 2; exon_id "ENSE00003637389.1"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316192.1";
+chr22	HAVANA	exon	18171752	18171908	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000464649.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BCL2L13-009"; exon_number 3; exon_id "ENSE00003687973.1"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316192.1";
+chr22	HAVANA	exon	18175122	18175161	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000464649.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BCL2L13-009"; exon_number 4; exon_id "ENSE00001873289.1"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316192.1";
+chr22	ENSEMBL	transcript	18121523	18210466	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18121523	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; exon_number 1; exon_id "ENSE00001845131.1"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18138428	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; exon_number 2; exon_id "ENSE00003461014.1"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	CDS	18138515	18138598	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; exon_number 2; exon_id "ENSE00003461014.1"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	start_codon	18138515	18138517	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; exon_number 2; exon_id "ENSE00003461014.1"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18185009	18185152	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; exon_number 3; exon_id "ENSE00003546934.1"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	CDS	18185009	18185152	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; exon_number 3; exon_id "ENSE00003546934.1"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18209443	18210466	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; exon_number 4; exon_id "ENSE00002232124.1"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	CDS	18209443	18210297	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; exon_number 4; exon_id "ENSE00002232124.1"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	stop_codon	18210298	18210300	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; exon_number 4; exon_id "ENSE00002232124.1"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18121523	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18138428	18138514	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18210298	18210466	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000538149.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-203"; level 3; protein_id "ENSP00000441344.1"; tag "basic"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	transcript	18121530	18210428	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18121530	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; exon_number 1; exon_id "ENSE00001323953.3"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18138428	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; exon_number 2; exon_id "ENSE00003461313.1"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; exon_number 3; exon_id "ENSE00003637389.1"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18185009	18185152	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; exon_number 4; exon_id "ENSE00003600296.1"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	CDS	18185039	18185152	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; exon_number 4; exon_id "ENSE00003600296.1"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	start_codon	18185039	18185041	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; exon_number 4; exon_id "ENSE00003600296.1"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18209443	18210428	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; exon_number 5; exon_id "ENSE00002263893.1"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	CDS	18209443	18210297	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; exon_number 5; exon_id "ENSE00002263893.1"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	stop_codon	18210298	18210300	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; exon_number 5; exon_id "ENSE00002263893.1"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18121530	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18138428	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18185009	18185038	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18210298	18210428	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000337612.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-201"; level 3; protein_id "ENSP00000338932.5"; tag "basic"; tag "CCDS"; ccdsid "CCDS59448.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	HAVANA	transcript	18121538	18186499	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	exon	18121538	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 1; exon_id "ENSE00001854798.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	exon	18138428	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	CDS	18138478	18138598	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	start_codon	18138478	18138480	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	exon	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 3; exon_id "ENSE00003693073.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	CDS	18165980	18166087	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 3; exon_id "ENSE00003693073.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	exon	18171752	18171908	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 4; exon_id "ENSE00003591214.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	CDS	18171752	18171908	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 4; exon_id "ENSE00003591214.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	exon	18178907	18178976	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 5; exon_id "ENSE00003497481.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	CDS	18178907	18178976	.	+	1	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 5; exon_id "ENSE00003497481.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	exon	18185009	18186499	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 6; exon_id "ENSE00001841813.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	CDS	18185009	18185155	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 6; exon_id "ENSE00001841813.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	stop_codon	18185156	18185158	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; exon_number 6; exon_id "ENSE00001841813.1"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	UTR	18121538	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	UTR	18138428	18138477	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	UTR	18185156	18186499	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000493680.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-004"; level 2; protein_id "ENSP00000434764.1"; tag "alternative_5_UTR"; tag "basic"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316187.2";
+chr22	HAVANA	transcript	18121577	18213388	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	exon	18121577	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; exon_number 1; exon_id "ENSE00001832778.1"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	exon	18138428	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	CDS	18138478	18138598	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	start_codon	18138478	18138480	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; exon_number 2; exon_id "ENSE00003647715.1"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	exon	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; exon_number 3; exon_id "ENSE00003693073.1"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	CDS	18165980	18166087	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; exon_number 3; exon_id "ENSE00003693073.1"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	exon	18171752	18171908	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; exon_number 4; exon_id "ENSE00003591214.1"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	CDS	18171752	18171908	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; exon_number 4; exon_id "ENSE00003591214.1"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	exon	18209443	18213388	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; exon_number 5; exon_id "ENSE00001890669.1"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	CDS	18209443	18209569	.	+	1	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; exon_number 5; exon_id "ENSE00001890669.1"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	stop_codon	18209570	18209572	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; exon_number 5; exon_id "ENSE00001890669.1"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	UTR	18121577	18121652	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	UTR	18138428	18138477	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	HAVANA	UTR	18209570	18213388	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000355028.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "BCL2L13-005"; level 2; protein_id "ENSP00000347133.3"; tag "basic"; tag "CCDS"; ccdsid "CCDS59447.1"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316188.1";
+chr22	ENSEMBL	transcript	18138478	18210300	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18138478	18138598	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; exon_number 1; exon_id "ENSE00001629201.2"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	CDS	18138478	18138598	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; exon_number 1; exon_id "ENSE00001629201.2"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	start_codon	18138478	18138480	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; exon_number 1; exon_id "ENSE00001629201.2"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18165980	18166087	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; exon_number 2; exon_id "ENSE00003693073.1"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	CDS	18165980	18166087	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; exon_number 2; exon_id "ENSE00003693073.1"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18167375	18167472	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; exon_number 3; exon_id "ENSE00001315528.2"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	CDS	18167375	18167457	.	+	2	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; exon_number 3; exon_id "ENSE00001315528.2"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	stop_codon	18167458	18167460	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; exon_number 3; exon_id "ENSE00001315528.2"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18171752	18171908	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; exon_number 4; exon_id "ENSE00003687973.1"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	exon	18209443	18210300	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; exon_number 5; exon_id "ENSE00001540150.3"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18167458	18167472	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18171752	18171908	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	ENSEMBL	UTR	18209443	18210300	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000418951.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BCL2L13-202"; level 3; protein_id "ENSP00000410019.2"; tag "basic"; tag "CCDS"; ccdsid "CCDS13746.1"; havana_gene "OTTHUMG00000150088.3";
+chr22	HAVANA	transcript	18171840	18211906	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399777.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-006"; level 2; protein_id "ENSP00000382677.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316189.3";
+chr22	HAVANA	exon	18171840	18171908	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399777.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-006"; exon_number 1; exon_id "ENSE00001540161.1"; level 2; protein_id "ENSP00000382677.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316189.3";
+chr22	HAVANA	CDS	18171840	18171908	.	+	1	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399777.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-006"; exon_number 1; exon_id "ENSE00001540161.1"; level 2; protein_id "ENSP00000382677.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316189.3";
+chr22	HAVANA	exon	18185009	18185152	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399777.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-006"; exon_number 2; exon_id "ENSE00003526121.1"; level 2; protein_id "ENSP00000382677.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316189.3";
+chr22	HAVANA	CDS	18185009	18185051	.	+	1	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399777.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-006"; exon_number 2; exon_id "ENSE00003526121.1"; level 2; protein_id "ENSP00000382677.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316189.3";
+chr22	HAVANA	stop_codon	18185052	18185054	.	+	0	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399777.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-006"; exon_number 2; exon_id "ENSE00003526121.1"; level 2; protein_id "ENSP00000382677.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316189.3";
+chr22	HAVANA	exon	18209443	18211906	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399777.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-006"; exon_number 3; exon_id "ENSE00001399631.3"; level 2; protein_id "ENSP00000382677.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316189.3";
+chr22	HAVANA	UTR	18185052	18185152	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399777.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-006"; level 2; protein_id "ENSP00000382677.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316189.3";
+chr22	HAVANA	UTR	18209443	18211906	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000399777.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "nonsense_mediated_decay"; transcript_status "KNOWN"; transcript_name "BCL2L13-006"; level 2; protein_id "ENSP00000382677.1"; tag "mRNA_start_NF"; tag "cds_start_NF"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316189.3";
+chr22	HAVANA	transcript	18178504	18185129	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000479296.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BCL2L13-010"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316193.1";
+chr22	HAVANA	exon	18178504	18178976	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000479296.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BCL2L13-010"; exon_number 1; exon_id "ENSE00001926348.1"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316193.1";
+chr22	HAVANA	exon	18185009	18185129	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000479296.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BCL2L13-010"; exon_number 2; exon_id "ENSE00001895448.1"; level 2; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316193.1";
+chr22	HAVANA	transcript	18189476	18210436	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000485631.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BCL2L13-007"; level 1; tag "basic"; tag "exp_conf"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316190.1";
+chr22	HAVANA	exon	18189476	18189591	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000485631.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BCL2L13-007"; exon_number 1; exon_id "ENSE00001958207.1"; level 1; tag "basic"; tag "exp_conf"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316190.1";
+chr22	HAVANA	exon	18209443	18210436	.	+	.	gene_id "ENSG00000099968.13"; transcript_id "ENST00000485631.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BCL2L13"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BCL2L13-007"; exon_number 2; exon_id "ENSE00001826278.1"; level 1; tag "basic"; tag "exp_conf"; havana_gene "OTTHUMG00000150088.3"; havana_transcript "OTTHUMT00000316190.1";
+chr22	HAVANA	gene	18216906	18257536	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENSG00000015475.14"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID"; level 2; tag "ncRNA_host"; havana_gene "OTTHUMG00000150087.4";
+chr22	HAVANA	transcript	18216906	18256782	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	exon	18256376	18256782	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 1; exon_id "ENSE00001349079.5"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	CDS	18256376	18256455	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 1; exon_id "ENSE00001349079.5"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	start_codon	18256453	18256455	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 1; exon_id "ENSE00001349079.5"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	exon	18232871	18232940	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 2; exon_id "ENSE00003568392.1"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	CDS	18232871	18232940	.	-	1	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 2; exon_id "ENSE00003568392.1"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	exon	18226569	18226779	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 3; exon_id "ENSE00003565087.1"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	CDS	18226569	18226779	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 3; exon_id "ENSE00003565087.1"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	exon	18222115	18222254	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 4; exon_id "ENSE00003689682.1"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	CDS	18222115	18222254	.	-	2	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 4; exon_id "ENSE00003689682.1"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	exon	18220783	18220995	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 5; exon_id "ENSE00003542752.1"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	CDS	18220783	18220995	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 5; exon_id "ENSE00003542752.1"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	exon	18216906	18218357	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 6; exon_id "ENSE00001946765.1"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	CDS	18218349	18218357	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 6; exon_id "ENSE00001946765.1"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	stop_codon	18218346	18218348	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; exon_number 6; exon_id "ENSE00001946765.1"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	UTR	18256456	18256782	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	HAVANA	UTR	18216906	18218348	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000317361.7"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-002"; level 2; protein_id "ENSP00000318822.7"; tag "basic"; tag "CCDS"; ccdsid "CCDS13747.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316179.1";
+chr22	ENSEMBL	transcript	18216908	18257258	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	exon	18257147	18257258	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; exon_number 1; exon_id "ENSE00001540140.1"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	exon	18226569	18226779	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; exon_number 2; exon_id "ENSE00003489267.1"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	exon	18222115	18222254	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; exon_number 3; exon_id "ENSE00003616197.1"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	CDS	18222115	18222189	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; exon_number 3; exon_id "ENSE00003616197.1"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	start_codon	18222187	18222189	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; exon_number 3; exon_id "ENSE00003616197.1"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	exon	18220783	18220995	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; exon_number 4; exon_id "ENSE00003542752.1"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	CDS	18220783	18220995	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; exon_number 4; exon_id "ENSE00003542752.1"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	exon	18216908	18218357	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; exon_number 5; exon_id "ENSE00001389825.1"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	CDS	18218349	18218357	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; exon_number 5; exon_id "ENSE00001389825.1"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	stop_codon	18218346	18218348	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; exon_number 5; exon_id "ENSE00001389825.1"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	UTR	18257147	18257258	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	UTR	18226569	18226779	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	UTR	18222190	18222254	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	ENSEMBL	UTR	18216908	18218348	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399767.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-201"; level 3; protein_id "ENSP00000382669.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4";
+chr22	HAVANA	transcript	18216937	18257258	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	exon	18257147	18257258	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 1; exon_id "ENSE00001540140.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	exon	18232871	18232940	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 2; exon_id "ENSE00003526724.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	CDS	18232871	18232882	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 2; exon_id "ENSE00003526724.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	start_codon	18232880	18232882	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 2; exon_id "ENSE00003526724.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	exon	18226569	18226779	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 3; exon_id "ENSE00003565087.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	CDS	18226569	18226779	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 3; exon_id "ENSE00003565087.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	exon	18222115	18222254	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 4; exon_id "ENSE00003689682.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	CDS	18222115	18222254	.	-	2	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 4; exon_id "ENSE00003689682.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	exon	18220783	18220995	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 5; exon_id "ENSE00003542752.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	CDS	18220783	18220995	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 5; exon_id "ENSE00003542752.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	exon	18216937	18218357	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 6; exon_id "ENSE00001856820.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	CDS	18218349	18218357	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 6; exon_id "ENSE00001856820.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	stop_codon	18218346	18218348	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; exon_number 6; exon_id "ENSE00001856820.1"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	UTR	18257147	18257258	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	UTR	18232883	18232940	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	UTR	18216937	18218348	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399774.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-001"; level 2; protein_id "ENSP00000382674.3"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316178.1";
+chr22	HAVANA	transcript	18216941	18257255	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	exon	18257147	18257255	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; exon_number 1; exon_id "ENSE00001540096.1"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	exon	18222115	18222254	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; exon_number 2; exon_id "ENSE00003616197.1"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	CDS	18222115	18222189	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; exon_number 2; exon_id "ENSE00003616197.1"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	start_codon	18222187	18222189	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; exon_number 2; exon_id "ENSE00003616197.1"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	exon	18220783	18220995	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; exon_number 3; exon_id "ENSE00003542752.1"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	CDS	18220783	18220995	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; exon_number 3; exon_id "ENSE00003542752.1"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	exon	18216941	18218357	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; exon_number 4; exon_id "ENSE00001540093.1"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	CDS	18218349	18218357	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; exon_number 4; exon_id "ENSE00001540093.1"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	stop_codon	18218346	18218348	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; exon_number 4; exon_id "ENSE00001540093.1"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	UTR	18257147	18257255	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	UTR	18222190	18222254	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	UTR	18216941	18218348	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000399765.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-004"; level 2; protein_id "ENSP00000382667.1"; tag "basic"; tag "CCDS"; ccdsid "CCDS13749.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316181.1";
+chr22	HAVANA	transcript	18217988	18223960	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000494097.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "retained_intron"; transcript_status "KNOWN"; transcript_name "BID-005"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316182.1";
+chr22	HAVANA	exon	18222115	18223960	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000494097.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "retained_intron"; transcript_status "KNOWN"; transcript_name "BID-005"; exon_number 1; exon_id "ENSE00001855408.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316182.1";
+chr22	HAVANA	exon	18220783	18220995	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000494097.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "retained_intron"; transcript_status "KNOWN"; transcript_name "BID-005"; exon_number 2; exon_id "ENSE00003683851.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316182.1";
+chr22	HAVANA	exon	18217988	18218357	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000494097.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "retained_intron"; transcript_status "KNOWN"; transcript_name "BID-005"; exon_number 3; exon_id "ENSE00001892438.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316182.1";
+chr22	HAVANA	transcript	18218265	18257178	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	exon	18257147	18257178	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 1; exon_id "ENSE00002195037.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	exon	18232871	18232940	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 2; exon_id "ENSE00003526724.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	CDS	18232871	18232882	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 2; exon_id "ENSE00003526724.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	start_codon	18232880	18232882	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 2; exon_id "ENSE00003526724.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	exon	18226569	18226779	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 3; exon_id "ENSE00003565087.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	CDS	18226569	18226779	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 3; exon_id "ENSE00003565087.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	exon	18222848	18222942	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 4; exon_id "ENSE00001374791.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	CDS	18222848	18222942	.	-	2	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 4; exon_id "ENSE00001374791.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	exon	18222115	18222254	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 5; exon_id "ENSE00003668564.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	CDS	18222162	18222254	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 5; exon_id "ENSE00003668564.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	stop_codon	18222159	18222161	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 5; exon_id "ENSE00003668564.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	exon	18220783	18220995	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 6; exon_id "ENSE00003683851.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	exon	18218265	18218357	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; exon_number 7; exon_id "ENSE00001428765.1"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	UTR	18257147	18257178	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	UTR	18232883	18232940	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	UTR	18222115	18222161	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	UTR	18220783	18220995	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	UTR	18218265	18218357	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000342111.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-003"; level 2; protein_id "ENSP00000344594.5"; tag "NMD_exception"; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316180.3";
+chr22	HAVANA	transcript	18218318	18257178	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000550946.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "retained_intron"; transcript_status "KNOWN"; transcript_name "BID-011"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404246.1";
+chr22	HAVANA	exon	18257147	18257178	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000550946.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "retained_intron"; transcript_status "KNOWN"; transcript_name "BID-011"; exon_number 1; exon_id "ENSE00002195037.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404246.1";
+chr22	HAVANA	exon	18232871	18232940	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000550946.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "retained_intron"; transcript_status "KNOWN"; transcript_name "BID-011"; exon_number 2; exon_id "ENSE00003590401.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404246.1";
+chr22	HAVANA	exon	18226569	18226779	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000550946.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "retained_intron"; transcript_status "KNOWN"; transcript_name "BID-011"; exon_number 3; exon_id "ENSE00003489267.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404246.1";
+chr22	HAVANA	exon	18222115	18222942	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000550946.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "retained_intron"; transcript_status "KNOWN"; transcript_name "BID-011"; exon_number 4; exon_id "ENSE00002394631.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404246.1";
+chr22	HAVANA	exon	18220783	18220995	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000550946.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "retained_intron"; transcript_status "KNOWN"; transcript_name "BID-011"; exon_number 5; exon_id "ENSE00003683851.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404246.1";
+chr22	HAVANA	exon	18218318	18218357	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000550946.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "retained_intron"; transcript_status "KNOWN"; transcript_name "BID-011"; exon_number 6; exon_id "ENSE00003539371.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404246.1";
+chr22	HAVANA	transcript	18218318	18257431	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	exon	18257406	18257431	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 1; exon_id "ENSE00002343949.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	exon	18232871	18232940	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 2; exon_id "ENSE00003526724.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	CDS	18232871	18232882	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 2; exon_id "ENSE00003526724.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	start_codon	18232880	18232882	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 2; exon_id "ENSE00003526724.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	exon	18226569	18226779	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 3; exon_id "ENSE00003565087.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	CDS	18226569	18226779	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 3; exon_id "ENSE00003565087.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	exon	18222115	18222254	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 4; exon_id "ENSE00003689682.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	CDS	18222115	18222254	.	-	2	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 4; exon_id "ENSE00003689682.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	exon	18220783	18220995	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 5; exon_id "ENSE00003542752.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	CDS	18220783	18220995	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 5; exon_id "ENSE00003542752.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	exon	18218318	18218357	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 6; exon_id "ENSE00003487532.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	CDS	18218349	18218357	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 6; exon_id "ENSE00003487532.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	stop_codon	18218346	18218348	.	-	0	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; exon_number 6; exon_id "ENSE00003487532.1"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	UTR	18257406	18257431	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	UTR	18232883	18232940	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	UTR	18218318	18218348	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000551952.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "BID-009"; level 2; protein_id "ENSP00000449236.1"; tag "alternative_5_UTR"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13748.1"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404247.1";
+chr22	HAVANA	transcript	18220824	18257261	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000473439.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BID-006"; level 2; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316183.1";
+chr22	HAVANA	exon	18257147	18257261	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000473439.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BID-006"; exon_number 1; exon_id "ENSE00001917930.1"; level 2; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316183.1";
+chr22	HAVANA	exon	18226569	18226779	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000473439.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BID-006"; exon_number 2; exon_id "ENSE00003489267.1"; level 2; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316183.1";
+chr22	HAVANA	exon	18222115	18222254	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000473439.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BID-006"; exon_number 3; exon_id "ENSE00003500448.1"; level 2; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316183.1";
+chr22	HAVANA	exon	18220824	18220995	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000473439.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "processed_transcript"; transcript_status "PUTATIVE"; transcript_name "BID-006"; exon_number 4; exon_id "ENSE00001877316.1"; level 2; tag "basic"; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000316183.1";
+chr22	HAVANA	transcript	18222214	18257536	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000552886.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "BID-008"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404248.1";
+chr22	HAVANA	exon	18257459	18257536	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000552886.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "BID-008"; exon_number 1; exon_id "ENSE00002385433.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404248.1";
+chr22	HAVANA	exon	18226569	18226779	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000552886.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "BID-008"; exon_number 2; exon_id "ENSE00003489267.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404248.1";
+chr22	HAVANA	exon	18222214	18222254	.	-	.	gene_id "ENSG00000015475.14"; transcript_id "ENST00000552886.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "BID"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "BID-008"; exon_number 3; exon_id "ENSE00002342528.1"; level 2; havana_gene "OTTHUMG00000150087.4"; havana_transcript "OTTHUMT00000404248.1";
+chr22	HAVANA	gene	29454660	29457832	.	-	.	gene_id "ENSG00000100249.4"; transcript_id "ENSG00000100249.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31"; level 2; havana_gene "OTTHUMG00000151011.1";
+chr22	HAVANA	transcript	29454660	29457832	.	-	.	gene_id "ENSG00000100249.4"; transcript_id "ENST00000216071.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31-001"; level 2; protein_id "ENSP00000216071.4"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13848.1"; havana_gene "OTTHUMG00000151011.1"; havana_transcript "OTTHUMT00000320952.1";
+chr22	HAVANA	exon	29457778	29457832	.	-	.	gene_id "ENSG00000100249.4"; transcript_id "ENST00000216071.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31-001"; exon_number 1; exon_id "ENSE00001048193.2"; level 2; protein_id "ENSP00000216071.4"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13848.1"; havana_gene "OTTHUMG00000151011.1"; havana_transcript "OTTHUMT00000320952.1";
+chr22	HAVANA	CDS	29457778	29457780	.	-	0	gene_id "ENSG00000100249.4"; transcript_id "ENST00000216071.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31-001"; exon_number 1; exon_id "ENSE00001048193.2"; level 2; protein_id "ENSP00000216071.4"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13848.1"; havana_gene "OTTHUMG00000151011.1"; havana_transcript "OTTHUMT00000320952.1";
+chr22	HAVANA	start_codon	29457778	29457780	.	-	0	gene_id "ENSG00000100249.4"; transcript_id "ENST00000216071.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31-001"; exon_number 1; exon_id "ENSE00001048193.2"; level 2; protein_id "ENSP00000216071.4"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13848.1"; havana_gene "OTTHUMG00000151011.1"; havana_transcript "OTTHUMT00000320952.1";
+chr22	HAVANA	exon	29456403	29456831	.	-	.	gene_id "ENSG00000100249.4"; transcript_id "ENST00000216071.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31-001"; exon_number 2; exon_id "ENSE00000651998.1"; level 2; protein_id "ENSP00000216071.4"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13848.1"; havana_gene "OTTHUMG00000151011.1"; havana_transcript "OTTHUMT00000320952.1";
+chr22	HAVANA	CDS	29456403	29456831	.	-	0	gene_id "ENSG00000100249.4"; transcript_id "ENST00000216071.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31-001"; exon_number 2; exon_id "ENSE00000651998.1"; level 2; protein_id "ENSP00000216071.4"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13848.1"; havana_gene "OTTHUMG00000151011.1"; havana_transcript "OTTHUMT00000320952.1";
+chr22	HAVANA	exon	29454660	29455170	.	-	.	gene_id "ENSG00000100249.4"; transcript_id "ENST00000216071.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31-001"; exon_number 3; exon_id "ENSE00000879699.1"; level 2; protein_id "ENSP00000216071.4"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13848.1"; havana_gene "OTTHUMG00000151011.1"; havana_transcript "OTTHUMT00000320952.1";
+chr22	HAVANA	CDS	29454733	29455170	.	-	0	gene_id "ENSG00000100249.4"; transcript_id "ENST00000216071.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31-001"; exon_number 3; exon_id "ENSE00000879699.1"; level 2; protein_id "ENSP00000216071.4"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13848.1"; havana_gene "OTTHUMG00000151011.1"; havana_transcript "OTTHUMT00000320952.1";
+chr22	HAVANA	stop_codon	29454730	29454732	.	-	0	gene_id "ENSG00000100249.4"; transcript_id "ENST00000216071.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31-001"; exon_number 3; exon_id "ENSE00000879699.1"; level 2; protein_id "ENSP00000216071.4"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13848.1"; havana_gene "OTTHUMG00000151011.1"; havana_transcript "OTTHUMT00000320952.1";
+chr22	HAVANA	UTR	29457781	29457832	.	-	.	gene_id "ENSG00000100249.4"; transcript_id "ENST00000216071.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31-001"; level 2; protein_id "ENSP00000216071.4"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13848.1"; havana_gene "OTTHUMG00000151011.1"; havana_transcript "OTTHUMT00000320952.1";
+chr22	HAVANA	UTR	29454660	29454732	.	-	.	gene_id "ENSG00000100249.4"; transcript_id "ENST00000216071.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "C22orf31"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "C22orf31-001"; level 2; protein_id "ENSP00000216071.4"; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS13848.1"; havana_gene "OTTHUMG00000151011.1"; havana_transcript "OTTHUMT00000320952.1";

From 3f7148fcea69d84208adcf1d53c92999d6649d1b Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Fri, 28 Jun 2019 09:28:46 +0200
Subject: [PATCH 012/126] Relevant genes extracted from dbNSFP2.9_gene.

---
 scripts/importer/tests/data/dbNSFP_gene.txt | 5 +++++
 1 file changed, 5 insertions(+)
 create mode 100644 scripts/importer/tests/data/dbNSFP_gene.txt

diff --git a/scripts/importer/tests/data/dbNSFP_gene.txt b/scripts/importer/tests/data/dbNSFP_gene.txt
new file mode 100644
index 000000000..66967f047
--- /dev/null
+++ b/scripts/importer/tests/data/dbNSFP_gene.txt
@@ -0,0 +1,5 @@
+Gene_name	Ensembl_gene	chr	Gene_old_names	Gene_other_names	Uniprot_acc	Uniprot_id	Entrez_gene_id	CCDS_id	Refseq_id	ucsc_id	MIM_id	Gene_full_name	Pathway(BioCarta)_short	Pathway(BioCarta)_full	Pathway(ConsensusPathDB)	Pathway(KEGG)_id	Pathway(KEGG)_full	Function_description	Disease_description	MIM_phenotype_id	MIM_disease	Trait_association(GWAS)	GO_Slim_biological_process	GO_Slim_cellular_component	GO_Slim_molecular_function	Expression(egenetics)	Expression(GNF/Atlas)	Interactions(IntAct)	Interactions(BioGRID)	Interactions(ConsensusPathDB)	P(HI)	P(rec)	Known_rec_info	Essential_gene	MGI_mouse_gene	MGI_mouse_phenotype	ZFIN_zebrafish_gene	ZFIN_zebrafish_structure	ZFIN_zebrafish_phenotype_quality	ZFIN_zebrafish_phenotype_tag
+BCL2L13	ENSG00000099968	22	.	MIL1;BCL-RAMBO	Q9BXK5	B2L13_HUMAN	23786	CCDS13746.1;CCDS59447.1;CCDS59448.1	NM_015367;NM_001270727	uc002zmw.4	.	BCL2-like 13 (apoptosis facilitator)	.	.	Legionellosis - Homo sapiens (human)	.	.	May promote the activation of caspase-3 and apoptosis.	.	.	.	.	cell death	cellular_component;nucleus;mitochondrion	enzyme regulator activity;peptidase activity	medulla oblongata;smooth muscle;skin;bone marrow;retina;prostate;optic nerve;frontal lobe;endometrium;thyroid;iris;germinal center;bladder;brain;heart;cartilage;tongue;blood;lens;skeletal muscle;breast;macula lutea;visual apparatus;liver;alveolus;cervix;spleen;mammary gland;colon;parathyroid;fovea centralis;choroid;uterus;whole body;bone;pituitary gland;testis;unclassifiable (Anatomical System);lymph node;trophoblast;islets of Langerhans;bile duct;pancreas;lung;nasopharynx;placenta;duodenum;head and neck;kidney;stomach;thymus;cerebellum;	testis;	3	2	3	0.05910	.	.	.	Bcl2l13	.	.	.	.	.
+BID	ENSG00000015475	22	.	.	P55957	BID_HUMAN	637	CCDS13747.1;CCDS13748.1;CCDS13749.1	NM_197966;XR_244338	uc002znc.2	601997	BH3 interacting domain death agonist	chemicalPathway;HivnefPathway;deathPathway;mitochondriaPathway	Apoptotic Signaling in Response to DNA Damage;HIV-I Nef: negative effector of Fas and TNF;Induction of apoptosis through DR3 and DR4/5 Death Receptors ;Role of Mitochondria in Apoptotic Signaling	miRNA Regulation of DNA Damage Response;TP53 Network;Apoptosis Modulation and Signaling;Intrinsic Pathway for Apoptosis;Amyotrophic lateral sclerosis (ALS);ATM Signaling Pathway;Apoptosis;Apoptosis Modulation by HSP70;Integrated Breast Cancer Pathway;Alzheimers Disease;TNF alpha Signaling Pathway;Integrated Pancreatic Cancer Pathway;DNA Damage Response;Viral myocarditis - Homo sapiens (human);Alzheimer,s disease - Homo sapiens (human);Amyotrophic lateral sclerosis (ALS) - Homo sapiens (human);p53 signaling pathway - Homo sapiens (human);Tuberculosis - Homo sapiens (human);Natural killer cell mediated cytotoxicity - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Apoptosis - Homo sapiens (human);Direct p53 effectors;induction of apoptosis through dr3 and dr4/5 death receptors;Caspase Cascade in Apoptosis;Activation of BAD and translocation to mitochondria;Fas;TNF;TNFalpha;BH3-only proteins associate with and inactivate anti-apoptotic BCL-2 members;induction of apoptosis through dr3 and dr4/5 death receptors;Ceramide signaling pathway;FAS (CD95) signaling pathway;HIV-1 Nef: Negative effector of Fas and TNF-alpha;Intrinsic Pathway for Apoptosis;apoptotic signaling in response to dna damage;ATM pathway;Activation and oligomerization of BAK protein;hiv-1 nef: negative effector of fas and tnf;Activation, translocation and oligomerization of BAX;role of mitochondria in apoptotic signaling;Activation, myristolyation of BID and translocation to mitochondria;apoptotic signaling in response to dna damage;role of mitochondria in apoptotic signaling;hiv-1 nef: negative effector of fas and tnf;Activation, myristolyation of BID and translocation to mitochondria;Activation and oligomerization of BAK protein;Activation of BAD and translocation to mitochondria ;Activation of BH3-only proteins;BH3-only proteins associate with and inactivate anti-apoptotic BCL-2 members;Activation, translocation and oligomerization of BAX;Intrinsic Pathway for Apoptosis;Apoptosis	hsa04115;hsa04210;hsa04650	p53 signaling pathway;Apoptosis;Natural killer cell mediated cytotoxicity	The major proteolytic product p15 BID allows the release of cytochrome c (By similarity). Isoform 1, isoform 2 and isoform 4 induce ICE-like proteases and apoptosis. Isoform 3 does not induce apoptosis. Counters the protective effect of Bcl-2.	.	.	.	.	membrane organization;mitochondrion organization;protein complex assembly;anatomical structure development;biological_process;protein targeting;cell proliferation;cell death;cell cycle;signal transduction;transport	mitochondrion;cellular_component;cytosol	enzyme binding;molecular_function	myocardium;ovary;salivary gland;colon;parathyroid;fovea centralis;choroid;vein;skin;retina;uterus;prostate;optic nerve;whole body;frontal lobe;endometrium;bone;testis;germinal center;brain;unclassifiable (Anatomical System);lymph node;cartilage;heart;islets of Langerhans;lens;skeletal muscle;breast;pancreas;lung;placenta;macula lutea;visual apparatus;liver;spleen;cervix;kidney;stomach;	whole brain;liver;globus pallidus;white blood cells;whole blood;trigeminal ganglion;	24	42	72	0.06027	0.11574	lof-tolerant	N	Bid	cellular phenotype; homeostasis/metabolism phenotype; muscle phenotype; endocrine/exocrine gland phenotype; mortality/aging (characteristics involving the ability of an organism to live and age normally throughout development and life span); hematopoietic system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); respiratory system phenotype; liver/biliary system phenotype; immune system phenotype; vision/eye phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); 	.	.	.	.
+NEK2P2	ENSG00000231565	22	.	.	.	.	100379667	.	NG_016726	.	.	NEK2 pseudogene 2	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1	1	1	.	.	.	.	.	.	.	.	.	.
+POTEH	ENSG00000198062	22	ACTBL1;A26C3	POTE22;CT104.7	Q6S545	POTEH_HUMAN	23784	CCDS46658.1	NM_001136213	uc010gqp.2	608913	POTE ankyrin domain family, member H	.	.	.	.	.	.	.	.	.	.	.	.	.	prostate;testis;stomach;	.	1	1	1	0.04666	0.08864	.	.	.	.	.	.	.	.

From 08aaaef01aa60c161976d087322b25435c90c8aa Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Fri, 28 Jun 2019 10:52:40 +0200
Subject: [PATCH 013/126] Reference database contents added.

---
 scripts/importer/tests/data/reference.psql | 747 +++++++++++++++++++++
 1 file changed, 747 insertions(+)
 create mode 100644 scripts/importer/tests/data/reference.psql

diff --git a/scripts/importer/tests/data/reference.psql b/scripts/importer/tests/data/reference.psql
new file mode 100644
index 000000000..6adef74c3
--- /dev/null
+++ b/scripts/importer/tests/data/reference.psql
@@ -0,0 +1,747 @@
+COPY data.studies (id, pi_name, pi_email, contact_name, contact_email, title, study_description, publication_date, ref_doi) FROM stdin;
+1	name	email	name	email	SweGen	\N	2001-01-01 00:00:00	doi
+2	name2	email2	name2	email2	SweGen2	\N	2001-01-02 00:00:00	doi
+\.
+COPY data.datasets (id, study, short_name, full_name, browser_uri, beacon_uri, beacon_description, avg_seq_depth, seq_type, seq_tech, seq_center, dataset_size) FROM stdin;
+1	1	Dataset 1	Dataset 1	url	\N	\N	0	type	method	place	0
+2	2	Dataset 2	Dataset 2	url	\N	\N	0	type	method	place	0
+\.
+COPY data.reference_sets (id, reference_build, reference_name, ensembl_version, gencode_version, dbnsfp_version) FROM stdin;
+1	GRCh37p13	GRCh37p13	homo_sapiens_core_75_37	19	2.9.3
+\.
+COPY data.dataset_versions (id, dataset, reference_set, dataset_version, dataset_description, terms, available_from, ref_doi, data_contact_name, data_contact_link, num_variants, coverage_levels, portal_avail, file_access, beacon_access) FROM stdin;
+1	1	1	Version 1	desc	terms	2001-01-01 00:00:00	doi	place	email	18	{1,5,10,15,20,25,30,50,100}	t	REGISTERED	PUBLIC
+2	1	1	Version 2	desc	terms	2001-01-02 00:00:00	doi	place	email	12	{1,5,10,15,20,25,30,50,100}	t	REGISTERED	PUBLIC
+3	2	1	Version 1	desc	terms	2001-01-02 00:00:00	doi	place	email	12	{1,5,10,15,20,25,30,50,100}	t	REGISTERED	PUBLIC
+\.
+COPY beacon.beacon_dataset_counts_table (datasetid, dataset, callcount, variantcount) FROM stdin;
+\.
+COPY data.collections (id, study_name, ethnicity) FROM stdin;
+1	reg	undefined
+2	reg	undefined
+\.
+COPY data.coverage (id, dataset_version, chrom, pos, mean, median, coverage) FROM stdin;
+1	1	22	46515890	37.8400002	37	{1,1,1,1,0.99000001,0.959999979,0.860000014,0.0799999982,0}
+2	1	22	46515900	38.0200005	37	{1,1,1,1,0.99000001,0.970000029,0.850000024,0.0799999982,0}
+3	1	22	46515910	37.9700012	38	{1,1,1,1,0.99000001,0.959999979,0.850000024,0.0900000036,0}
+4	1	22	46515920	38.2700005	38	{1,1,1,1,0.99000001,0.959999979,0.870000005,0.0799999982,0}
+5	1	22	46515930	38.4000015	38	{1,1,1,1,0.99000001,0.959999979,0.860000014,0.100000001,0}
+6	1	22	46515940	38.5299988	38	{1,1,1,1,1,0.949999988,0.870000005,0.100000001,0}
+7	1	22	46515950	38.0499992	38	{1,1,1,1,0.99000001,0.939999998,0.870000005,0.109999999,0}
+8	1	22	46515960	37.9900017	37	{1,1,1,1,1,0.949999988,0.850000024,0.119999997,0}
+9	1	22	46515970	37.9000015	37	{1,1,1,1,0.99000001,0.959999979,0.860000014,0.109999999,0}
+10	1	22	46515980	37.4900017	37	{1,1,1,1,0.99000001,0.930000007,0.850000024,0.0900000036,0}
+11	1	22	46515990	37.9099998	37	{1,1,1,1,0.99000001,0.949999988,0.829999983,0.100000001,0}
+12	1	22	46516000	37.6300011	37	{1,1,1,1,0.99000001,0.949999988,0.819999993,0.100000001,0}
+13	1	22	46516010	37.7000008	37	{1,1,1,1,0.99000001,0.949999988,0.829999983,0.0900000036,0}
+14	1	22	46516020	37.6300011	37	{1,1,1,1,0.99000001,0.949999988,0.839999974,0.0900000036,0}
+15	1	22	46516030	37.8800011	37	{1,1,1,1,0.99000001,0.959999979,0.860000014,0.0799999982,0}
+16	1	22	46516040	37.0600014	36	{1,1,1,1,0.99000001,0.939999998,0.829999983,0.0700000003,0}
+17	1	22	46516050	36.3400002	36	{1,1,1,1,0.99000001,0.930000007,0.800000012,0.0599999987,0}
+18	1	22	46516060	36.2799988	36	{1,1,1,1,0.99000001,0.930000007,0.800000012,0.0599999987,0}
+19	1	22	46516070	35.8600006	35	{1,1,1,1,0.99000001,0.939999998,0.779999971,0.0599999987,0}
+20	1	22	46516080	35.3800011	35	{1,1,1,1,0.99000001,0.939999998,0.779999971,0.0599999987,0}
+21	1	22	46516090	35.1899986	34	{1,1,1,1,0.99000001,0.930000007,0.75999999,0.0599999987,0}
+22	1	22	46516100	34.8800011	34	{1,1,1,1,1,0.920000017,0.75,0.0399999991,0}
+23	1	22	46516110	35.1399994	35	{1,1,1,1,0.99000001,0.920000017,0.779999971,0.0500000007,0}
+24	1	22	46516120	35.2000008	34	{1,1,1,1,1,0.939999998,0.790000021,0.0500000007,0}
+25	1	22	46516130	35.2799988	35	{1,1,1,1,0.99000001,0.930000007,0.75999999,0.0500000007,0}
+26	2	22	16364820	75.4499969	71	{1,1,0.999000013,0.998000026,0.998000026,0.994000018,0.976000011,0.792999983,0.170000002}
+27	2	22	16364830	75.9400024	71	{1,1,0.999000013,0.999000013,0.998000026,0.994000018,0.977999985,0.801999986,0.179000005}
+28	2	22	16364840	74.8899994	70	{1,1,1,0.999000013,0.996999979,0.991999984,0.976999998,0.791999996,0.166999996}
+29	2	22	16364850	72.9400024	69	{1,1,0.999000013,0.999000013,0.996999979,0.991999984,0.976000011,0.772000015,0.157000005}
+30	2	22	16364860	71.0599976	67	{1,1,0.999000013,0.999000013,0.996999979,0.987999976,0.973999977,0.762000024,0.143999994}
+31	2	22	16364870	67.4100037	63	{1,1,0.999000013,0.998000026,0.996999979,0.986999989,0.968999982,0.722000003,0.112000003}
+32	2	22	16364880	64.2600021	60	{1,1,1,0.998000026,0.994000018,0.986999989,0.958000004,0.693000019,0.0799999982}
+33	2	22	16364890	60.9199982	58	{1,1,1,0.998000026,0.995000005,0.986000001,0.957000017,0.637000024,0.0560000017}
+34	2	22	16364900	58.8899994	56	{1,1,1,0.998000026,0.995000005,0.98299998,0.953000009,0.611999989,0.0419999994}
+35	2	22	16364910	57.5699997	54	{1,1,1,0.996999979,0.994000018,0.98299998,0.94599998,0.589999974,0.0370000005}
+36	2	22	16364920	56.25	53.5	{1,1,1,0.995999992,0.990999997,0.98299998,0.938000023,0.57099998,0.0299999993}
+37	2	22	16364930	55.1800003	53	{1,1,1,0.995999992,0.990999997,0.980000019,0.944000006,0.546999991,0.0250000004}
+38	2	22	16364940	55.1500015	53	{1,1,1,0.996999979,0.990999997,0.976999998,0.954999983,0.555999994,0.0260000005}
+39	2	22	16364950	54	52	{1,1,1,0.998000026,0.990999997,0.978999972,0.95599997,0.532000005,0.0189999994}
+40	2	22	16364960	51.6800003	50	{1,1,1,0.995999992,0.99000001,0.976000011,0.940999985,0.476000011,0.0140000004}
+41	2	22	16364970	50.6199989	48	{1,1,1,0.995999992,0.989000022,0.973999977,0.927999973,0.451000005,0.0109999999}
+42	2	22	16364980	50.5	48.5	{1,1,1,0.996999979,0.99000001,0.975000024,0.93900001,0.451000005,0.00999999978}
+43	2	22	16364990	50.8499985	49	{1,1,1,0.996999979,0.992999971,0.977999985,0.941999972,0.460000008,0.00999999978}
+44	2	22	16365000	50.9799995	49	{1,1,1,0.998000026,0.991999984,0.981999993,0.941999972,0.453999996,0.00999999978}
+45	2	22	16365010	51.2400017	49	{1,1,1,0.998000026,0.991999984,0.981999993,0.950999975,0.451999992,0.0109999999}
+46	2	22	16365020	52.4599991	50	{1,1,1,0.998000026,0.991999984,0.981000006,0.957000017,0.488999993,0.00999999978}
+47	2	22	16365030	52.9500008	51	{1,1,1,0.999000013,0.992999971,0.981999993,0.958999991,0.504999995,0.0109999999}
+48	2	22	16365040	53.5299988	51	{1,1,1,0.998000026,0.995000005,0.986999989,0.959999979,0.521000028,0.0120000001}
+\.
+COPY data.dataset_files (id, dataset_version, basename, uri, file_size) FROM stdin;
+\.
+COPY data.dataset_logos (id, dataset, mimetype, bytes) FROM stdin;
+\.
+COPY data.genes (id, reference_set, gene_id, gene_name, full_name, canonical_transcript, chrom, start_pos, end_pos, strand) FROM stdin;
+1	1	ENSG00000198062	POTEH	POTE ankyrin domain family, member H	ENST00000343518	22	16256441	16287937	-
+2	1	ENSG00000236666	POTEH-AS1	\N	ENST00000422014	22	16274560	16278602	+
+3	1	ENSG00000226474	LA16c-2F2.5	\N	ENST00000440999	22	16362385	16362561	+
+4	1	ENSG00000231565	NEK2P2	NEK2 pseudogene 2	ENST00000438441	22	16364867	16366204	+
+5	1	ENSG00000230471	LA16c-2F2.8	\N	ENST00000428118	22	16373081	16377055	+
+6	1	ENSG00000099968	BCL2L13	BCL2-like 13 (apoptosis facilitator)	ENST00000317582	22	18111621	18213388	+
+7	1	ENSG00000015475	BID	BH3 interacting domain death agonist	ENST00000317361	22	18216906	18257536	-
+8	1	ENSG00000100249	C22orf31	\N	ENST00000216071	22	29454660	29457832	-
+\.
+COPY data.transcripts (id, transcript_id, gene, mim_annotation, mim_gene_accession, chrom, start_pos, stop_pos, strand) FROM stdin;
+1	ENST00000452800	1	\N	\N	22	16256441	16287717	-
+2	ENST00000343518	1	\N	\N	22	16256441	16287937	-
+3	ENST00000422014	2	\N	\N	22	16274560	16278602	+
+4	ENST00000440999	3	\N	\N	22	16362385	16362561	+
+5	ENST00000438441	4	\N	\N	22	16364867	16366204	+
+6	ENST00000428118	5	\N	\N	22	16373081	16377055	+
+7	ENST00000399781	6	\N	\N	22	18111621	18178975	+
+8	ENST00000399782	6	\N	\N	22	18111682	18185194	+
+9	ENST00000317582	6	\N	\N	22	18121356	18211487	+
+10	ENST00000498133	6	\N	\N	22	18121507	18211465	+
+11	ENST00000543133	6	\N	\N	22	18121507	18211465	+
+12	ENST00000464649	6	\N	\N	22	18121523	18175161	+
+13	ENST00000538149	6	\N	\N	22	18121523	18210466	+
+14	ENST00000337612	6	\N	\N	22	18121530	18210428	+
+15	ENST00000493680	6	\N	\N	22	18121538	18186499	+
+16	ENST00000355028	6	\N	\N	22	18121577	18213388	+
+17	ENST00000418951	6	\N	\N	22	18138478	18210300	+
+18	ENST00000399777	6	\N	\N	22	18171840	18211906	+
+19	ENST00000479296	6	\N	\N	22	18178504	18185129	+
+20	ENST00000485631	6	\N	\N	22	18189476	18210436	+
+21	ENST00000317361	7	\N	\N	22	18216906	18256782	-
+22	ENST00000399767	7	\N	\N	22	18216908	18257258	-
+23	ENST00000399774	7	\N	\N	22	18216937	18257258	-
+24	ENST00000399765	7	\N	\N	22	18216941	18257255	-
+25	ENST00000494097	7	\N	\N	22	18217988	18223960	-
+26	ENST00000342111	7	\N	\N	22	18218265	18257178	-
+27	ENST00000550946	7	\N	\N	22	18218318	18257178	-
+28	ENST00000551952	7	\N	\N	22	18218318	18257431	-
+29	ENST00000473439	7	\N	\N	22	18220824	18257261	-
+30	ENST00000552886	7	\N	\N	22	18222214	18257536	-
+31	ENST00000216071	8	\N	\N	22	29454660	29457832	-
+\.
+COPY data.features (id, gene, transcript, chrom, start_pos, stop_pos, strand, feature_type) FROM stdin;
+1	1	1	22	16287254	16287717	-	exon
+2	1	1	22	16287254	16287717	-	CDS
+3	1	1	22	16282478	16282592	-	exon
+4	1	1	22	16282478	16282592	-	CDS
+5	1	1	22	16282145	16282318	-	exon
+6	1	1	22	16282145	16282318	-	CDS
+7	1	1	22	16280334	16280589	-	exon
+8	1	1	22	16280434	16280589	-	CDS
+9	1	1	22	16279195	16279301	-	exon
+10	1	1	22	16277748	16277885	-	exon
+11	1	1	22	16275207	16275277	-	exon
+12	1	1	22	16269873	16269943	-	exon
+13	1	1	22	16268137	16268181	-	exon
+14	1	1	22	16266929	16267095	-	exon
+15	1	1	22	16258185	16258303	-	exon
+16	1	1	22	16256441	16256677	-	exon
+17	1	1	22	16280334	16280433	-	UTR
+18	1	1	22	16279195	16279301	-	UTR
+19	1	1	22	16277748	16277885	-	UTR
+20	1	1	22	16275207	16275277	-	UTR
+21	1	1	22	16269873	16269943	-	UTR
+22	1	1	22	16268137	16268181	-	UTR
+23	1	1	22	16266929	16267095	-	UTR
+24	1	1	22	16258185	16258303	-	UTR
+25	1	1	22	16256441	16256677	-	UTR
+26	1	2	22	16287254	16287937	-	exon
+27	1	2	22	16287254	16287885	-	CDS
+28	1	2	22	16282478	16282592	-	exon
+29	1	2	22	16282478	16282592	-	CDS
+30	1	2	22	16282145	16282318	-	exon
+31	1	2	22	16282145	16282318	-	CDS
+32	1	2	22	16279195	16279301	-	exon
+33	1	2	22	16279195	16279301	-	CDS
+34	1	2	22	16277748	16277885	-	exon
+35	1	2	22	16277748	16277885	-	CDS
+36	1	2	22	16275207	16275277	-	exon
+37	1	2	22	16275207	16275277	-	CDS
+38	1	2	22	16269873	16269943	-	exon
+39	1	2	22	16269873	16269943	-	CDS
+40	1	2	22	16268137	16268181	-	exon
+41	1	2	22	16268137	16268181	-	CDS
+42	1	2	22	16266929	16267095	-	exon
+43	1	2	22	16266929	16267095	-	CDS
+44	1	2	22	16258185	16258303	-	exon
+45	1	2	22	16258189	16258303	-	CDS
+46	1	2	22	16256441	16256677	-	exon
+47	1	2	22	16287886	16287937	-	UTR
+48	1	2	22	16258185	16258188	-	UTR
+49	1	2	22	16256441	16256677	-	UTR
+50	2	3	22	16274560	16275003	+	exon
+51	2	3	22	16276481	16278602	+	exon
+52	3	4	22	16362385	16362561	+	exon
+53	4	5	22	16364867	16366204	+	exon
+54	5	6	22	16373081	16373121	+	exon
+55	5	6	22	16373830	16373911	+	exon
+56	5	6	22	16375449	16377055	+	exon
+57	6	7	22	18111621	18111672	+	exon
+58	6	7	22	18120868	18121466	+	exon
+59	6	7	22	18138428	18138598	+	exon
+60	6	7	22	18165980	18166087	+	exon
+61	6	7	22	18178907	18178975	+	exon
+62	6	8	22	18111682	18111771	+	exon
+63	6	8	22	18120868	18121466	+	exon
+64	6	8	22	18138428	18138598	+	exon
+65	6	8	22	18138478	18138598	+	CDS
+66	6	8	22	18165980	18166087	+	exon
+67	6	8	22	18165980	18166087	+	CDS
+68	6	8	22	18171752	18171908	+	exon
+69	6	8	22	18171752	18171908	+	CDS
+70	6	8	22	18178907	18178976	+	exon
+71	6	8	22	18178907	18178976	+	CDS
+72	6	8	22	18185009	18185194	+	exon
+73	6	8	22	18185009	18185155	+	CDS
+74	6	8	22	18111682	18111771	+	UTR
+75	6	8	22	18120868	18121466	+	UTR
+76	6	8	22	18138428	18138477	+	UTR
+77	6	8	22	18185156	18185194	+	UTR
+78	6	9	22	18121356	18121652	+	exon
+79	6	9	22	18138428	18138598	+	exon
+80	6	9	22	18138478	18138598	+	CDS
+81	6	9	22	18165980	18166087	+	exon
+82	6	9	22	18165980	18166087	+	CDS
+83	6	9	22	18171752	18171908	+	exon
+84	6	9	22	18171752	18171908	+	CDS
+85	6	9	22	18178907	18178976	+	exon
+86	6	9	22	18178907	18178976	+	CDS
+87	6	9	22	18185009	18185152	+	exon
+88	6	9	22	18185009	18185152	+	CDS
+89	6	9	22	18209443	18211487	+	exon
+90	6	9	22	18209443	18210297	+	CDS
+91	6	9	22	18121356	18121652	+	UTR
+92	6	9	22	18138428	18138477	+	UTR
+93	6	9	22	18210298	18211487	+	UTR
+94	6	10	22	18121507	18121652	+	exon
+95	6	10	22	18138428	18138598	+	exon
+96	6	10	22	18138478	18138598	+	CDS
+97	6	10	22	18165980	18166087	+	exon
+98	6	10	22	18165980	18166087	+	CDS
+99	6	10	22	18178907	18178976	+	exon
+100	6	10	22	18178907	18178911	+	CDS
+101	6	10	22	18185009	18185152	+	exon
+102	6	10	22	18209443	18211465	+	exon
+103	6	10	22	18121507	18121652	+	UTR
+104	6	10	22	18138428	18138477	+	UTR
+105	6	10	22	18178912	18178976	+	UTR
+106	6	10	22	18185009	18185152	+	UTR
+107	6	10	22	18209443	18211465	+	UTR
+108	6	11	22	18121507	18121652	+	exon
+109	6	11	22	18138428	18138598	+	exon
+110	6	11	22	18165980	18166087	+	exon
+111	6	11	22	18178907	18178976	+	exon
+112	6	11	22	18185009	18185152	+	exon
+113	6	11	22	18185039	18185152	+	CDS
+114	6	11	22	18209443	18211465	+	exon
+115	6	11	22	18209443	18210297	+	CDS
+116	6	11	22	18121507	18121652	+	UTR
+117	6	11	22	18138428	18138598	+	UTR
+118	6	11	22	18165980	18166087	+	UTR
+119	6	11	22	18178907	18178976	+	UTR
+120	6	11	22	18185009	18185038	+	UTR
+121	6	11	22	18210298	18211465	+	UTR
+122	6	12	22	18121523	18121652	+	exon
+123	6	12	22	18165980	18166087	+	exon
+124	6	12	22	18171752	18171908	+	exon
+125	6	12	22	18175122	18175161	+	exon
+126	6	13	22	18121523	18121652	+	exon
+127	6	13	22	18138428	18138598	+	exon
+128	6	13	22	18138515	18138598	+	CDS
+129	6	13	22	18185009	18185152	+	exon
+130	6	13	22	18185009	18185152	+	CDS
+131	6	13	22	18209443	18210466	+	exon
+132	6	13	22	18209443	18210297	+	CDS
+133	6	13	22	18121523	18121652	+	UTR
+134	6	13	22	18138428	18138514	+	UTR
+135	6	13	22	18210298	18210466	+	UTR
+136	6	14	22	18121530	18121652	+	exon
+137	6	14	22	18138428	18138598	+	exon
+138	6	14	22	18165980	18166087	+	exon
+139	6	14	22	18185009	18185152	+	exon
+140	6	14	22	18185039	18185152	+	CDS
+141	6	14	22	18209443	18210428	+	exon
+142	6	14	22	18209443	18210297	+	CDS
+143	6	14	22	18121530	18121652	+	UTR
+144	6	14	22	18138428	18138598	+	UTR
+145	6	14	22	18165980	18166087	+	UTR
+146	6	14	22	18185009	18185038	+	UTR
+147	6	14	22	18210298	18210428	+	UTR
+148	6	15	22	18121538	18121652	+	exon
+149	6	15	22	18138428	18138598	+	exon
+150	6	15	22	18138478	18138598	+	CDS
+151	6	15	22	18165980	18166087	+	exon
+152	6	15	22	18165980	18166087	+	CDS
+153	6	15	22	18171752	18171908	+	exon
+154	6	15	22	18171752	18171908	+	CDS
+155	6	15	22	18178907	18178976	+	exon
+156	6	15	22	18178907	18178976	+	CDS
+157	6	15	22	18185009	18186499	+	exon
+158	6	15	22	18185009	18185155	+	CDS
+159	6	15	22	18121538	18121652	+	UTR
+160	6	15	22	18138428	18138477	+	UTR
+161	6	15	22	18185156	18186499	+	UTR
+162	6	16	22	18121577	18121652	+	exon
+163	6	16	22	18138428	18138598	+	exon
+164	6	16	22	18138478	18138598	+	CDS
+165	6	16	22	18165980	18166087	+	exon
+166	6	16	22	18165980	18166087	+	CDS
+167	6	16	22	18171752	18171908	+	exon
+168	6	16	22	18171752	18171908	+	CDS
+169	6	16	22	18209443	18213388	+	exon
+170	6	16	22	18209443	18209569	+	CDS
+171	6	16	22	18121577	18121652	+	UTR
+172	6	16	22	18138428	18138477	+	UTR
+173	6	16	22	18209570	18213388	+	UTR
+174	6	17	22	18138478	18138598	+	exon
+175	6	17	22	18138478	18138598	+	CDS
+176	6	17	22	18165980	18166087	+	exon
+177	6	17	22	18165980	18166087	+	CDS
+178	6	17	22	18167375	18167472	+	exon
+179	6	17	22	18167375	18167457	+	CDS
+180	6	17	22	18171752	18171908	+	exon
+181	6	17	22	18209443	18210300	+	exon
+182	6	17	22	18167458	18167472	+	UTR
+183	6	17	22	18171752	18171908	+	UTR
+184	6	17	22	18209443	18210300	+	UTR
+185	6	18	22	18171840	18171908	+	exon
+186	6	18	22	18171840	18171908	+	CDS
+187	6	18	22	18185009	18185152	+	exon
+188	6	18	22	18185009	18185051	+	CDS
+189	6	18	22	18209443	18211906	+	exon
+190	6	18	22	18185052	18185152	+	UTR
+191	6	18	22	18209443	18211906	+	UTR
+192	6	19	22	18178504	18178976	+	exon
+193	6	19	22	18185009	18185129	+	exon
+194	6	20	22	18189476	18189591	+	exon
+195	6	20	22	18209443	18210436	+	exon
+196	7	21	22	18256376	18256782	-	exon
+197	7	21	22	18256376	18256455	-	CDS
+198	7	21	22	18232871	18232940	-	exon
+199	7	21	22	18232871	18232940	-	CDS
+200	7	21	22	18226569	18226779	-	exon
+201	7	21	22	18226569	18226779	-	CDS
+202	7	21	22	18222115	18222254	-	exon
+203	7	21	22	18222115	18222254	-	CDS
+204	7	21	22	18220783	18220995	-	exon
+205	7	21	22	18220783	18220995	-	CDS
+206	7	21	22	18216906	18218357	-	exon
+207	7	21	22	18218349	18218357	-	CDS
+208	7	21	22	18256456	18256782	-	UTR
+209	7	21	22	18216906	18218348	-	UTR
+210	7	22	22	18257147	18257258	-	exon
+211	7	22	22	18226569	18226779	-	exon
+212	7	22	22	18222115	18222254	-	exon
+213	7	22	22	18222115	18222189	-	CDS
+214	7	22	22	18220783	18220995	-	exon
+215	7	22	22	18220783	18220995	-	CDS
+216	7	22	22	18216908	18218357	-	exon
+217	7	22	22	18218349	18218357	-	CDS
+218	7	22	22	18257147	18257258	-	UTR
+219	7	22	22	18226569	18226779	-	UTR
+220	7	22	22	18222190	18222254	-	UTR
+221	7	22	22	18216908	18218348	-	UTR
+222	7	23	22	18257147	18257258	-	exon
+223	7	23	22	18232871	18232940	-	exon
+224	7	23	22	18232871	18232882	-	CDS
+225	7	23	22	18226569	18226779	-	exon
+226	7	23	22	18226569	18226779	-	CDS
+227	7	23	22	18222115	18222254	-	exon
+228	7	23	22	18222115	18222254	-	CDS
+229	7	23	22	18220783	18220995	-	exon
+230	7	23	22	18220783	18220995	-	CDS
+231	7	23	22	18216937	18218357	-	exon
+232	7	23	22	18218349	18218357	-	CDS
+233	7	23	22	18257147	18257258	-	UTR
+234	7	23	22	18232883	18232940	-	UTR
+235	7	23	22	18216937	18218348	-	UTR
+236	7	24	22	18257147	18257255	-	exon
+237	7	24	22	18222115	18222254	-	exon
+238	7	24	22	18222115	18222189	-	CDS
+239	7	24	22	18220783	18220995	-	exon
+240	7	24	22	18220783	18220995	-	CDS
+241	7	24	22	18216941	18218357	-	exon
+242	7	24	22	18218349	18218357	-	CDS
+243	7	24	22	18257147	18257255	-	UTR
+244	7	24	22	18222190	18222254	-	UTR
+245	7	24	22	18216941	18218348	-	UTR
+246	7	25	22	18222115	18223960	-	exon
+247	7	25	22	18220783	18220995	-	exon
+248	7	25	22	18217988	18218357	-	exon
+249	7	26	22	18257147	18257178	-	exon
+250	7	26	22	18232871	18232940	-	exon
+251	7	26	22	18232871	18232882	-	CDS
+252	7	26	22	18226569	18226779	-	exon
+253	7	26	22	18226569	18226779	-	CDS
+254	7	26	22	18222848	18222942	-	exon
+255	7	26	22	18222848	18222942	-	CDS
+256	7	26	22	18222115	18222254	-	exon
+257	7	26	22	18222162	18222254	-	CDS
+258	7	26	22	18220783	18220995	-	exon
+259	7	26	22	18218265	18218357	-	exon
+260	7	26	22	18257147	18257178	-	UTR
+261	7	26	22	18232883	18232940	-	UTR
+262	7	26	22	18222115	18222161	-	UTR
+263	7	26	22	18220783	18220995	-	UTR
+264	7	26	22	18218265	18218357	-	UTR
+265	7	27	22	18257147	18257178	-	exon
+266	7	27	22	18232871	18232940	-	exon
+267	7	27	22	18226569	18226779	-	exon
+268	7	27	22	18222115	18222942	-	exon
+269	7	27	22	18220783	18220995	-	exon
+270	7	27	22	18218318	18218357	-	exon
+271	7	28	22	18257406	18257431	-	exon
+272	7	28	22	18232871	18232940	-	exon
+273	7	28	22	18232871	18232882	-	CDS
+274	7	28	22	18226569	18226779	-	exon
+275	7	28	22	18226569	18226779	-	CDS
+276	7	28	22	18222115	18222254	-	exon
+277	7	28	22	18222115	18222254	-	CDS
+278	7	28	22	18220783	18220995	-	exon
+279	7	28	22	18220783	18220995	-	CDS
+280	7	28	22	18218318	18218357	-	exon
+281	7	28	22	18218349	18218357	-	CDS
+282	7	28	22	18257406	18257431	-	UTR
+283	7	28	22	18232883	18232940	-	UTR
+284	7	28	22	18218318	18218348	-	UTR
+285	7	29	22	18257147	18257261	-	exon
+286	7	29	22	18226569	18226779	-	exon
+287	7	29	22	18222115	18222254	-	exon
+288	7	29	22	18220824	18220995	-	exon
+289	7	30	22	18257459	18257536	-	exon
+290	7	30	22	18226569	18226779	-	exon
+291	7	30	22	18222214	18222254	-	exon
+292	8	31	22	29457778	29457832	-	exon
+293	8	31	22	29457778	29457780	-	CDS
+294	8	31	22	29456403	29456831	-	exon
+295	8	31	22	29456403	29456831	-	CDS
+296	8	31	22	29454660	29455170	-	exon
+297	8	31	22	29454733	29455170	-	CDS
+298	8	31	22	29457781	29457832	-	UTR
+299	8	31	22	29454660	29454732	-	UTR
+\.
+COPY data.gene_other_names (id, gene, name) FROM stdin;
+1	1	POTE22
+2	1	CT104.7
+3	6	MIL1
+4	6	BCL-RAMBO
+\.
+COPY data.mates (id, dataset_version, chrom_id, pos, ref, alt, chrom, mate_chrom, mate_start, mate_id, allele_freq, variant_id, allele_count, allele_num) FROM stdin;
+\.
+COPY data.metrics (id, dataset_version, metric, mids, hist) FROM stdin;
+\.
+COPY data.sample_sets (id, dataset, collection, sample_size, phenotype) FROM stdin;
+1	1	1	0	Undefined
+2	2	1	0	Undefined
+\.
+COPY data.variants (id, dataset_version, variant_type, rsid, chrom, pos, ref, alt, site_quality, orig_alt_alleles, hom_count, allele_freq, filter_string, variant_id, allele_count, allele_num, quality_metrics, vep_annotations) FROM stdin;
+1	1	\N	\N	22	18118637	A	G	212919	{22-18118637-A-G}	\N	1	PASS	22-18118637-A-G	600	600	{"DP": "7320", "FS": "0", "MQ": "60", "QD": "29.98", "VQSLOD": "3.22", "MQRankSum": "-0.413", "BaseQRankSum": "1.45", "ReadPosRankSum": "0.867", "ClippingRankSum": "1.24", "InbreedingCoeff": "-0"}	[{"AF": "1", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2719", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2893", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2940", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399781.1:n.53-2231A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000399781", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382682", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399782.1:c.-649-2231A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "1/6", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399782", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000464649", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2886", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000434764", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000493680", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2901", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2870", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2886", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2870", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2713", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2713", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2713", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2713", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2713", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2713", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2713", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2713", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2713", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2713", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.-592-2231A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "1/6", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261289.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261232.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "2713", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}, {"AF": "1", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.-835-2231A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "1", "AMR_AF": "1", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "1", "EUR_AF": "1", "IMPACT": "MODIFIER", "INTRON": "1/5", "MAX_AF": "1", "PUBMED": "", "SAS_AF": "1", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR&AMR&EAS&EUR&SAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4256048", "MOTIF_SCORE_CHANGE": ""}]
+2	1	\N	\N	22	18159071	CA	C	159520	{22-18159071-CA-C}	\N	0.876666665	PASS	22-18159071-CA-C	526	600	{"DP": "7580", "FS": "0.967", "MQ": "60", "QD": "23.78", "VQSLOD": "3.21", "MQRankSum": "0.024", "BaseQRankSum": "0.213", "ReadPosRankSum": "0.588", "ClippingRankSum": "-0.194", "InbreedingCoeff": "-0.1107"}	[{"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.-138-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399781.1:n.823-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000399781", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382682", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399782.1:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "3/6", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399782", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000464649.1:n.131-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/3", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000464649", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000434764", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000493680.1:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000493680", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.84+20482del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.-208-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.194-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.194-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.121+20482del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.-208-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.-208-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.-295-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.287-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.172-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.194-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261289.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261232.1:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261232.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.122-6900del", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "-", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "8", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "deletion", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs11343596", "MOTIF_SCORE_CHANGE": ""}]
+3	1	\N	\N	22	18159407	T	C	253125	{22-18159407-T-C}	\N	0.873333335	PASS	22-18159407-T-C	524	600	{"DP": "10409", "FS": "0", "MQ": "60", "QD": "24.69", "VQSLOD": "6.91", "MQRankSum": "-0.121", "BaseQRankSum": "-2.616", "ReadPosRankSum": "0.347", "ClippingRankSum": "-0.155", "InbreedingCoeff": "-0.1149"}	[{"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "YES", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.-138-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399781.1:n.823-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000399781", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382682", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399782.1:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399782", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000464649.1:n.131-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000464649", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000434764", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000493680.1:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000493680", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.84+20809T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.-208-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.194-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.194-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.121+20809T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.-208-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.-208-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.-295-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.287-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.172-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.194-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "YES", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261289.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261232.1:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261232.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8646", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.122-6573T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9281", "AMR_AF": "0.853", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535694", "MOTIF_SCORE_CHANGE": ""}]
+4	1	\N	\N	22	18163136	A	C	167770	{22-18163136-A-C}	\N	0.867892981	PASS	22-18163136-A-C	519	598	{"DP": "6358", "FS": "1.964", "MQ": "59.45", "QD": "29.62", "VQSLOD": "0.808", "MQRankSum": "0.102", "BaseQRankSum": "0.67", "ReadPosRankSum": "0.274", "ClippingRankSum": "-0.34", "InbreedingCoeff": "-0.0744"}	[{"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.-138-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399781.1:n.823-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000399781", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382682", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399782.1:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399782", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000464649.1:n.131-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000464649", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000434764", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000493680.1:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000493680", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.85-21873A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.-208-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.194-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.194-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.122-21873A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.-208-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.-208-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.-295-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.287-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.172-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.194-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261289.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261232.1:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261232.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8524", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.122-2844A>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.885", "AMR_AF": "0.8473", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs9605381", "MOTIF_SCORE_CHANGE": ""}]
+5	1	\N	\N	22	18163308	G	A	49925.8008	{22-18163308-G-A}	\N	0.746350348	VQSRTrancheSNP99.70to99.90	22-18163308-G-A	409	548	{"DP": "3616", "FS": "3.907", "MQ": "58.52", "QD": "24.33", "VQSLOD": "-3.268", "MQRankSum": "0.289", "BaseQRankSum": "0.573", "ReadPosRankSum": "0.067", "ClippingRankSum": "0.135", "InbreedingCoeff": "0.256"}	[{"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "YES", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.-138-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399781.1:n.823-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000399781", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382682", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399782.1:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "3/6", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399782", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000464649.1:n.131-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/3", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000464649", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000434764", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000493680.1:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000493680", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.85-21701G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.-208-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.194-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.194-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.122-21701G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.-208-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.-208-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.-295-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.287-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.172-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.194-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "YES", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261289.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261232.1:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261232.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.122-2672G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "", "AMR_AF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "", "EUR_AF": "", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "", "PUBMED": "", "SAS_AF": "", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs3994810", "MOTIF_SCORE_CHANGE": ""}]
+6	1	\N	\N	22	18167478	T	C	84068	{22-18167478-T-C}	\N	0.608333349	PASS	22-18167478-T-C	365	600	{"DP": "5798", "FS": "0", "MQ": "60", "QD": "19.03", "VQSLOD": "2.38", "MQRankSum": "-0.045", "BaseQRankSum": "-1.48", "ReadPosRankSum": "0.143", "ClippingRankSum": "0.025", "InbreedingCoeff": "0.0153"}	[{"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.229+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/6", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "YES", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.-31+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.229+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382677", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "cds_start_NF", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000399777", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001F77C70", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "4362", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399781.1:n.930+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000399781", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382682", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399782.1:c.229+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "4/6", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399782", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.*12+6T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "LOW", "INTRON": "3/4", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "splice_region_variant&intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000464649.1:n.238+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000464649", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000434764", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000493680.1:c.229+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000493680", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.229+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.85-17531T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.-101+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.301+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.301+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.122-17531T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.-101+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.-101+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.-188+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.229+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.229+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.229+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.229+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/6", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.394+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.377+6T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "LOW", "INTRON": "3/4", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "splice_region_variant&intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.301+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/6", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "YES", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261289.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261232.1:c.229+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261232.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.229+1391T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.7821", "AMR_AF": "0.7133", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.8502", "EUR_AF": "0.6501", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "0.8534", "PUBMED": "", "SAS_AF": "0.7127", "SOURCE": "", "STRAND": "", "SYMBOL": "", "TREMBL": "", "BIOTYPE": "promoter_flanking_region", "DOMAINS": "", "Feature": "ENSR00000143556", "HGNC_ID": "", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "", "CANONICAL": "", "GIVEN_REF": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "0.713", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "regulatory_region_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "gnomAD_EAS", "CDS_position": "", "Feature_type": "RegulatoryFeature", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "0.7701", "gnomAD_AMR_AF": "0.7356", "gnomAD_ASJ_AF": "0.6607", "gnomAD_EAS_AF": "0.8534", "gnomAD_FIN_AF": "0.6225", "gnomAD_NFE_AF": "0.6667", "gnomAD_OTH_AF": "0.677", "gnomAD_SAS_AF": "0.7406", "Protein_position": "", "Existing_variation": "rs5747326", "MOTIF_SCORE_CHANGE": ""}]
+7	1	\N	\N	22	18184011	G	A	289332	{22-18184011-G-A}	\N	0.873333335	PASS	22-18184011-G-A	524	600	{"DP": "10746", "FS": "0", "MQ": "60", "QD": "27.42", "VQSLOD": "3.7", "MQRankSum": "0.266", "BaseQRankSum": "0.919", "ReadPosRankSum": "0.361", "ClippingRankSum": "0.106", "InbreedingCoeff": "-0.1149"}	[{"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.457-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "YES", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.-30-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.386+12103G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382677", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000399777.1:c.70-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/2", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000399777", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001F77C70", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382682", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399782.1:c.457-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399782", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.*169+12103G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000479296.1:n.474-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000479296", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000434764", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000493680.1:c.457-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000493680", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.*63-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.85-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.-30-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.529-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.528+5035G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.122-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.-30-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.-30-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.-30-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.230-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.386+12103G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.229+17924G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.457-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.551+12103G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.534+12103G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.529-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "YES", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261289.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261232.1:c.457-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261232.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8586", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.230-998G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9085", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "A", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587082", "MOTIF_SCORE_CHANGE": ""}]
+8	1	\N	\N	22	18184290	T	C	242253	{22-18184290-T-C}	\N	0.873333335	PASS	22-18184290-T-C	524	600	{"DP": "10394", "FS": "0.846", "MQ": "60", "QD": "24.06", "VQSLOD": "3.93", "MQRankSum": "-0.06", "BaseQRankSum": "-2.561", "ReadPosRankSum": "0.315", "ClippingRankSum": "-0.19", "InbreedingCoeff": "-0.1149"}	[{"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.457-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/6", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "YES", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.-30-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.386+12382T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382677", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000399777.1:c.70-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/2", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000399777", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001F77C70", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382682", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399782.1:c.457-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399782", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.*169+12382T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000479296.1:n.474-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000479296", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000434764", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000493680.1:c.457-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000493680", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000002A4BC", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.*63-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.85-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.-30-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.529-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.528+5314T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.122-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.-30-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.-30-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.-30-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.230-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.386+12382T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.229+18203T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.457-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/6", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.551+12382T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.534+12382T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.529-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/6", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "YES", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261289.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261232.1:c.457-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261232.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.230-719T>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587083", "MOTIF_SCORE_CHANGE": ""}]
+9	1	\N	\N	22	18191951	A	G	190711	{22-18191951-A-G}	\N	0.88499999	PASS	22-18191951-A-G	531	600	{"DP": "8191", "FS": "0", "MQ": "59.4", "QD": "24.2", "VQSLOD": "3.94", "MQRankSum": "0.035", "BaseQRankSum": "-1.061", "ReadPosRankSum": "0.246", "ClippingRankSum": "0.158", "InbreedingCoeff": "-0.0972"}	[{"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.600+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.114+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.387-17492A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382677", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000399777.1:c.*98+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/2", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000399777", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001F77C70", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.*170-17492A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000485631.1:n.116+2360A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000485631", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.*206+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.228+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.114+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.672+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.528+12975A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.265+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.114+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.114+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.114+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.373+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257662.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270733.1:c.-241+2360A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270733.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.387-17492A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.230-17492A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.600+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.552-17492A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.535-17492A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.672+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.373+6799A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7618", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535711", "MOTIF_SCORE_CHANGE": ""}]
+10	1	\N	\N	22	18192136	A	G	238291	{22-18192136-A-G}	\N	0.88499999	PASS	22-18192136-A-G	531	600	{"DP": "9824", "FS": "0", "MQ": "60", "QD": "25.06", "VQSLOD": "4.27", "MQRankSum": "-0.037", "BaseQRankSum": "-2.317", "ReadPosRankSum": "0.154", "ClippingRankSum": "-0.205", "InbreedingCoeff": "-0.0972"}	[{"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.600+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.114+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.387-17307A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382677", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000399777.1:c.*98+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "2/2", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000399777", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001F77C70", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.*170-17307A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000485631.1:n.116+2545A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000485631", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.*206+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.228+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.114+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.672+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.528+13160A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.265+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.114+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.114+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.114+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.373+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257662.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270733.1:c.-241+2545A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270733.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.387-17307A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.230-17307A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.600+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.552-17307A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.535-17307A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.672+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8582", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.373+6984A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535712", "MOTIF_SCORE_CHANGE": ""}]
+11	1	\N	\N	22	18193560	A	G	181696	{22-18193560-A-G}	\N	0.88166666	PASS	22-18193560-A-G	529	600	{"DP": "7200", "FS": "0", "MQ": "60", "QD": "26.27", "VQSLOD": "3.52", "MQRankSum": "-0.047", "BaseQRankSum": "-0.965", "ReadPosRankSum": "0.35", "ClippingRankSum": "0.107", "InbreedingCoeff": "-0.1017"}	[{"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.600+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.114+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.387-15883A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382677", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000399777.1:c.*98+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "2/2", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000399777", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001F77C70", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.*170-15883A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000485631.1:n.116+3969A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000485631", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.*206+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.228+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.114+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.672+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.528+14584A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.265+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.114+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.114+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.114+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.373+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257662.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270733.1:c.-241+3969A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270733.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.387-15883A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.230-15883A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.600+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.552-15883A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.535-15883A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.672+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.373+8408A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8501", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs4819462", "MOTIF_SCORE_CHANGE": ""}]
+12	1	\N	\N	22	18197172	G	C	192554	{22-18197172-G-C}	\N	0.870000005	PASS	22-18197172-G-C	522	600	{"DP": "7689", "FS": "0", "MQ": "60", "QD": "25.84", "VQSLOD": "3.47", "MQRankSum": "0.026", "BaseQRankSum": "-1.623", "ReadPosRankSum": "0.416", "ClippingRankSum": "-0.075", "InbreedingCoeff": "-0.1035"}	[{"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.600+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "YES", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.114+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.387-12271G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382677", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000399777.1:c.*98+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "2/2", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000399777", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001F77C70", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.*170-12271G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000485631.1:n.116+7581G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000485631", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.*206+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.228+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.114+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.672+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.529-12271G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.265+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.114+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.114+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.114+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.373+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257662.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270733.1:c.-241+7581G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270733.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.387-12271G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.230-12271G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.600+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.552-12271G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.535-12271G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.672+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "YES", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.373+12020G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs5992098", "MOTIF_SCORE_CHANGE": ""}]
+13	1	\N	\N	22	18198327	C	G	244937	{22-18198327-C-G}	\N	0.873333335	PASS	22-18198327-C-G	524	600	{"DP": "9590", "FS": "0.858", "MQ": "60", "QD": "26.7", "VQSLOD": "4.19", "MQRankSum": "-0.029", "BaseQRankSum": "0.217", "ReadPosRankSum": "0.491", "ClippingRankSum": "0.168", "InbreedingCoeff": "-0.1149"}	[{"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.601-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "YES", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.115-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.387-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382677", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000399777.1:c.*99-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/2", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000399777", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001F77C70", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.*170-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000485631.1:n.116+8736C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000485631", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.*207-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.229-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.115-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.673-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.529-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.266-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.115-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.115-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.115-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.374-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257662.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270733.1:c.-241+8736C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270733.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.387-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.230-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.601-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.552-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.535-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.673-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "YES", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8648", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.374-11116C>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9289", "AMR_AF": "0.853", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7628", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2109659", "MOTIF_SCORE_CHANGE": ""}]
+14	1	\N	\N	22	18201526	G	C	264315	{22-18201526-G-C}	\N	0.873333335	PASS	22-18201526-G-C	524	600	{"DP": "9775", "FS": "0", "MQ": "60", "QD": "27.91", "VQSLOD": "6.05", "MQRankSum": "0.084", "BaseQRankSum": "0.35", "ReadPosRankSum": "0.299", "ClippingRankSum": "-0.161", "InbreedingCoeff": "-0.1149"}	[{"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.601-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "YES", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.115-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.387-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382677", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000399777.1:c.*99-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "2/2", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000399777", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001F77C70", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.*170-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000485631.1:n.117-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000485631", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.*207-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.229-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.115-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.673-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.529-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.266-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.115-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.115-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.115-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.374-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257662.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270733.1:c.-240-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270733.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.387-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.230-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.601-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.552-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.535-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.673-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "YES", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.374-7917G>C", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.907", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "G", "CANONICAL": "", "GIVEN_REF": "G", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2587092", "MOTIF_SCORE_CHANGE": ""}]
+15	1	\N	\N	22	18202129	A	G	248026	{22-18202129-A-G}	\N	0.873333335	PASS	22-18202129-A-G	524	600	{"DP": "9481", "FS": "1.761", "MQ": "60", "QD": "28.72", "VQSLOD": "3.03", "MQRankSum": "0.022", "BaseQRankSum": "-0.422", "ReadPosRankSum": "0.345", "ClippingRankSum": "-0.022", "InbreedingCoeff": "-0.1149"}	[{"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.601-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.115-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.387-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382677", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000399777.1:c.*99-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "2/2", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000399777", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001F77C70", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.*170-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000485631.1:n.117-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000485631", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.*207-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.229-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.115-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.673-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.529-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.266-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.115-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.115-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.115-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.374-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257662.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270733.1:c.-240-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270733.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.387-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.230-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.601-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.552-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.535-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.673-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.374-7314A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9864", "AMR_AF": "0.8545", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8151", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9864", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "AFR", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535676", "MOTIF_SCORE_CHANGE": ""}]
+16	1	\N	\N	22	18202207	A	G	265777	{22-18202207-A-G}	\N	0.873333335	PASS	22-18202207-A-G	524	600	{"DP": "11034", "FS": "0.814", "MQ": "60", "QD": "26.43", "VQSLOD": "3.05", "MQRankSum": "-0.116", "BaseQRankSum": "0.321", "ReadPosRankSum": "0.601", "ClippingRankSum": "-0.139", "InbreedingCoeff": "-0.1149"}	[{"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "CCDS13746.1", "ENSP": "ENSP00000318883", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317582.5:c.601-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B2RB43", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317582", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000004F301", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000338932", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000337612.5:c.115-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000337612", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "CCDS59447.1", "ENSP": "ENSP00000347133", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000355028.3:c.387-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "E9PDD6", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000355028", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0000246DFE", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000382677", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000399777.1:c.*99-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "2/2", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000399777", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001F77C70", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000410019", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000418951.2:c.*170-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "Q8IZP5", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000418951", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00000740D0", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000485631.1:n.117-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000485631", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000436321", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000498133.1:c.*207-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "F2Z2C3", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "Feature": "ENST00000498133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI000155D5B6", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000441344", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000538149.1:c.229-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "B7Z238", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000538149", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI0001914B19", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "CCDS59448.1", "ENSP": "ENSP00000437667", "EXON": "", "Gene": "ENSG00000099968", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000543133.1:c.115-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "Ensembl", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000543133", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "UPI00001A3E35", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "Q9BXK5", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257655.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270726.1:c.673-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270726.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257656.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270727.1:c.529-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270727.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257657.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270728.1:c.266-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270728.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257658.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270729.1:c.115-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270729.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257659.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270730.1:c.115-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270730.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257660.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270731.1:c.115-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270731.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257661.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270732.1:c.374-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270732.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257662.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270733.1:c.-240-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "1/1", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270733.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257663.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270734.1:c.387-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270734.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001257664.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001270735.1:c.230-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "3/3", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001270735.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_056182.2", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_015367.3:c.601-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_015367.3", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073068.1:n.552-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073068.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NR_073069.1:n.535-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "4/4", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "NR_073069.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261288.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261231.1:c.673-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "6/6", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261231.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "YES", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.859", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "XP_005261290.1", "EXON": "", "Gene": "23786", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XM_005261233.1:c.374-7236A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9092", "AMR_AF": "0.8516", "APPRIS": "", "Allele": "G", "Codons": "", "EAS_AF": "0.9375", "EUR_AF": "0.8121", "IMPACT": "MODIFIER", "INTRON": "5/5", "MAX_AF": "0.9375", "PUBMED": "", "SAS_AF": "0.7638", "SOURCE": "RefSeq", "STRAND": "1", "SYMBOL": "BCL2L13", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "XM_005261233.1", "HGNC_ID": "17164", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "A", "CANONICAL": "", "GIVEN_REF": "A", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs2535677", "MOTIF_SCORE_CHANGE": ""}]
+17	1	\N	\N	22	18225318	C	T	149858	{22-18225318-C-T}	\N	0.855000019	PASS	22-18225318-C-T	513	600	{"DP": "6030", "FS": "0", "MQ": "60", "QD": "26.1", "VQSLOD": "3.16", "MQRankSum": "-0.181", "BaseQRankSum": "1.66", "ReadPosRankSum": "0.144", "ClippingRankSum": "-0.321", "InbreedingCoeff": "-0.0357"}	[{"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13747.1", "ENSP": "ENSP00000318822", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317361.7:c.361+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "B2ZP79&B1PL87&A8ASI8", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317361", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI00001D69F1", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "YES", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000344594", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000342111.5:c.223+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "3/6", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000342111", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI00001B5F92", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13749.1", "ENSP": "ENSP00000382667", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399765.1:c.-65-3064G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "1/3", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "B2ZP79", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399765", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI00001D69F2", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13749.1", "ENSP": "ENSP00000382669", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399767.1:c.-66+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "B2ZP79", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399767", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI00001D69F2", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13748.1", "ENSP": "ENSP00000382674", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399774.3:c.223+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "B2ZP79&B1PL87&A8ASI8", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399774", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI0000001637", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000473439.1:n.326+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "2/3", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000473439", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "retained_intron", "DOMAINS": "", "Feature": "ENST00000494097", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "1358", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000550946.1:n.313+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "retained_intron", "DOMAINS": "", "Feature": "ENST00000550946", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "CCDS13748.1", "ENSP": "ENSP00000449236", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000551952.1:c.223+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "B2ZP79&B1PL87&A8ASI8", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000551952", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI0000001637", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000552886.1:n.289+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "2/2", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000552886", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001187.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001196.3:c.223+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001196.3", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001231496.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001244567.1:c.223+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001244567.1", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001231498.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001244569.1:c.-65-3064G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001244569.1", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001231499.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001244570.1:c.-65-3064G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "1/3", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001244570.1", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001231501.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001244572.1:c.-65-3064G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "1/3", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001244572.1", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_932070.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_197966.2:c.361+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "3/5", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_197966.2", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "YES", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_932071.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_197967.2:c.-66+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_197967.2", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XR_244338.1:n.390+1251G>A", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "3/6", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "XR_244338.1", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "C", "CANONICAL": "", "GIVEN_REF": "C", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "", "STRAND": "", "SYMBOL": "", "TREMBL": "", "BIOTYPE": "CTCF_binding_site", "DOMAINS": "", "Feature": "ENSR00000301067", "HGNC_ID": "", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "", "CANONICAL": "", "GIVEN_REF": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "regulatory_region_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "RegulatoryFeature", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": ""}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "", "STRAND": "1", "SYMBOL": "", "TREMBL": "", "BIOTYPE": "", "DOMAINS": "", "Feature": "ENSM00523333330", "HGNC_ID": "", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "", "CANONICAL": "", "GIVEN_REF": "", "LoF_flags": "", "MOTIF_POS": "14", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "ENSM00523333330", "Amino_acids": "", "Consequence": "TF_binding_site_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "MotifFeature", "HIGH_INF_POS": "N", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": "-0.025"}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "", "STRAND": "1", "SYMBOL": "", "TREMBL": "", "BIOTYPE": "", "DOMAINS": "", "Feature": "ENSM00523966268", "HGNC_ID": "", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "", "CANONICAL": "", "GIVEN_REF": "", "LoF_flags": "", "MOTIF_POS": "4", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "ENSM00523966268", "Amino_acids": "", "Consequence": "TF_binding_site_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "MotifFeature", "HIGH_INF_POS": "N", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": "-0.005"}, {"AF": "", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.8094", "AMR_AF": "0.8256", "APPRIS": "", "Allele": "T", "Codons": "", "EAS_AF": "0.9365", "EUR_AF": "0.8022", "IMPACT": "MODIFIER", "INTRON": "", "MAX_AF": "0.9365", "PUBMED": "", "SAS_AF": "0.7822", "SOURCE": "", "STRAND": "1", "SYMBOL": "", "TREMBL": "", "BIOTYPE": "", "DOMAINS": "", "Feature": "ENSM00525592001", "HGNC_ID": "", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "", "CANONICAL": "", "GIVEN_REF": "", "LoF_flags": "", "MOTIF_POS": "1", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "ENSM00525592001", "Amino_acids": "", "Consequence": "TF_binding_site_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "MotifFeature", "HIGH_INF_POS": "N", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181399", "MOTIF_SCORE_CHANGE": "-0.027"}]
+18	1	\N	\N	22	18229774	T	C	221760	{22-18229774-T-C}	\N	0.861666679	PASS	22-18229774-T-C	517	600	{"DP": "9401", "FS": "0", "MQ": "60", "QD": "24.32", "VQSLOD": "7.22", "MQRankSum": "-0.021", "BaseQRankSum": "-1.026", "ReadPosRankSum": "0.19", "ClippingRankSum": "0.254", "InbreedingCoeff": "-0.0207"}	[{"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "CCDS13747.1", "ENSP": "ENSP00000318822", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000317361.7:c.151-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "B2ZP79&B1PL87&A8ASI8", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000317361", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI00001D69F1", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "YES", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000344594", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000342111.5:c.13-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000342111", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI00001B5F92", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "CCDS13749.1", "ENSP": "ENSP00000382667", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399765.1:c.-65-7520A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "1/3", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "B2ZP79", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399765", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI00001D69F2", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "CCDS13749.1", "ENSP": "ENSP00000382669", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399767.1:c.-276-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "B2ZP79", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399767", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI00001D69F2", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "CCDS13748.1", "ENSP": "ENSP00000382674", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000399774.3:c.13-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "B2ZP79&B1PL87&A8ASI8", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000399774", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI0000001637", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000473439.1:n.116-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "1/3", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000473439", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000550946.1:n.103-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "retained_intron", "DOMAINS": "", "Feature": "ENST00000550946", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "CCDS13748.1", "ENSP": "ENSP00000449236", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000551952.1:c.13-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "B2ZP79&B1PL87&A8ASI8", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "ENST00000551952", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "UPI0000001637", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "P55957", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "ENSG00000015475", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "ENST00000552886.1:n.79-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "1/2", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "Ensembl", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "processed_transcript", "DOMAINS": "", "Feature": "ENST00000552886", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001187.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001196.3:c.13-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001196.3", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001231496.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001244567.1:c.13-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001244567.1", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001231498.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001244569.1:c.-66+3097A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "2/4", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001244569.1", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001231499.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001244570.1:c.-65-7520A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "1/3", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001244570.1", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_001231501.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_001244572.1:c.-65-7520A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "1/3", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_001244572.1", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_932070.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_197966.2:c.151-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "2/5", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_197966.2", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "YES", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "NP_932071.1", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "NM_197967.2:c.-276-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "1/4", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "Feature": "NM_197967.2", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "OK", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}, {"AF": "0.8552", "LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "Gene": "637", "SIFT": "", "AA_AF": "", "EA_AF": "", "FLAGS": "", "HGVSc": "XR_244338.1:n.180-2995A>G", "HGVSp": "", "PHENO": "", "miRNA": "", "AFR_AF": "0.9009", "AMR_AF": "0.83", "APPRIS": "", "Allele": "C", "Codons": "", "EAS_AF": "0.9385", "EUR_AF": "0.8012", "IMPACT": "MODIFIER", "INTRON": "2/6", "MAX_AF": "0.9385", "PUBMED": "", "SAS_AF": "0.7812", "SOURCE": "RefSeq", "STRAND": "-1", "SYMBOL": "BID", "TREMBL": "", "BIOTYPE": "misc_RNA", "DOMAINS": "", "Feature": "XR_244338.1", "HGNC_ID": "1050", "SOMATIC": "", "UNIPARC": "", "BAM_EDIT": "", "CLIN_SIG": "", "DISTANCE": "", "LoF_info": "", "PolyPhen": "", "USED_REF": "T", "CANONICAL": "", "GIVEN_REF": "T", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "gnomAD_AF": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "MAX_AF_POPS": "EAS", "CDS_position": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "REFSEQ_MATCH": "", "SYMBOL_SOURCE": "EntrezGene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "gnomAD_AFR_AF": "", "gnomAD_AMR_AF": "", "gnomAD_ASJ_AF": "", "gnomAD_EAS_AF": "", "gnomAD_FIN_AF": "", "gnomAD_NFE_AF": "", "gnomAD_OTH_AF": "", "gnomAD_SAS_AF": "", "Protein_position": "", "Existing_variation": "rs181402", "MOTIF_SCORE_CHANGE": ""}]
+19	2	\N	2716251	22	16263767	G	A	568432	{22-16263767-G-A}	772	0.688499987	VQSRTrancheSNP99.90to100.00	22-16263767-G-A	1377	2000	{"DP": "36470", "FS": "83.243", "MQ": "37.4", "QD": "15.79", "VQSLOD": "-41.68", "MQRankSum": "-4.06", "BaseQRankSum": "-0.027", "ReadPosRankSum": "0.17", "ClippingRankSum": "-0.044"}	[{"LoF": "", "TSL": "", "CCDS": "CCDS46658.1", "ENSP": "ENSP00000340610", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "", "HGVSc": "ENST00000343518.6:c.1520+3162C>T", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "9/10", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000343518", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI0000E5A425", "CLIN_SIG": "", "DISTANCE": "", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "POTEH_HUMAN", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs2154837", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000442107", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000452800.1:c.*696+3162C>T", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "10/11", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "H0YG78_HUMAN", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000452800", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI000204A808", "CLIN_SIG": "", "DISTANCE": "", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs2154837", "MOTIF_SCORE_CHANGE": ""}]
+20	2	\N	200045958	22	16283300	G	A	512760	{22-16283300-G-A}	746	0.67824775	VQSRTrancheSNP99.90to100.00	22-16283300-G-A	1347	1986	{"DP": "31551", "FS": "0", "MQ": "26.1", "QD": "16.48", "VQSLOD": "-49.54", "MQRankSum": "-0.491", "BaseQRankSum": "1.45", "ReadPosRankSum": "0.668", "ClippingRankSum": "0.062", "InbreedingCoeff": "-0.3905"}	[{"LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "GMAF": "G:0.3051", "Gene": "ENSG00000236666", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "1", "SYMBOL": "POTEH-AS1", "TREMBL": "", "AFR_MAF": "A:0.5862&A:0.5862", "AMR_MAF": "A:0.7118&A:0.7118", "BIOTYPE": "antisense", "DOMAINS": "", "EAS_MAF": "A:0.7827&A:0.7827", "EUR_MAF": "A:0.6849&A:0.6849", "Feature": "ENST00000422014", "HGNC_ID": "40058", "SAS_MAF": "A:0.7495&A:0.7495", "SOMATIC": "", "UNIPARC": "", "CLIN_SIG": "", "DISTANCE": "4698", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "downstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs200045958&rs8138383", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "CCDS46658.1", "ENSP": "ENSP00000340610", "EXON": "", "GMAF": "G:0.3051", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "", "HGVSc": "ENST00000343518.6:c.633-708C>T", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "1/10", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "", "AFR_MAF": "A:0.5862&A:0.5862", "AMR_MAF": "A:0.7118&A:0.7118", "BIOTYPE": "protein_coding", "DOMAINS": "", "EAS_MAF": "A:0.7827&A:0.7827", "EUR_MAF": "A:0.6849&A:0.6849", "Feature": "ENST00000343518", "HGNC_ID": "133", "SAS_MAF": "A:0.7495&A:0.7495", "SOMATIC": "", "UNIPARC": "UPI0000E5A425", "CLIN_SIG": "", "DISTANCE": "", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "POTEH_HUMAN", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs200045958&rs8138383", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000442107", "EXON": "", "GMAF": "G:0.3051", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000452800.1:c.465-708C>T", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "1/11", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "H0YG78_HUMAN", "AFR_MAF": "A:0.5862&A:0.5862", "AMR_MAF": "A:0.7118&A:0.7118", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "EAS_MAF": "A:0.7827&A:0.7827", "EUR_MAF": "A:0.6849&A:0.6849", "Feature": "ENST00000452800", "HGNC_ID": "133", "SAS_MAF": "A:0.7495&A:0.7495", "SOMATIC": "", "UNIPARC": "UPI000204A808", "CLIN_SIG": "", "DISTANCE": "", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs200045958&rs8138383", "MOTIF_SCORE_CHANGE": ""}]
+21	2	\N	116260054	22	16285350	G	C	174358	{22-16285350-G-C}	612	0.587244272	VQSRTrancheSNP99.90to100.00	22-16285350-G-C	976	1662	{"DP": "16983", "FS": "180.887", "MQ": "40.44", "QD": "12.92", "VQSLOD": "-23780", "MQRankSum": "-2.69", "BaseQRankSum": "1.63", "ReadPosRankSum": "0.58", "ClippingRankSum": "-0.045"}	[{"LoF": "", "TSL": "", "CCDS": "CCDS46658.1", "ENSP": "ENSP00000340610", "EXON": "", "GMAF": "C:0.2977", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "", "HGVSc": "ENST00000343518.6:c.632+1904C>G", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "C", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "1/10", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "", "AFR_MAF": "C:0.4697", "AMR_MAF": "C:0.2133", "BIOTYPE": "protein_coding", "DOMAINS": "", "EAS_MAF": "C:0.1855", "EUR_MAF": "C:0.2266", "Feature": "ENST00000343518", "HGNC_ID": "133", "SAS_MAF": "C:0.3139", "SOMATIC": "", "UNIPARC": "UPI0000E5A425", "CLIN_SIG": "", "DISTANCE": "", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "POTEH_HUMAN", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs116260054", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000442107", "EXON": "", "GMAF": "C:0.2977", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000452800.1:c.464+1904C>G", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "C", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "1/11", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "H0YG78_HUMAN", "AFR_MAF": "C:0.4697", "AMR_MAF": "C:0.2133", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "EAS_MAF": "C:0.1855", "EUR_MAF": "C:0.2266", "Feature": "ENST00000452800", "HGNC_ID": "133", "SAS_MAF": "C:0.3139", "SOMATIC": "", "UNIPARC": "UPI000204A808", "CLIN_SIG": "", "DISTANCE": "", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs116260054", "MOTIF_SCORE_CHANGE": ""}]
+22	2	\N	201077540	22	16286239	A	G	391206	{22-16286239-A-G}	304	0.487987995	VQSRTrancheSNP99.90to100.00	22-16286239-A-G	975	1998	{"DP": "43446", "FS": "19.445", "MQ": "36.03", "QD": "11.26", "VQSLOD": "-26.92", "MQRankSum": "-1.85", "BaseQRankSum": "-0.39", "ReadPosRankSum": "0.196", "ClippingRankSum": "-0.12", "InbreedingCoeff": "-0.368"}	[{"LoF": "", "TSL": "", "CCDS": "CCDS46658.1", "ENSP": "ENSP00000340610", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "", "HGVSc": "ENST00000343518.6:c.632+1015T>C", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "G", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "1/10", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000343518", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI0000E5A425", "CLIN_SIG": "", "DISTANCE": "", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "POTEH_HUMAN", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs62224837", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000442107", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "cds_start_NF", "HGVSc": "ENST00000452800.1:c.464+1015T>C", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "G", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "1/11", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "H0YG78_HUMAN", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000452800", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI000204A808", "CLIN_SIG": "", "DISTANCE": "", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "intron_variant&NMD_transcript_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs62224837", "MOTIF_SCORE_CHANGE": ""}]
+23	2	\N	371907891	22	16288255	T	C	605667	{22-16288255-T-C,22-16288255-T-TGCCAAGCCAAGCAAAGAAC}	4	0.494500011	VQSRTrancheINDEL99.90to100.00	22-16288255-T-C	989	2000	{"DP": "78349", "FS": "112.401", "MQ": "47.54", "QD": "7.93", "VQSLOD": "-20.53", "MQRankSum": "-4.794", "BaseQRankSum": "-0.618", "ReadPosRankSum": "0.83", "ClippingRankSum": "-0.041", "InbreedingCoeff": "-4.4727"}	[{"LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000442107", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "cds_start_NF", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "C", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "H0YG78_HUMAN", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000452800", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI000204A808", "CLIN_SIG": "", "DISTANCE": "538", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "indel", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs371907891", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "CCDS46658.1", "ENSP": "ENSP00000340610", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "C", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000343518", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI0000E5A425", "CLIN_SIG": "", "DISTANCE": "318", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "POTEH_HUMAN", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "indel", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs371907891", "MOTIF_SCORE_CHANGE": ""}]
+24	2	\N	371907891	22	16288255	T	TGCCAAGCCAAGCAAAGAAC	605667	{22-16288255-T-C,22-16288255-T-TGCCAAGCCAAGCAAAGAAC}	0	0.000500000024	VQSRTrancheINDEL99.90to100.00	22-16288255-T-TGCCAAGCCAAGCAAAGAAC	1	2000	{"DP": "78349", "FS": "112.401", "MQ": "47.54", "QD": "7.93", "VQSLOD": "-20.53", "MQRankSum": "-4.794", "BaseQRankSum": "-0.618", "ReadPosRankSum": "0.83", "ClippingRankSum": "-0.041", "InbreedingCoeff": "-4.4727"}	[{"LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000442107", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "cds_start_NF", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "TGCCAAGCCAAGCAAAGAAC", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "H0YG78_HUMAN", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000452800", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI000204A808", "CLIN_SIG": "", "DISTANCE": "538", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "2", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "indel", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs371907891", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "CCDS46658.1", "ENSP": "ENSP00000340610", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "TGCCAAGCCAAGCAAAGAAC", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000343518", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI0000E5A425", "CLIN_SIG": "", "DISTANCE": "318", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "POTEH_HUMAN", "ALLELE_NUM": "2", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "indel", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs371907891", "MOTIF_SCORE_CHANGE": ""}]
+25	2	\N	62224840	22	16288538	T	C	1445490	{22-16288538-T-C,22-16288538-T-TGGCGTGCGCGCGC,22-16288538-T-*}	512	0.613981783	PASS	22-16288538-T-C	1212	1974	{"DP": "59434", "FS": "2.597", "MQ": "55.58", "QD": "33.83", "VQSLOD": "-1.577", "MQRankSum": "-0.484", "BaseQRankSum": "-0.687", "ReadPosRankSum": "0.883", "ClippingRankSum": "0.208"}	[{"LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000442107", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "cds_start_NF", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "C", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "H0YG78_HUMAN", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000452800", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI000204A808", "CLIN_SIG": "", "DISTANCE": "821", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "sequence_alteration", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs62224840", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "CCDS46658.1", "ENSP": "ENSP00000340610", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "C", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000343518", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI0000E5A425", "CLIN_SIG": "", "DISTANCE": "601", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "POTEH_HUMAN", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "sequence_alteration", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs62224840", "MOTIF_SCORE_CHANGE": ""}]
+26	2	\N	62224840	22	16288538	T	TGGCGTGCGCGCGC	1445490	{22-16288538-T-C,22-16288538-T-TGGCGTGCGCGCGC,22-16288538-T-*}	6	0.295845985	PASS	22-16288538-T-TGGCGTGCGCGCGC	584	1974	{"DP": "59434", "FS": "2.597", "MQ": "55.58", "QD": "33.83", "VQSLOD": "-1.577", "MQRankSum": "-0.484", "BaseQRankSum": "-0.687", "ReadPosRankSum": "0.883", "ClippingRankSum": "0.208"}	[{"LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000442107", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "cds_start_NF", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "TGGCGTGCGCGCGC", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "H0YG78_HUMAN", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000452800", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI000204A808", "CLIN_SIG": "", "DISTANCE": "821", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "2", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "sequence_alteration", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs62224840", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "CCDS46658.1", "ENSP": "ENSP00000340610", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "TGGCGTGCGCGCGC", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000343518", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI0000E5A425", "CLIN_SIG": "", "DISTANCE": "601", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "POTEH_HUMAN", "ALLELE_NUM": "2", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "sequence_alteration", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs62224840", "MOTIF_SCORE_CHANGE": ""}]
+27	2	\N	62224840	22	16288538	T	*	1445490	{22-16288538-T-C,22-16288538-T-TGGCGTGCGCGCGC,22-16288538-T-*}	0	0.00101317128	PASS	22-16288538-T-*	2	1974	{"DP": "59434", "FS": "2.597", "MQ": "55.58", "QD": "33.83", "VQSLOD": "-1.577", "MQRankSum": "-0.484", "BaseQRankSum": "-0.687", "ReadPosRankSum": "0.883", "ClippingRankSum": "0.208"}	[]
+28	2	\N	76462367	22	16288742	G	C	1005040	{22-16288742-G-C}	844	0.702105284	VQSRTrancheSNP99.00to99.90	22-16288742-G-C	1334	1900	{"DP": "35702", "FS": "2.885", "MQ": "53.32", "QD": "30.51", "VQSLOD": "-3.356", "MQRankSum": "-2.757", "BaseQRankSum": "-0.389", "ReadPosRankSum": "0.231", "ClippingRankSum": "-0.06", "InbreedingCoeff": "-0.287"}	[{"LoF": "", "TSL": "", "CCDS": "CCDS46658.1", "ENSP": "ENSP00000340610", "EXON": "", "GMAF": "G:0.2065", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "C", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "", "AFR_MAF": "C:0.8964", "AMR_MAF": "C:0.7695", "BIOTYPE": "protein_coding", "DOMAINS": "", "EAS_MAF": "C:0.6776", "EUR_MAF": "C:0.7803", "Feature": "ENST00000343518", "HGNC_ID": "133", "SAS_MAF": "C:0.8047", "SOMATIC": "", "UNIPARC": "UPI0000E5A425", "CLIN_SIG": "", "DISTANCE": "805", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "POTEH_HUMAN", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs76462367", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000442107", "EXON": "", "GMAF": "G:0.2065", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "cds_start_NF", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "C", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "H0YG78_HUMAN", "AFR_MAF": "C:0.8964", "AMR_MAF": "C:0.7695", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "EAS_MAF": "C:0.6776", "EUR_MAF": "C:0.7803", "Feature": "ENST00000452800", "HGNC_ID": "133", "SAS_MAF": "C:0.8047", "SOMATIC": "", "UNIPARC": "UPI000204A808", "CLIN_SIG": "", "DISTANCE": "1025", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs76462367", "MOTIF_SCORE_CHANGE": ""}]
+29	2	\N	67775324	22	16288776	A	G	1003200	{22-16288776-A-G}	850	0.699893951	VQSRTrancheSNP99.00to99.90	22-16288776-A-G	1320	1886	{"DP": "39005", "FS": "1.301", "MQ": "52.63", "QD": "28.38", "VQSLOD": "-3.749", "MQRankSum": "-3.055", "BaseQRankSum": "-2.381", "ReadPosRankSum": "-0.224", "ClippingRankSum": "-0.051", "InbreedingCoeff": "-0.2566"}	[{"LoF": "", "TSL": "", "CCDS": "", "ENSP": "ENSP00000442107", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "cds_start_NF", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "G", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "H0YG78_HUMAN", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "nonsense_mediated_decay", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000452800", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI000204A808", "CLIN_SIG": "", "DISTANCE": "1059", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs67775324", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "CCDS46658.1", "ENSP": "ENSP00000340610", "EXON": "", "GMAF": "", "Gene": "ENSG00000198062", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "G", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "POTEH", "TREMBL": "", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "protein_coding", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000343518", "HGNC_ID": "133", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "UPI0000E5A425", "CLIN_SIG": "", "DISTANCE": "839", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "POTEH_HUMAN", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs67775324", "MOTIF_SCORE_CHANGE": ""}]
+30	2	\N	5771604	22	16364923	C	A	967564	{22-16364923-C-A}	222	0.528500021	VQSRTrancheSNP99.00to99.90	22-16364923-C-A	1057	2000	{"DP": "50352", "FS": "8.487", "MQ": "53.71", "QD": "19.96", "VQSLOD": "-5.859", "MQRankSum": "-3.951", "BaseQRankSum": "0.642", "ReadPosRankSum": "-0.32", "ClippingRankSum": "-0.058"}	[{"LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "GMAF": "C:0.4599", "Gene": "ENSG00000226474", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "1", "SYMBOL": "LA16c-2F2.5", "TREMBL": "", "AFR_MAF": "A:0.8442", "AMR_MAF": "A:0.4582", "BIOTYPE": "unprocessed_pseudogene", "DOMAINS": "", "EAS_MAF": "A:0.3363", "EUR_MAF": "A:0.4612", "Feature": "ENST00000440999", "HGNC_ID": "", "SAS_MAF": "A:0.4785", "SOMATIC": "", "UNIPARC": "", "CLIN_SIG": "", "DISTANCE": "2362", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "downstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "Clone_based_vega_gene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs5771604", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "1/1", "GMAF": "C:0.4599", "Gene": "ENSG00000231565", "SIFT": "", "FLAGS": "", "HGVSc": "ENST00000438441.1:n.57C>A", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "1", "SYMBOL": "NEK2P2", "TREMBL": "", "AFR_MAF": "A:0.8442", "AMR_MAF": "A:0.4582", "BIOTYPE": "processed_pseudogene", "DOMAINS": "", "EAS_MAF": "A:0.3363", "EUR_MAF": "A:0.4612", "Feature": "ENST00000438441", "HGNC_ID": "37816", "SAS_MAF": "A:0.4785", "SOMATIC": "", "UNIPARC": "", "CLIN_SIG": "", "DISTANCE": "", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "non_coding_transcript_exon_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "57", "Protein_position": "", "Existing_variation": "rs5771604", "MOTIF_SCORE_CHANGE": ""}]
+31	2	\N	141818524	22	16365289	G	A	344637	{22-16365289-G-A}	1406	0.832665324	VQSRTrancheSNP99.90to100.00	22-16365289-G-A	1662	1996	{"DP": "17926", "FS": "22.413", "MQ": "32.1", "QD": "20.78", "VQSLOD": "-32.66", "MQRankSum": "-3.254", "BaseQRankSum": "-0.392", "ReadPosRankSum": "0.504", "ClippingRankSum": "0"}	[{"LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "GMAF": "G:0.2520", "Gene": "ENSG00000226474", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "1", "SYMBOL": "LA16c-2F2.5", "TREMBL": "", "AFR_MAF": "A:0.9191", "AMR_MAF": "A:0.6888", "BIOTYPE": "unprocessed_pseudogene", "DOMAINS": "", "EAS_MAF": "A:0.6895", "EUR_MAF": "A:0.6899", "Feature": "ENST00000440999", "HGNC_ID": "", "SAS_MAF": "A:0.6789", "SOMATIC": "", "UNIPARC": "", "CLIN_SIG": "", "DISTANCE": "2728", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "downstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "Clone_based_vega_gene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs1153411", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "1/1", "GMAF": "G:0.2520", "Gene": "ENSG00000231565", "SIFT": "", "FLAGS": "", "HGVSc": "ENST00000438441.1:n.423G>A", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "1", "SYMBOL": "NEK2P2", "TREMBL": "", "AFR_MAF": "A:0.9191", "AMR_MAF": "A:0.6888", "BIOTYPE": "processed_pseudogene", "DOMAINS": "", "EAS_MAF": "A:0.6895", "EUR_MAF": "A:0.6899", "Feature": "ENST00000438441", "HGNC_ID": "37816", "SAS_MAF": "A:0.6789", "SOMATIC": "", "UNIPARC": "", "CLIN_SIG": "", "DISTANCE": "", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "non_coding_transcript_exon_variant&non_coding_transcript_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "423", "Protein_position": "", "Existing_variation": "rs1153411", "MOTIF_SCORE_CHANGE": ""}]
+32	2	\N	371958062	22	16370229	G	A	858332	{22-16370229-G-A}	0	0.486999989	VQSRTrancheSNP99.90to100.00	22-16370229-G-A	974	2000	{"DP": "77999", "FS": "3.256", "MQ": "32.13", "QD": "11.19", "VQSLOD": "-44.14", "MQRankSum": "-1.564", "BaseQRankSum": "-0.428", "ReadPosRankSum": "0.623", "ClippingRankSum": "0.059"}	[{"LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "GMAF": "", "Gene": "ENSG00000231565", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "1", "SYMBOL": "NEK2P2", "TREMBL": "", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "processed_pseudogene", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000438441", "HGNC_ID": "37816", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "", "CLIN_SIG": "", "DISTANCE": "4025", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "downstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs371958062", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "GMAF": "", "Gene": "ENSG00000230471", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "1", "SYMBOL": "LA16c-2F2.8", "TREMBL": "", "AFR_MAF": "", "AMR_MAF": "", "BIOTYPE": "lincRNA", "DOMAINS": "", "EAS_MAF": "", "EUR_MAF": "", "Feature": "ENST00000428118", "HGNC_ID": "", "SAS_MAF": "", "SOMATIC": "", "UNIPARC": "", "CLIN_SIG": "", "DISTANCE": "2852", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "Clone_based_vega_gene", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs371958062", "MOTIF_SCORE_CHANGE": ""}]
+33	2	\N	783	22	29461622	G	A	715011	{22-29461622-G-A}	772	0.62349999	PASS	22-29461622-G-A	1247	2000	{"DP": "36991", "FS": "0", "MQ": "60", "QD": "22.28", "VQSLOD": "22.38", "MQRankSum": "0.023", "BaseQRankSum": "2.44", "ReadPosRankSum": "0.313", "ClippingRankSum": "-0.031"}	[{"LoF": "", "TSL": "", "CCDS": "CCDS13848.1", "ENSP": "ENSP00000216071", "EXON": "", "GMAF": "G:0.4289", "Gene": "ENSG00000100249", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "-1", "SYMBOL": "C22orf31", "TREMBL": "", "AFR_MAF": "A:0.5681", "AMR_MAF": "A:0.4654", "BIOTYPE": "protein_coding", "DOMAINS": "", "EAS_MAF": "A:0.5466", "EUR_MAF": "A:0.664", "Feature": "ENST00000216071", "HGNC_ID": "26931", "SAS_MAF": "A:0.5798", "SOMATIC": "", "UNIPARC": "UPI0000073FE0", "CLIN_SIG": "", "DISTANCE": "3790", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "YES", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "CV031_HUMAN", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "upstream_gene_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "Transcript", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "HGNC", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs783", "MOTIF_SCORE_CHANGE": ""}, {"LoF": "", "TSL": "", "CCDS": "", "ENSP": "", "EXON": "", "GMAF": "G:0.4289", "Gene": "", "SIFT": "", "FLAGS": "", "HGVSc": "", "HGVSp": "", "PHENO": "", "AA_MAF": "", "APPRIS": "", "Allele": "A", "Codons": "", "EA_MAF": "", "IMPACT": "MODIFIER", "INTRON": "", "PUBMED": "", "STRAND": "", "SYMBOL": "", "TREMBL": "", "AFR_MAF": "A:0.5681", "AMR_MAF": "A:0.4654", "BIOTYPE": "promoter_flanking_region", "DOMAINS": "", "EAS_MAF": "A:0.5466", "EUR_MAF": "A:0.664", "Feature": "ENSR00001731804", "HGNC_ID": "", "SAS_MAF": "A:0.5798", "SOMATIC": "", "UNIPARC": "", "CLIN_SIG": "", "DISTANCE": "", "ExAC_MAF": "", "LoF_info": "", "PolyPhen": "", "CANONICAL": "", "LoF_flags": "", "MOTIF_POS": "", "SWISSPROT": "", "ALLELE_NUM": "1", "GENE_PHENO": "", "LoF_filter": "", "MOTIF_NAME": "", "Amino_acids": "", "Consequence": "regulatory_region_variant", "HGVS_OFFSET": "", "CDS_position": "", "ExAC_AFR_MAF": "", "ExAC_AMR_MAF": "", "ExAC_Adj_MAF": "", "ExAC_EAS_MAF": "", "ExAC_FIN_MAF": "", "ExAC_NFE_MAF": "", "ExAC_OTH_MAF": "", "ExAC_SAS_MAF": "", "Feature_type": "RegulatoryFeature", "HIGH_INF_POS": "", "SYMBOL_SOURCE": "", "VARIANT_CLASS": "SNV", "cDNA_position": "", "Protein_position": "", "Existing_variation": "rs783", "MOTIF_SCORE_CHANGE": ""}]
+34	3	\N	587697622	22	16050075	A	G	100	{22-16050075-A-G}	\N	0.000199680508	PASS	22-16050075-A-G	1	5008	{"DP": "8012"}	\N
+35	3	\N	587642978	22	16064513	A	AAGAATGGCCTAATAC	100	{22-16064513-A-AAGAATGGCCTAATAC}	\N	0.0041932906	PASS	22-16064513-A-AAGAATGGCCTAATAC	21	5008	{"DP": "26803"}	\N
+36	3	\N	574946654	22	16497141	CTT	C	100	{22-16497141-CTT-C}	\N	0.000798722031	PASS	22-16497141-CTT-C	4	5008	{"DP": "19138"}	\N
+37	3	\N	527791780	22	16517680	GACAA	G	100	{22-16517680-GACAA-G}	\N	0.000599041523	PASS	22-16517680-GACAA-G	3	5008	{"DP": "23980"}	\N
+38	3	\N	538489066	22	16539541	A	AC	100	{22-16539541-A-AC}	\N	0.00139776361	PASS	22-16539541-A-AC	7	5008	{"DP": "19363"}	\N
+39	3	\N	374006257	22	16577044	TG	AG	100	{22-16577044-TG-AG,22-16577044-TG-T}	\N	0.0033945688	PASS	22-16577044-TG-AG	17	5008	{"DP": "14269"}	\N
+40	3	\N	200929253	22	16577044	TG	T	100	{22-16577044-TG-AG,22-16577044-TG-T}	\N	0.00938498415	PASS	22-16577044-TG-T	47	5008	{"DP": "14269"}	\N
+41	3	\N	371560503	22	16879601	T	TA	100	{22-16879601-T-TA,22-16879601-T-TAA}	\N	0.062699683	PASS	22-16879601-T-TA	314	5008	{"DP": "18393"}	\N
+42	3	\N	371560503	22	16879601	T	TAA	100	{22-16879601-T-TA,22-16879601-T-TAA}	\N	0.0231629387	PASS	22-16879601-T-TAA	116	5008	{"DP": "18393"}	\N
+43	3	\N	5994030	22	17302972	C	A	100	{22-17302972-C-A}	\N	0.58526355	PASS	22-17302972-C-A	2931	5008	{"DP": "14904"}	\N
+44	3	\N	5748665	22	17300408	A	G	100	{22-17300408-A-G}	\N	0.943091035	PASS	22-17300408-A-G	4723	5008	{"DP": "17781"}	\N
+45	3	\N	5844283	22	17301526	ATACATAGTC	A	100	{22-17301526-ATACATAGTC-A}	\N	0.585463285	PASS	22-17301526-ATACATAGTC-A	2932	5008	{"DP": "5287"}	\N
+46	3	\N	553611103	22	19617927	GTCT	GTCTTCT	100	{22-19617927-GTCT-GTCTTCT,22-19617927-GTCT-GTCTTCTTCT,22-19617927-GTCT-G}	\N	0.023562301	PASS	22-19617927-GTCT-GTCTTCT	118	5008	{"DP": "24087"}	\N
+47	3	\N	553611103	22	19617927	GTCT	GTCTTCTTCT	100	{22-19617927-GTCT-GTCTTCT,22-19617927-GTCT-GTCTTCTTCT,22-19617927-GTCT-G}	\N	0.0033945688	PASS	22-19617927-GTCT-GTCTTCTTCT	17	5008	{"DP": "24087"}	\N
+48	3	\N	148427666	22	19617927	GTCT	G	100	{22-19617927-GTCT-GTCTTCT,22-19617927-GTCT-GTCTTCTTCT,22-19617927-GTCT-G}	\N	0.0363418534	PASS	22-19617927-GTCT-G	182	5008	{"DP": "24087"}	\N
+49	3	\N	374006257	2	16577044	TG	AG	100	{2-16577044-TG-AG,2-16577044-TG-T}	\N	0.0033945688	PASS	2-16577044-TG-AG	17	5008	{"DP": "14269"}	\N
+50	3	\N	200929253	2	16577044	TG	T	100	{2-16577044-TG-AG,2-16577044-TG-T}	\N	0.00938498415	PASS	2-16577044-TG-T	47	5008	{"DP": "14269"}	\N
+\.
+COPY data.variant_genes (id, variant, gene) FROM stdin;
+1	1	6
+2	2	6
+3	3	6
+4	4	6
+5	5	6
+6	6	6
+7	7	6
+8	8	6
+9	9	6
+10	10	6
+11	11	6
+12	12	6
+13	13	6
+14	14	6
+15	15	6
+16	16	6
+17	17	7
+18	18	7
+19	19	1
+20	20	2
+21	20	1
+22	21	1
+23	22	1
+24	23	1
+25	24	1
+26	25	1
+27	26	1
+28	28	1
+29	29	1
+30	30	4
+31	30	3
+32	31	4
+33	31	3
+34	32	4
+35	32	5
+36	33	8
+\.
+COPY data.variant_transcripts (id, variant, transcript) FROM stdin;
+1	1	7
+2	1	12
+3	1	9
+4	1	11
+5	1	10
+6	1	13
+7	1	8
+8	1	16
+9	1	15
+10	1	14
+11	2	17
+12	2	7
+13	2	12
+14	2	9
+15	2	11
+16	2	10
+17	2	13
+18	2	8
+19	2	16
+20	2	15
+21	2	14
+22	3	17
+23	3	7
+24	3	12
+25	3	9
+26	3	11
+27	3	10
+28	3	13
+29	3	8
+30	3	16
+31	3	15
+32	3	14
+33	4	17
+34	4	7
+35	4	12
+36	4	9
+37	4	11
+38	4	10
+39	4	13
+40	4	8
+41	4	16
+42	4	15
+43	4	14
+44	5	17
+45	5	7
+46	5	12
+47	5	9
+48	5	11
+49	5	10
+50	5	13
+51	5	8
+52	5	16
+53	5	15
+54	5	14
+55	6	17
+56	6	7
+57	6	12
+58	6	18
+59	6	11
+60	6	10
+61	6	13
+62	6	16
+63	6	9
+64	6	8
+65	6	15
+66	6	14
+67	7	17
+68	7	19
+69	7	9
+70	7	18
+71	7	11
+72	7	10
+73	7	13
+74	7	8
+75	7	16
+76	7	15
+77	7	14
+78	8	17
+79	8	19
+80	8	9
+81	8	18
+82	8	11
+83	8	10
+84	8	13
+85	8	8
+86	8	16
+87	8	15
+88	8	14
+89	9	17
+90	9	18
+91	9	11
+92	9	10
+93	9	13
+94	9	16
+95	9	9
+96	9	20
+97	9	14
+98	10	17
+99	10	18
+100	10	11
+101	10	10
+102	10	13
+103	10	16
+104	10	9
+105	10	20
+106	10	14
+107	11	17
+108	11	18
+109	11	11
+110	11	10
+111	11	13
+112	11	16
+113	11	9
+114	11	20
+115	11	14
+116	12	17
+117	12	18
+118	12	11
+119	12	10
+120	12	13
+121	12	16
+122	12	9
+123	12	20
+124	12	14
+125	13	17
+126	13	18
+127	13	11
+128	13	10
+129	13	13
+130	13	16
+131	13	9
+132	13	20
+133	13	14
+134	14	17
+135	14	18
+136	14	11
+137	14	10
+138	14	13
+139	14	16
+140	14	9
+141	14	20
+142	14	14
+143	15	17
+144	15	18
+145	15	11
+146	15	10
+147	15	13
+148	15	16
+149	15	9
+150	15	20
+151	15	14
+152	16	17
+153	16	18
+154	16	11
+155	16	10
+156	16	13
+157	16	16
+158	16	9
+159	16	20
+160	16	14
+161	17	26
+162	17	29
+163	17	25
+164	17	27
+165	17	28
+166	17	30
+167	17	24
+168	17	21
+169	17	23
+170	17	22
+171	18	26
+172	18	29
+173	18	27
+174	18	28
+175	18	30
+176	18	24
+177	18	21
+178	18	23
+179	18	22
+180	19	2
+181	19	1
+182	20	2
+183	20	3
+184	20	1
+185	21	2
+186	21	1
+187	22	2
+188	22	1
+189	23	2
+190	23	1
+191	24	2
+192	24	1
+193	25	2
+194	25	1
+195	26	2
+196	26	1
+197	28	2
+198	28	1
+199	29	2
+200	29	1
+201	30	4
+202	30	5
+203	31	4
+204	31	5
+205	32	6
+206	32	5
+207	33	31
+\.
+COPY users.users (id, username, email, affiliation, country, identity, identity_type) FROM stdin;
+\.
+COPY users.dataset_access (id, dataset, user_id, wants_newsletter, is_admin) FROM stdin;
+\.
+COPY users.linkhash (id, dataset_version, user_id, hash, expires_on) FROM stdin;
+\.
+COPY users.sftp_users (id, user_id, user_uid, user_name, password_hash, account_expires) FROM stdin;
+\.
+COPY users.user_access_log (id, user_id, dataset, ts, action) FROM stdin;
+\.
+COPY users.user_consent_log (id, user_id, dataset_version, ts) FROM stdin;
+\.
+COPY users.user_download_log (id, user_id, dataset_file, ts) FROM stdin;
+\.

From e3c8c259ab460d4b22a6e24675580cf60e963ecf Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Fri, 28 Jun 2019 11:05:13 +0200
Subject: [PATCH 014/126] Add import testing to travis.

---
 .travis.yml           |  1 +
 test/travis_script.sh | 78 +++++++++++++++++++++++++++++++++++++------
 2 files changed, 69 insertions(+), 10 deletions(-)

diff --git a/.travis.yml b/.travis.yml
index df42263ba..678dd835a 100644
--- a/.travis.yml
+++ b/.travis.yml
@@ -12,6 +12,7 @@ before_install:
 install:
     - pip install -r backend/requirements.txt
     - pip install -r test/requirements.txt
+    - pip install -r scripts/importer/requirements.txt
     - pip install coverage coveralls
 script:
     - test/travis_script.sh
diff --git a/test/travis_script.sh b/test/travis_script.sh
index 2049505af..932725b46 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -25,14 +25,15 @@ psql -U postgres -h 127.0.0.1 -p 5433 -f sql/patch-master-db.sql "$DBNAME"
 
 # Empty the database
 psql -U postgres -h 127.0.0.1 -p 5433 "$DBNAME" <<__END__
-DROP SCHEMA data;
-DROP SCHEMA users;
+DROP SCHEMA data CASCADE;
+DROP SCHEMA users CASCADE;
 __END__
 
 
 echo '>>> Test 2: Load the swefreq schema'
 psql -U postgres -h 127.0.0.1 -p 5433 -f sql/data_schema.sql "$DBNAME"
 psql -U postgres -h 127.0.0.1 -p 5433 -f sql/user_schema.sql "$DBNAME"
+psql -U postgres -h 127.0.0.1 -p 5433 -f sql/beacon_schema.sql "$DBNAME"
 psql -U postgres -h 127.0.0.1 -p 5433 -f test/data/load_dummy_data.sql "$DBNAME"
 psql -U postgres -h 127.0.0.1 -p 5433 -f test/data/browser_test_data.sql "$DBNAME"
 
@@ -81,27 +82,84 @@ curl localhost:4000/developer/quit
 sleep 2 # Lets wait a little bit so the server has stopped
 
 
-echo '>>> Prepare for test 5: Reset the database'
+echo '>>> Prepare for test 5'
 psql -U postgres -h 127.0.0.1 -p 5433 "$DBNAME" <<__END__
-DROP SCHEMA data;
-DROP SCHEMA users;
+DROP SCHEMA data CASCADE;
+DROP SCHEMA users CASCADE;
 __END__
 
 psql -U postgres -h 127.0.0.1 -p 5433 -f sql/data_schema.sql "$DBNAME"
 psql -U postgres -h 127.0.0.1 -p 5433 -f sql/user_schema.sql "$DBNAME"
 
+BASE=scripts/importer
+ln -s tests/data "$BASE/downloaded_files"
+gzip -c "$BASE/downloaded_files/dbNSFP_gene.txt" > "$BASE/downloaded_files/dbNSFP2.9_gene.gz"
+gzip -c "$BASE/downloaded_files/gencode.gtf" > "$BASE/downloaded_files/gencode.v19.annotation.gtf.gz"
+gzip "$BASE/tests/data/dataset1_1.vcf"
+gzip "$BASE/tests/data/dataset1_1_coverage.txt"
+gzip "$BASE/tests/data/dataset1_2.vcf"
+gzip "$BASE/tests/data/dataset1_2_coverage.txt"
+gzip "$BASE/tests/data/dataset2_1.vcf"
 
 echo '>>> Test 5. Importing data'
+
+sed -i -e 's/\"\$SCRIPT_DIR\/importer/COVERAGE_FILE=.coverage_import_1 coverage run \"\$SCRIPT_DIR\/importer/g' scripts/manage.sh
 # read reference data
-# insert sql data with studies etc
-# read vcf files
-# make pg_dump
-# compare to reference
+scripts/manage.sh import --add_reference\
+                  --gencode_version 19\
+                  --ensembl_version homo_sapiens_core_75_37\
+		  --assembly_id GRCh37p13\
+                  --dbnsfp_version 2.9.3\
+                  --ref_name GRCh37p13
+
+# read dataset names, versions etc
+psql -U postgres -h 127.0.0.1 -p 5433 -f "$BASE/tests/data/base_info.sql" "$DBNAME"
+
+
+# read variant data
+sed -i -e 's/import_1/import_2/' scripts/manage.sh
+scripts/manage.sh import --add_raw_data \
+                   --dataset  "Dataset 1"\
+                   --version "Version 1"\
+                   --variant_file "$BASE/tests/data/dataset1_1.vcf.gz"\
+		   --coverage_file "$BASE/tests/data/dataset1_1_coverage.txt.gz"
+
+sed -i -e 's/import_2/import_3/' scripts/manage.sh
+scripts/manage.sh import --add_raw_data \
+                   --dataset  "Dataset 1"\
+                   --version "Version 2"\
+                   --variant_file "$BASE/tests/data/dataset1_2.vcf.gz"\
+		   --coverage_file "$BASE/tests/data/dataset1_2_coverage.txt.gz"
+
+sed -i -e 's/import_3/import_4/' scripts/manage.sh
+scripts/manage.sh import --add_raw_data \
+                   --dataset  "Dataset 2"\
+                   --version "Version 1"\
+                   --variant_file "$BASE/tests/data/dataset2_1.vcf.gz"\
+		   --beacon-only
 
+# make pg_dump
+pg_dump -U postgres -h 127.0.0.1 -p 5433 "$DBNAME" -f dbdump.psql --data-only
+sed -i -e '/^--/d;/^$/d' dbdump.psql
+grep -v -P "^SE[TL]" dbdump.psql | sort > sdump.psql
+sort "$BASE/tests/data/reference.psql" > ref.psql
+cat dbdump.psql
+
+cat sdump.psql
+
+cat ref.psql
+
+# compare dump to reference
+diff sdump.psql ref.psql
+DIFFRES=$?
+if [ $DIFFRES -ne 0 ]; then
+    echo "Database not identical to reference"
+    RETURN_VALUE=$((RETURN_VALUE + $DIFFRES))
+fi
 
 echo '>>> Finalising: Combine coverage'
 
-coverage combine .coverage_pytest .coverage_server
+coverage combine .coverage_pytest .coverage_server .coverage_import1 .coverage_import2 .coverage_import3 .coverage_import4
 
 if [ -f .coverage ]; then
     coveralls

From 24419b0be46c7b0362939ea353aa18ce509680f3 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 5 Aug 2019 13:38:52 +0200
Subject: [PATCH 015/126] Make sure cause is chained when exception is raised
 after catching an exception.

---
 backend/modules/browser/lookups.py | 53 +++++++++++++++---------------
 backend/modules/browser/utils.py   |  4 +--
 2 files changed, 29 insertions(+), 28 deletions(-)

diff --git a/backend/modules/browser/lookups.py b/backend/modules/browser/lookups.py
index 3a518cb7f..f4ebda777 100644
--- a/backend/modules/browser/lookups.py
+++ b/backend/modules/browser/lookups.py
@@ -27,8 +27,8 @@ def autocomplete(dataset:str, query:str, ds_version:str=None):
     """
     try:
         ref_set = db.get_dataset_version(dataset, ds_version).reference_set
-    except AttributeError:
-        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.')
+    except AttributeError as err:
+        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.') from err
     query = (db.Gene.select(db.Gene.name)
              .where(((db.Gene.name.startswith(query)) &
                       (db.Gene.reference_set == ref_set))))
@@ -220,9 +220,9 @@ def get_exons_in_transcript(dataset:str, transcript_id:str, ds_version=None):
                       .where((db.Transcript.transcript_id == transcript_id) &
                              (db.Gene.reference_set == ref_set))
                       .get())
-    except db.Transcript.DoesNotExist:
+    except db.Transcript.DoesNotExist as err:
         logging.info('get_exons_in_transcript({}, {}): unable to retrieve transcript'.format(dataset, transcript_id))
-        raise error.NotFoundError(f'Transcript {transcript_id} not found in reference data.')
+        raise error.NotFoundError(f'Transcript {transcript_id} not found in reference data.') from err
     wanted_types = ('CDS', 'UTR', 'exon')
     features = sorted(list(db.Feature.select().where((db.Feature.transcript == transcript) &
                                                      (db.Feature.feature_type in wanted_types)).dicts()),
@@ -247,14 +247,14 @@ def get_gene(dataset:str, gene_id:str, ds_version:str=None):
     """
     try:
         ref_set = db.get_dataset_version(dataset, ds_version).reference_set
-    except AttributeError:
-        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.')
+    except AttributeError as err:
+        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.') from err
 
     try:
         return db.Gene.select().where((db.Gene.gene_id == gene_id) &
                                       (db.Gene.reference_set == ref_set)).dicts().get()
-    except db.Gene.DoesNotExist:
-        raise error.NotFoundError(f'Gene {gene_id} not found in reference data.')
+    except db.Gene.DoesNotExist as err:
+        raise error.NotFoundError(f'Gene {gene_id} not found in reference data.') from err
 
 
 def get_gene_by_dbid(gene_dbid:str):
@@ -291,8 +291,8 @@ def get_gene_by_name(dataset:str, gene_name:str, ds_version=None):
     """
     try:
         ref_set = db.get_dataset_version(dataset, ds_version).reference_set
-    except AttributeError:
-        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.')
+    except AttributeError as err:
+        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.') from err
 
     try:
         return (db.Gene.select()
@@ -308,9 +308,9 @@ def get_gene_by_name(dataset:str, gene_name:str, ds_version=None):
                            (db.Gene.reference_set == ref_set))
                     .dicts()
                     .get())
-        except db.GeneOtherNames.DoesNotExist:
+        except db.GeneOtherNames.DoesNotExist as err:
             logging.info('get_gene_by_name({}, {}): unable to retrieve gene'.format(dataset, gene_name))
-            raise error.NotFoundError(f'Gene {gene_name} not found in reference data')
+            raise error.NotFoundError(f'Gene {gene_name} not found in reference data') from err
 
 
 def get_genes_in_region(dataset:str, chrom:str, start_pos:int, stop_pos:int, ds_version:str=None):
@@ -330,8 +330,8 @@ def get_genes_in_region(dataset:str, chrom:str, start_pos:int, stop_pos:int, ds_
     """
     try:
         ref_set = db.get_dataset_version(dataset, ds_version).reference_set
-    except AttributeError:
-        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.')
+    except AttributeError as err:
+        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.') from err
 
     genes = db.Gene.select().where((db.Gene.reference_set == ref_set) &
                                    (db.Gene.start <= stop_pos) &
@@ -381,10 +381,10 @@ def get_raw_variant(dataset:str, pos:int, chrom:str, ref:str, alt:str, ds_versio
                                   .where(db.VariantTranscripts.variant == variant['id'])
                                   .dicts()]
         return variant
-    except db.Variant.DoesNotExist:
+    except db.Variant.DoesNotExist as err:
         logging.info('get_raw_variant({}, {}, {}, {}, {}, {}): unable to retrieve variant'
                      .format(dataset, pos, chrom, ref, alt, dataset_version.id))
-        raise error.NotFoundError(f'Variant {chrom}-{pos}-{ref}-{alt} not found')
+        raise error.NotFoundError(f'Variant {chrom}-{pos}-{ref}-{alt} not found') from err
 
 
 def get_transcript(dataset:str, transcript_id:str, ds_version:str=None):
@@ -404,8 +404,8 @@ def get_transcript(dataset:str, transcript_id:str, ds_version:str=None):
     """
     try:
         ref_set = db.get_dataset_version(dataset, ds_version).reference_set
-    except AttributeError:
-        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.')
+    except AttributeError as err:
+        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.') from err
     try:
         transcript = (db.Transcript
                       .select(db.Transcript, db.Gene.gene_id)
@@ -416,9 +416,9 @@ def get_transcript(dataset:str, transcript_id:str, ds_version:str=None):
                       .get())
         transcript['exons'] = get_exons_in_transcript(dataset, transcript_id)
         return transcript
-    except db.Transcript.DoesNotExist:
+    except db.Transcript.DoesNotExist as err:
         logging.info('get_transcript({}, {}): unable to retrieve transcript'.format(dataset, transcript_id))
-        raise error.NotFoundError(f'Transcript {transcript_id} not found in reference data')
+        raise error.NotFoundError(f'Transcript {transcript_id} not found in reference data') from err
 
 
 def get_transcripts_in_gene(dataset:str, gene_id:str, ds_version:str=None):
@@ -436,16 +436,16 @@ def get_transcripts_in_gene(dataset:str, gene_id:str, ds_version:str=None):
     """
     try:
         ref_set = db.get_dataset_version(dataset, ds_version).reference_set
-    except AttributeError:
+    except AttributeError as err:
         logging.warning('get_transcripts_in_gene({}, {}): unable to get referenceset dbid'.format(dataset, gene_id))
-        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.')
+        raise error.NotFoundError(f'Reference set not found for dataset {dataset}.') from err
 
     try:
         gene = db.Gene.select().where((db.Gene.reference_set == ref_set) &
                                       (db.Gene.gene_id == gene_id)).dicts().get()
-    except db.Gene.DoesNotExist:
+    except db.Gene.DoesNotExist as err:
         logging.info('get_transcripts_in_gene({}, {}): unable to retrieve gene'.format(dataset, gene_id))
-        raise error.NotFoundError(f'Gene {gene_id} not found in reference data')
+        raise error.NotFoundError(f'Gene {gene_id} not found in reference data') from err
 
     return [transcript for transcript in db.Transcript.select().where(db.Transcript.gene == gene['id']).dicts()]
 
@@ -510,9 +510,10 @@ def get_variants_by_rsid(dataset:str, rsid:str, ds_version:str=None):
 
     try:
         rsid = int(rsid.lstrip('rs'))
-    except ValueError:
+    except ValueError as err:
         logging.error('get_variants_by_rsid({}, {}): not an integer after rs'.format(dataset, rsid))
-        raise error.ParsingError('Not an integer after rs')
+        raise error.ParsingError('Not an integer after rs') from err
+
     variants = (db.Variant
                 .select()
                 .where((db.Variant.rsid == rsid) &
diff --git a/backend/modules/browser/utils.py b/backend/modules/browser/utils.py
index d3c15aaf8..7a0322671 100644
--- a/backend/modules/browser/utils.py
+++ b/backend/modules/browser/utils.py
@@ -464,8 +464,8 @@ def parse_region(region:str):
     try:
         start = int(start)
         stop = int(stop)
-    except ValueError:
-        raise error.ParsingError(f'Unable to parse region {region} (positions not integers).')
+    except ValueError as err:
+        raise error.ParsingError(f'Unable to parse region {region} (positions not integers).') from err
     
     return chrom, start, stop
 

From fa3654c394b5d86530ec9b3325b88f05540d833b Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Fri, 28 Jun 2019 14:54:16 +0200
Subject: [PATCH 016/126] Simplify diff reporting in Travis.

---
 test/travis_script.sh | 7 ++-----
 1 file changed, 2 insertions(+), 5 deletions(-)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index 932725b46..9a5bdd13e 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -151,11 +151,8 @@ cat ref.psql
 
 # compare dump to reference
 diff sdump.psql ref.psql
-DIFFRES=$?
-if [ $DIFFRES -ne 0 ]; then
-    echo "Database not identical to reference"
-    RETURN_VALUE=$((RETURN_VALUE + $DIFFRES))
-fi
+
+RETURN_VALUE=$((RETURN_VALUE + $?))
 
 echo '>>> Finalising: Combine coverage'
 

From 8826fa78bb170a6202abc9688b69e3f3729a6571 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Fri, 28 Jun 2019 15:06:45 +0200
Subject: [PATCH 017/126] Update reference data.

---
 scripts/importer/tests/data/reference.psql | 400 ++++++++++-----------
 1 file changed, 200 insertions(+), 200 deletions(-)

diff --git a/scripts/importer/tests/data/reference.psql b/scripts/importer/tests/data/reference.psql
index 6adef74c3..0af29b7f7 100644
--- a/scripts/importer/tests/data/reference.psql
+++ b/scripts/importer/tests/data/reference.psql
@@ -1,3 +1,9 @@
+COPY beacon.beacon_dataset_counts_table (datasetid, dataset, callcount, variantcount) FROM stdin;
+\.
+COPY data.collections (id, study_name, ethnicity) FROM stdin;
+1	reg	undefined
+2	reg	undefined
+\.
 COPY data.studies (id, pi_name, pi_email, contact_name, contact_email, title, study_description, publication_date, ref_doi) FROM stdin;
 1	name	email	name	email	SweGen	\N	2001-01-01 00:00:00	doi
 2	name2	email2	name2	email2	SweGen2	\N	2001-01-02 00:00:00	doi
@@ -14,12 +20,6 @@ COPY data.dataset_versions (id, dataset, reference_set, dataset_version, dataset
 2	1	1	Version 2	desc	terms	2001-01-02 00:00:00	doi	place	email	12	{1,5,10,15,20,25,30,50,100}	t	REGISTERED	PUBLIC
 3	2	1	Version 1	desc	terms	2001-01-02 00:00:00	doi	place	email	12	{1,5,10,15,20,25,30,50,100}	t	REGISTERED	PUBLIC
 \.
-COPY beacon.beacon_dataset_counts_table (datasetid, dataset, callcount, variantcount) FROM stdin;
-\.
-COPY data.collections (id, study_name, ethnicity) FROM stdin;
-1	reg	undefined
-2	reg	undefined
-\.
 COPY data.coverage (id, dataset_version, chrom, pos, mean, median, coverage) FROM stdin;
 1	1	22	46515890	37.8400002	37	{1,1,1,1,0.99000001,0.959999979,0.860000014,0.0799999982,0}
 2	1	22	46515900	38.0200005	37	{1,1,1,1,0.99000001,0.970000029,0.850000024,0.0799999982,0}
@@ -518,215 +518,215 @@ COPY data.variant_genes (id, variant, gene) FROM stdin;
 31	30	3
 32	31	4
 33	31	3
-34	32	4
-35	32	5
+34	32	5
+35	32	4
 36	33	8
 \.
 COPY data.variant_transcripts (id, variant, transcript) FROM stdin;
-1	1	7
-2	1	12
-3	1	9
-4	1	11
-5	1	10
-6	1	13
-7	1	8
-8	1	16
-9	1	15
-10	1	14
-11	2	17
-12	2	7
-13	2	12
-14	2	9
-15	2	11
-16	2	10
-17	2	13
-18	2	8
-19	2	16
-20	2	15
-21	2	14
-22	3	17
-23	3	7
-24	3	12
-25	3	9
-26	3	11
-27	3	10
-28	3	13
-29	3	8
-30	3	16
-31	3	15
-32	3	14
-33	4	17
-34	4	7
-35	4	12
-36	4	9
-37	4	11
-38	4	10
-39	4	13
-40	4	8
-41	4	16
-42	4	15
-43	4	14
-44	5	17
-45	5	7
-46	5	12
-47	5	9
-48	5	11
-49	5	10
-50	5	13
-51	5	8
-52	5	16
-53	5	15
-54	5	14
-55	6	17
-56	6	7
-57	6	12
-58	6	18
-59	6	11
-60	6	10
-61	6	13
-62	6	16
-63	6	9
-64	6	8
-65	6	15
-66	6	14
-67	7	17
-68	7	19
-69	7	9
-70	7	18
-71	7	11
-72	7	10
-73	7	13
-74	7	8
-75	7	16
-76	7	15
-77	7	14
-78	8	17
-79	8	19
-80	8	9
-81	8	18
-82	8	11
-83	8	10
-84	8	13
-85	8	8
-86	8	16
-87	8	15
-88	8	14
-89	9	17
-90	9	18
-91	9	11
-92	9	10
-93	9	13
-94	9	16
+1	1	11
+2	1	16
+3	1	7
+4	1	12
+5	1	15
+6	1	8
+7	1	13
+8	1	9
+9	1	14
+10	1	10
+11	2	11
+12	2	16
+13	2	7
+14	2	12
+15	2	15
+16	2	8
+17	2	17
+18	2	13
+19	2	9
+20	2	14
+21	2	10
+22	3	11
+23	3	16
+24	3	7
+25	3	12
+26	3	15
+27	3	8
+28	3	17
+29	3	13
+30	3	9
+31	3	14
+32	3	10
+33	4	11
+34	4	16
+35	4	7
+36	4	12
+37	4	15
+38	4	8
+39	4	17
+40	4	13
+41	4	9
+42	4	14
+43	4	10
+44	5	11
+45	5	16
+46	5	7
+47	5	12
+48	5	15
+49	5	8
+50	5	17
+51	5	13
+52	5	9
+53	5	14
+54	5	10
+55	6	11
+56	6	16
+57	6	7
+58	6	12
+59	6	15
+60	6	8
+61	6	17
+62	6	18
+63	6	13
+64	6	9
+65	6	14
+66	6	10
+67	7	11
+68	7	16
+69	7	19
+70	7	15
+71	7	8
+72	7	17
+73	7	18
+74	7	13
+75	7	9
+76	7	14
+77	7	10
+78	8	11
+79	8	16
+80	8	19
+81	8	15
+82	8	8
+83	8	17
+84	8	18
+85	8	13
+86	8	9
+87	8	14
+88	8	10
+89	9	11
+90	9	16
+91	9	20
+92	9	17
+93	9	18
+94	9	13
 95	9	9
-96	9	20
-97	9	14
-98	10	17
-99	10	18
-100	10	11
-101	10	10
-102	10	13
-103	10	16
+96	9	14
+97	9	10
+98	10	11
+99	10	16
+100	10	20
+101	10	17
+102	10	18
+103	10	13
 104	10	9
-105	10	20
-106	10	14
-107	11	17
-108	11	18
-109	11	11
-110	11	10
-111	11	13
-112	11	16
+105	10	14
+106	10	10
+107	11	11
+108	11	16
+109	11	20
+110	11	17
+111	11	18
+112	11	13
 113	11	9
-114	11	20
-115	11	14
-116	12	17
-117	12	18
-118	12	11
-119	12	10
-120	12	13
-121	12	16
+114	11	14
+115	11	10
+116	12	11
+117	12	16
+118	12	20
+119	12	17
+120	12	18
+121	12	13
 122	12	9
-123	12	20
-124	12	14
-125	13	17
-126	13	18
-127	13	11
-128	13	10
-129	13	13
-130	13	16
+123	12	14
+124	12	10
+125	13	11
+126	13	16
+127	13	20
+128	13	17
+129	13	18
+130	13	13
 131	13	9
-132	13	20
-133	13	14
-134	14	17
-135	14	18
-136	14	11
-137	14	10
-138	14	13
-139	14	16
+132	13	14
+133	13	10
+134	14	11
+135	14	16
+136	14	20
+137	14	17
+138	14	18
+139	14	13
 140	14	9
-141	14	20
-142	14	14
-143	15	17
-144	15	18
-145	15	11
-146	15	10
-147	15	13
-148	15	16
+141	14	14
+142	14	10
+143	15	11
+144	15	16
+145	15	20
+146	15	17
+147	15	18
+148	15	13
 149	15	9
-150	15	20
-151	15	14
-152	16	17
-153	16	18
-154	16	11
-155	16	10
-156	16	13
-157	16	16
+150	15	14
+151	15	10
+152	16	11
+153	16	16
+154	16	20
+155	16	17
+156	16	18
+157	16	13
 158	16	9
-159	16	20
-160	16	14
-161	17	26
+159	16	14
+160	16	10
+161	17	23
 162	17	29
-163	17	25
-164	17	27
-165	17	28
+163	17	24
+164	17	28
+165	17	21
 166	17	30
-167	17	24
-168	17	21
-169	17	23
-170	17	22
-171	18	26
+167	17	27
+168	17	22
+169	17	25
+170	17	26
+171	18	23
 172	18	29
-173	18	27
+173	18	24
 174	18	28
-175	18	30
-176	18	24
-177	18	21
-178	18	23
-179	18	22
-180	19	2
-181	19	1
-182	20	2
-183	20	3
-184	20	1
-185	21	2
-186	21	1
-187	22	2
-188	22	1
-189	23	2
-190	23	1
-191	24	2
-192	24	1
-193	25	2
-194	25	1
-195	26	2
-196	26	1
-197	28	2
-198	28	1
-199	29	2
-200	29	1
-201	30	4
-202	30	5
-203	31	4
-204	31	5
+175	18	21
+176	18	30
+177	18	27
+178	18	22
+179	18	26
+180	19	1
+181	19	2
+182	20	1
+183	20	2
+184	20	3
+185	21	1
+186	21	2
+187	22	1
+188	22	2
+189	23	1
+190	23	2
+191	24	1
+192	24	2
+193	25	1
+194	25	2
+195	26	1
+196	26	2
+197	28	1
+198	28	2
+199	29	1
+200	29	2
+201	30	5
+202	30	4
+203	31	5
+204	31	4
 205	32	6
 206	32	5
 207	33	31

From e8e6fd336025ee2b5a53f76403375736f1278dc3 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Tue, 6 Aug 2019 09:54:15 +0200
Subject: [PATCH 018/126] Ignore id column as it may wary due to dictionaries.

---
 test/travis_script.sh | 4 +++-
 1 file changed, 3 insertions(+), 1 deletion(-)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index 9a5bdd13e..51178dba5 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -140,9 +140,11 @@ scripts/manage.sh import --add_raw_data \
 
 # make pg_dump
 pg_dump -U postgres -h 127.0.0.1 -p 5433 "$DBNAME" -f dbdump.psql --data-only
-sed -i -e '/^--/d;/^$/d' dbdump.psql
+sed -i -r -e '/^--/d;/^$/d;s/[0-9]+[^I]//' dbdump.psql
 grep -v -P "^SE[TL]" dbdump.psql | sort > sdump.psql
+sed -i -r -e 's/[0-9]+[^I]//' "$BASE/tests/data/reference.psql"
 sort "$BASE/tests/data/reference.psql" > ref.psql
+
 cat dbdump.psql
 
 cat sdump.psql

From 3510c8e258e4da4b3852cd767613f1bca7cf4e05 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Tue, 6 Aug 2019 10:29:29 +0200
Subject: [PATCH 019/126] Fix incorrect coverage file names.

---
 test/travis_script.sh | 9 ++-------
 1 file changed, 2 insertions(+), 7 deletions(-)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index 51178dba5..91f21b6e0 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -139,18 +139,13 @@ scripts/manage.sh import --add_raw_data \
 		   --beacon-only
 
 # make pg_dump
+# compare file to reference; must remove comments, empty rows and id column
 pg_dump -U postgres -h 127.0.0.1 -p 5433 "$DBNAME" -f dbdump.psql --data-only
 sed -i -r -e '/^--/d;/^$/d;s/[0-9]+[^I]//' dbdump.psql
 grep -v -P "^SE[TL]" dbdump.psql | sort > sdump.psql
 sed -i -r -e 's/[0-9]+[^I]//' "$BASE/tests/data/reference.psql"
 sort "$BASE/tests/data/reference.psql" > ref.psql
 
-cat dbdump.psql
-
-cat sdump.psql
-
-cat ref.psql
-
 # compare dump to reference
 diff sdump.psql ref.psql
 
@@ -158,7 +153,7 @@ RETURN_VALUE=$((RETURN_VALUE + $?))
 
 echo '>>> Finalising: Combine coverage'
 
-coverage combine .coverage_pytest .coverage_server .coverage_import1 .coverage_import2 .coverage_import3 .coverage_import4
+coverage combine .coverage_pytest .coverage_server .coverage_import_1 .coverage_import_2 .coverage_import_3 .coverage_import_4
 
 if [ -f .coverage ]; then
     coveralls

From 61fe7f14edfd58a466d36da7764601a3243dde2c Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Wed, 3 Jul 2019 10:58:55 +0200
Subject: [PATCH 020/126] Test beacon counts

---
 scripts/importer/tests/data/reference.psql | 5 ++++-
 test/travis_script.sh                      | 2 ++
 2 files changed, 6 insertions(+), 1 deletion(-)

diff --git a/scripts/importer/tests/data/reference.psql b/scripts/importer/tests/data/reference.psql
index 0af29b7f7..a5aa3b87f 100644
--- a/scripts/importer/tests/data/reference.psql
+++ b/scripts/importer/tests/data/reference.psql
@@ -1,4 +1,7 @@
-COPY beacon.beacon_dataset_counts_table (datasetid, dataset, callcount, variantcount) FROM stdin;
+COPY beacon.beacon_dataset_counts_table (datasetid, callcount, variantcount) FROM stdin;
+GRCh37p13:Dataset 1:2001-01-01 00:00:00	18	18
+GRCh37p13:Dataset 2:2001-01-01 00:00:00	12	15
+
 \.
 COPY data.collections (id, study_name, ethnicity) FROM stdin;
 1	reg	undefined
diff --git a/test/travis_script.sh b/test/travis_script.sh
index 91f21b6e0..b3661d75c 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -122,6 +122,7 @@ scripts/manage.sh import --add_raw_data \
                    --dataset  "Dataset 1"\
                    --version "Version 1"\
                    --variant_file "$BASE/tests/data/dataset1_1.vcf.gz"\
+                   --count_calls \
 		   --coverage_file "$BASE/tests/data/dataset1_1_coverage.txt.gz"
 
 sed -i -e 's/import_2/import_3/' scripts/manage.sh
@@ -135,6 +136,7 @@ sed -i -e 's/import_3/import_4/' scripts/manage.sh
 scripts/manage.sh import --add_raw_data \
                    --dataset  "Dataset 2"\
                    --version "Version 1"\
+                   --count_calls \
                    --variant_file "$BASE/tests/data/dataset2_1.vcf.gz"\
 		   --beacon-only
 

From 536c771e35d5d3f9f410bc8a83650800fcf52e78 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Wed, 3 Jul 2019 11:15:39 +0200
Subject: [PATCH 021/126] Add test for parsing mates (breakends)

---
 scripts/importer/tests/data/manta.vcf         | 19 +++++++++++++++++++
 .../importer/tests/data/mates_reference.txt   |  8 ++++++++
 test/travis_script.sh                         | 15 +++++++++++++++
 3 files changed, 42 insertions(+)
 create mode 100644 scripts/importer/tests/data/manta.vcf
 create mode 100644 scripts/importer/tests/data/mates_reference.txt

diff --git a/scripts/importer/tests/data/manta.vcf b/scripts/importer/tests/data/manta.vcf
new file mode 100644
index 000000000..ee7221f73
--- /dev/null
+++ b/scripts/importer/tests/data/manta.vcf
@@ -0,0 +1,19 @@
+##fileformat=VCFv4.1
+##source=SVDB
+##ALT=<ID=DEL,Description="Deletion">
+##ALT=<ID=DUP,Description="Duplication">
+##ALT=<ID=INV,Description="Inversion">
+##ALT=<ID=BND,Description="Break end">
+##INFO=<ID=SVTYPE,Number=1,Type=String,Description="Type of structural variant">
+##INFO=<ID=END,Number=1,Type=String,Description="End of an intra-chromosomal variant">
+##INFO=<ID=OCC,Number=1,Type=Integer,Description="The number of occurences of the event in the database">
+##INFO=<ID=NSAMPLES,Number=1,Type=Integer,Description="the number of samples within the database">
+##INFO=<ID=VARIANTS,Number=1,Type=Integer,Description="a| separated list of the positions of the clustered variants">
+##INFO=<ID=FRQ,Number=1,Type=Float,Description="the frequency of the variant">
+##INFO=<ID=SVLEN,Number=1,Type=Integer,Description="Difference in length between REF and ALT alleles">
+##INFO=<ID=CIPOS,Number=2,Type=Integer,Description="Confidence interval around POS">
+##INFO=<ID=CIEND,Number=2,Type=Integer,Description="Confidence interval around END">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
+1	10546	cluster_14774	N	N[7:159128729[	.	PASS	SVTYPE=BND;NSAMPLES=997;OCC=1;FRQ=0.00101300902708
+1	10549	cluster_15023	N	N[18:10613[	.	PASS	SVTYPE=BND;NSAMPLES=997;OCC=1;FRQ=0.00101300902708
diff --git a/scripts/importer/tests/data/mates_reference.txt b/scripts/importer/tests/data/mates_reference.txt
new file mode 100644
index 000000000..82ae0f13b
--- /dev/null
+++ b/scripts/importer/tests/data/mates_reference.txt
@@ -0,0 +1,8 @@
+   chrom_id    |    pos    | ref | alt | chrom | mate_chrom | mate_start |    mate_id    | allele_freq |          variant_id          | allele_count | allele_num 
+---------------+-----------+-----+-----+-------+------------+------------+---------------+-------------+------------------------------+--------------+------------
+ cluster_14774 |     10546 | N   | N   | 1     | 7          |  159128729 |               |  0.00101301 | 1-10546-N-N[7:159128729[     |            0 |          0
+               | 159128729 | N   | N   | 7     | 1          |      10546 | cluster_14774 |  0.00101301 | 7-159128729-N-N[7:159128729[ |            0 |          0
+ cluster_15023 |     10549 | N   | N   | 1     | 18         |      10613 |               |  0.00101301 | 1-10549-N-N[18:10613[        |            0 |          0
+               |     10613 | N   | N   | 18    | 1          |      10549 | cluster_15023 |  0.00101301 | 18-10613-N-N[18:10613[       |            0 |          0
+(4 rows)
+
diff --git a/test/travis_script.sh b/test/travis_script.sh
index b3661d75c..07f10c2c9 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -162,4 +162,19 @@ if [ -f .coverage ]; then
     coverage report
 fi
 
+echo '>>> Test 6. Reading manta file'
+
+
+./scripts/manage.sh import --add_raw_data \
+                   --dataset "Dataset 1" \
+                   --version "Version 1" \
+                   --add_mates \
+                   --assembly_id "GRCh37p13" \
+                   --add_reversed_mates \
+                   --variant_file "$BASE/tests/data/manta.vcf"
+
+psql -U postgres -h localhost -p 5435 postgres -c "select chrom_id, pos, ref, alt, chrom, mate_chrom, mate_start, mate_id, allele_freq, variant_id, allele_count, allele_num from data.mates ;" > mates_res.txt
+diff mates_res.txt "$BASE/tests/data/mates_reference.txt"
+RETURN_VALUE=$((RETURN_VALUE + $?))
+
 exit "$RETURN_VALUE"

From e9a6452b0fa47a78d8e43800f47c026cd5dfb291 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Tue, 6 Aug 2019 13:29:59 +0200
Subject: [PATCH 022/126] Test the code used for batches as well.

---
 test/travis_script.sh | 1 +
 1 file changed, 1 insertion(+)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index 91f21b6e0..319b01cd1 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -129,6 +129,7 @@ scripts/manage.sh import --add_raw_data \
                    --dataset  "Dataset 1"\
                    --version "Version 2"\
                    --variant_file "$BASE/tests/data/dataset1_2.vcf.gz"\
+		   --batch_size 2\
 		   --coverage_file "$BASE/tests/data/dataset1_2_coverage.txt.gz"
 
 sed -i -e 's/import_3/import_4/' scripts/manage.sh

From 39213d8f75b7d2c497856a8726ec41bb89c300a8 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Tue, 6 Aug 2019 14:07:22 +0200
Subject: [PATCH 023/126] Use small batch for references as well.

---
 test/travis_script.sh | 1 +
 1 file changed, 1 insertion(+)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index 319b01cd1..410671b75 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -110,6 +110,7 @@ scripts/manage.sh import --add_reference\
                   --ensembl_version homo_sapiens_core_75_37\
 		  --assembly_id GRCh37p13\
                   --dbnsfp_version 2.9.3\
+		  --batch_size 2\
                   --ref_name GRCh37p13
 
 # read dataset names, versions etc

From 8af6f081ca07dbeb38c91d893d60f041892c4142 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 7 Aug 2019 07:36:36 +0200
Subject: [PATCH 024/126] Sort approved users by their application date.

---
 backend/application.py | 11 ++++-------
 1 file changed, 4 insertions(+), 7 deletions(-)

diff --git a/backend/application.py b/backend/application.py
index 5641c31a4..1f4cecbcd 100644
--- a/backend/application.py
+++ b/backend/application.py
@@ -546,14 +546,11 @@ def get(self, dataset):
         dataset, _ = utils.parse_dataset(dataset)
         dataset = db.get_dataset(dataset)
         users = db.User.select()
-        access = (db.DatasetAccessCurrent
-                   .select()
-                   .where(
-                       db.DatasetAccessCurrent.dataset == dataset,
-                   ))
+        access = (db.DatasetAccessCurrent.select()
+                  .where(db.DatasetAccessCurrent.dataset == dataset))
         query = peewee.prefetch(users, access)
-        self.finish({'data': _build_json_response(
-            query, lambda u: u.access_current)})
+        self.finish({'data': sorted(_build_json_response(
+            query, lambda u: u.access_current),key=lambda u: u['applyDate'])})
 
 
 class UserDatasetAccess(handlers.SafeHandler):

From e1975a4faa11de55c1a2b2735f83c218dc4543f0 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 7 Aug 2019 10:55:17 +0200
Subject: [PATCH 025/126] Pylint fixing in browser tests.

---
 backend/modules/browser/tests/test_lookups.py | 2 +-
 backend/modules/browser/tests/test_utils.py   | 2 +-
 2 files changed, 2 insertions(+), 2 deletions(-)

diff --git a/backend/modules/browser/tests/test_lookups.py b/backend/modules/browser/tests/test_lookups.py
index 6de69d606..fd339211c 100644
--- a/backend/modules/browser/tests/test_lookups.py
+++ b/backend/modules/browser/tests/test_lookups.py
@@ -175,7 +175,7 @@ def test_get_gene_by_dbid():
     assert not result
 
 
-def test_get_gene_by_name(caplog):
+def test_get_gene_by_name():
     """
     Test get_gene_by_name()
     """
diff --git a/backend/modules/browser/tests/test_utils.py b/backend/modules/browser/tests/test_utils.py
index 83361475e..aaeb21beb 100644
--- a/backend/modules/browser/tests/test_utils.py
+++ b/backend/modules/browser/tests/test_utils.py
@@ -89,7 +89,7 @@ def test_get_coverage():
 
     # no coverage found
     with pytest.raises(error.NotFoundError):
-        utils.get_coverage('BAD_SET', 'transcript', 'ENST00000438441')['coverage']
+        res = utils.get_coverage('BAD_SET', 'transcript', 'ENST00000438441')['coverage']
 
     with pytest.raises(error.MalformedRequest):
         res = utils.get_coverage('SweGen', 'region', '22-1-1000000')

From 291f698d5ebf7d33030006d4c076952c04cf8f09 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 7 Aug 2019 11:06:00 +0200
Subject: [PATCH 026/126] Pylint fixing in db.py

---
 backend/db.py | 18 +++++++-----------
 1 file changed, 7 insertions(+), 11 deletions(-)

diff --git a/backend/db.py b/backend/db.py
index 14cf557ea..8485126d3 100644
--- a/backend/db.py
+++ b/backend/db.py
@@ -2,8 +2,7 @@
 
 import logging
 import settings
-from peewee import (BigIntegerField,
-                    BlobField,
+from peewee import (BlobField,
                     BooleanField,
                     CharField,
                     DateTimeField,
@@ -12,9 +11,6 @@
                     FloatField,
                     ForeignKeyField,
                     Model,
-                    PostgresqlDatabase,
-                    PrimaryKeyField,
-                    SQL,
                     TextField,
                     fn,
                 )
@@ -375,7 +371,7 @@ def has_access(self, dataset, ds_version=None):
             return False
         if dsv.file_access in ('REGISTERED', 'PUBLIC'):
             return True
-        elif dsv.file_access == 'PRIVATE':
+        if dsv.file_access == 'PRIVATE':
             return False
 
         return (DatasetAccessCurrent.select()
@@ -505,7 +501,7 @@ class Meta:
 
 def get_next_free_uid():
     """
-    Get the next free uid >= 10000 and > than the current uids 
+    Get the next free uid >= 10000 and > than the current uids
     from the sftp_user table in the db.
 
     Returns:
@@ -568,9 +564,9 @@ def get_dataset_version(dataset:str, version:str=None):
                                .where(DatasetVersion.version == version,
                                       Dataset.short_name == dataset)).get()
         except DatasetVersion.DoesNotExist:
-            logging.error("get_dataset_version({}, {}): ".format(dataset, version) +
+            logging.error(f"get_dataset_version({dataset}, {version}): " +
                           "cannot retrieve dataset version")
-            return
+            return None
     else:
         try:
             dataset_version = (DatasetVersionCurrent
@@ -578,9 +574,9 @@ def get_dataset_version(dataset:str, version:str=None):
                                .join(Dataset)
                                .where(Dataset.short_name == dataset)).get()
         except DatasetVersionCurrent.DoesNotExist:
-            logging.error("get_dataset_version({}, version=None): ".format(dataset) +
+            logging.error(f"get_dataset_version({dataset}, version=None): " +
                           "cannot retrieve dataset version")
-            return
+            return None
     return dataset_version
 
 

From ae8f39ab1bc26be0c161d27a21530ce7f77722da Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 7 Aug 2019 11:10:11 +0200
Subject: [PATCH 027/126] Pylint fixing in browser

---
 backend/modules/browser/error.py   | 5 ++---
 backend/modules/browser/lookups.py | 4 ++--
 backend/modules/browser/utils.py   | 4 ++--
 3 files changed, 6 insertions(+), 7 deletions(-)

diff --git a/backend/modules/browser/error.py b/backend/modules/browser/error.py
index 606bb5c2e..fb7766098 100644
--- a/backend/modules/browser/error.py
+++ b/backend/modules/browser/error.py
@@ -1,11 +1,10 @@
 class NotFoundError(Exception):
     """The query returned nothing from the database."""
-    pass
+
 
 class ParsingError(Exception):
     """Failed to parse the request."""
-    pass
+
 
 class MalformedRequest(Exception):
     """Bad request (e.g. too large region)."""
-    pass
diff --git a/backend/modules/browser/lookups.py b/backend/modules/browser/lookups.py
index f4ebda777..c43237de7 100644
--- a/backend/modules/browser/lookups.py
+++ b/backend/modules/browser/lookups.py
@@ -95,7 +95,7 @@ def get_awesomebar_result(dataset:str, query:str, ds_version:str=None):
     except error.NotFoundError:
         pass
     else:
-        return 'gene', gene['gene_id']    
+        return 'gene', gene['gene_id']
 
     # Ensembl formatted queries
     if query.startswith('ENS'):
@@ -128,7 +128,7 @@ def get_awesomebar_result(dataset:str, query:str, ds_version:str=None):
             target_type = 'variant'
             try:
                 get_raw_variant(dataset, match.group(3), match.group(1), match.group(4), match.group(5), ds_version)
-            except error.NotFoundError as err:
+            except error.NotFoundError:
                 target_type = 'not_found'
 
         return target_type, target
diff --git a/backend/modules/browser/utils.py b/backend/modules/browser/utils.py
index 7a0322671..b673f6f54 100644
--- a/backend/modules/browser/utils.py
+++ b/backend/modules/browser/utils.py
@@ -178,7 +178,7 @@ def get_coverage(dataset:str, datatype:str, item:str, ds_version:str=None):
 
     elif datatype == 'region':
         chrom, start, stop = parse_region(item)
-            
+
         if is_region_too_large(start, stop):
             raise error.MalformedRequest('Region too large')
         ret['coverage'] = lookups.get_coverage_for_bases(dataset, chrom, start, stop, ds_version)
@@ -466,7 +466,7 @@ def parse_region(region:str):
         stop = int(stop)
     except ValueError as err:
         raise error.ParsingError(f'Unable to parse region {region} (positions not integers).') from err
-    
+
     return chrom, start, stop
 
 

From b4a0a8a22221f9d7a505297a7793d6f478b38917 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 7 Aug 2019 12:21:30 +0200
Subject: [PATCH 028/126] Improved annotations for lookups.

---
 backend/modules/browser/lookups.py | 38 +++++++++++++++---------------
 1 file changed, 19 insertions(+), 19 deletions(-)

diff --git a/backend/modules/browser/lookups.py b/backend/modules/browser/lookups.py
index c43237de7..712b74779 100644
--- a/backend/modules/browser/lookups.py
+++ b/backend/modules/browser/lookups.py
@@ -12,7 +12,7 @@
 REGION_REGEX = re.compile(r'^\s*(\d+|X|Y|M|MT)\s*([-:]?)\s*(\d*)-?([\dACTG]*)-?([ACTG]*)')
 
 
-def autocomplete(dataset:str, query:str, ds_version:str=None):
+def autocomplete(dataset: str, query: str, ds_version: str=None) -> list:
     """
     Provide autocomplete suggestions based on the query.
 
@@ -36,7 +36,7 @@ def autocomplete(dataset:str, query:str, ds_version:str=None):
     return gene_names
 
 
-def get_awesomebar_result(dataset:str, query:str, ds_version:str=None):
+def get_awesomebar_result(dataset: str, query: str, ds_version: str=None) -> tuple:
     """
     Parse the search input.
 
@@ -127,7 +127,7 @@ def get_awesomebar_result(dataset:str, query:str, ds_version:str=None):
         if match.group(5) and set(match.group(4)).issubset(set("ACGT")):
             target_type = 'variant'
             try:
-                get_raw_variant(dataset, match.group(3), match.group(1), match.group(4), match.group(5), ds_version)
+                get_raw_variant(dataset, int(match.group(3)), match.group(1), match.group(4), match.group(5), ds_version)
             except error.NotFoundError:
                 target_type = 'not_found'
 
@@ -136,7 +136,7 @@ def get_awesomebar_result(dataset:str, query:str, ds_version:str=None):
     return 'not_found', query
 
 
-def get_coverage_for_bases(dataset:str, chrom:str, start_pos:int, end_pos:int=None, ds_version:str=None):
+def get_coverage_for_bases(dataset: str, chrom: str, start_pos: int, end_pos: int=None, ds_version: str=None) -> list:
     """
     Get the coverage for the list of bases given by start_pos->end_pos, inclusive.
 
@@ -168,7 +168,7 @@ def get_coverage_for_bases(dataset:str, chrom:str, start_pos:int, end_pos:int=No
     return coverage
 
 
-def get_coverage_for_transcript(dataset:str, chrom:str, start_pos:int, end_pos:int=None, ds_version:str=None):
+def get_coverage_for_transcript(dataset: str, chrom: str, start_pos: int, end_pos: int=None, ds_version: str=None) -> list:
     """
     Get the coverage for the list of bases given by start_pos->end_pos, inclusive.
 
@@ -194,7 +194,7 @@ def get_coverage_for_transcript(dataset:str, chrom:str, start_pos:int, end_pos:i
     return covered
 
 
-def get_exons_in_transcript(dataset:str, transcript_id:str, ds_version=None):
+def get_exons_in_transcript(dataset: str, transcript_id: str, ds_version: str=None) -> list:
     """
     Retrieve exons associated with the given transcript id.
 
@@ -232,7 +232,7 @@ def get_exons_in_transcript(dataset:str, transcript_id:str, ds_version=None):
     return features
 
 
-def get_gene(dataset:str, gene_id:str, ds_version:str=None):
+def get_gene(dataset:str, gene_id: str, ds_version: str=None) -> dict:
     """
     Retrieve gene by gene id.
 
@@ -257,7 +257,7 @@ def get_gene(dataset:str, gene_id:str, ds_version:str=None):
         raise error.NotFoundError(f'Gene {gene_id} not found in reference data.') from err
 
 
-def get_gene_by_dbid(gene_dbid:str):
+def get_gene_by_dbid(gene_dbid: str) -> dict:
     """
     Retrieve gene by gene database id.
 
@@ -276,7 +276,7 @@ def get_gene_by_dbid(gene_dbid:str):
         return {}
 
 
-def get_gene_by_name(dataset:str, gene_name:str, ds_version=None):
+def get_gene_by_name(dataset: str, gene_name: str, ds_version: str=None) -> dict:
     """
     Retrieve gene by gene_name.
 
@@ -313,7 +313,7 @@ def get_gene_by_name(dataset:str, gene_name:str, ds_version=None):
             raise error.NotFoundError(f'Gene {gene_name} not found in reference data') from err
 
 
-def get_genes_in_region(dataset:str, chrom:str, start_pos:int, stop_pos:int, ds_version:str=None):
+def get_genes_in_region(dataset: str, chrom: str, start_pos: int, stop_pos: int, ds_version: str=None) -> dict:
     """
     Retrieve genes located within a region.
 
@@ -340,7 +340,7 @@ def get_genes_in_region(dataset:str, chrom:str, start_pos:int, stop_pos:int, ds_
     return genes
 
 
-def get_raw_variant(dataset:str, pos:int, chrom:str, ref:str, alt:str, ds_version:str=None):
+def get_raw_variant(dataset: str, pos: int, chrom: str, ref: str, alt: str, ds_version: str=None) -> dict:
     """
     Retrieve variant by position and change.
 
@@ -387,7 +387,7 @@ def get_raw_variant(dataset:str, pos:int, chrom:str, ref:str, alt:str, ds_versio
         raise error.NotFoundError(f'Variant {chrom}-{pos}-{ref}-{alt} not found') from err
 
 
-def get_transcript(dataset:str, transcript_id:str, ds_version:str=None):
+def get_transcript(dataset: str, transcript_id: str, ds_version: str=None) -> dict:
     """
     Retrieve transcript by transcript id.
 
@@ -421,7 +421,7 @@ def get_transcript(dataset:str, transcript_id:str, ds_version:str=None):
         raise error.NotFoundError(f'Transcript {transcript_id} not found in reference data') from err
 
 
-def get_transcripts_in_gene(dataset:str, gene_id:str, ds_version:str=None):
+def get_transcripts_in_gene(dataset: str, gene_id: str, ds_version: str=None) -> list:
     """
     Get the transcripts associated with a gene.
 
@@ -450,7 +450,7 @@ def get_transcripts_in_gene(dataset:str, gene_id:str, ds_version:str=None):
     return [transcript for transcript in db.Transcript.select().where(db.Transcript.gene == gene['id']).dicts()]
 
 
-def get_transcripts_in_gene_by_dbid(gene_dbid:int):
+def get_transcripts_in_gene_by_dbid(gene_dbid: int) -> list:
     """
     Get the transcripts associated with a gene.
 
@@ -464,7 +464,7 @@ def get_transcripts_in_gene_by_dbid(gene_dbid:int):
     return [transcript for transcript in db.Transcript.select().where(db.Transcript.gene == gene_dbid).dicts()]
 
 
-def get_variant(dataset:str, pos:int, chrom:str, ref:str, alt:str, ds_version:str=None):
+def get_variant(dataset: str, pos: int, chrom: str, ref: str, alt: str, ds_version: str=None) -> dict:
     """
     Retrieve variant by position and change.
 
@@ -487,7 +487,7 @@ def get_variant(dataset:str, pos:int, chrom:str, ref:str, alt:str, ds_version:st
     return variant
 
 
-def get_variants_by_rsid(dataset:str, rsid:str, ds_version:str=None):
+def get_variants_by_rsid(dataset: str, rsid: str, ds_version: str=None) -> list:
     """
     Retrieve variants by their associated rsid.
 
@@ -525,7 +525,7 @@ def get_variants_by_rsid(dataset:str, rsid:str, ds_version:str=None):
     return variants
 
 
-def get_variants_in_gene(dataset:str, gene_id:str, ds_version:str=None):
+def get_variants_in_gene(dataset: str, gene_id: str, ds_version: str=None) -> list:
     """
     Retrieve variants present inside a gene.
 
@@ -562,7 +562,7 @@ def get_variants_in_gene(dataset:str, gene_id:str, ds_version:str=None):
     return variants
 
 
-def get_variants_in_region(dataset:str, chrom:str, start_pos:int, end_pos:int, ds_version:str=None):
+def get_variants_in_region(dataset: str, chrom: str, start_pos: int, end_pos: int, ds_version: str=None) -> list:
     """
     Variants that overlap a region.
 
@@ -603,7 +603,7 @@ def get_variants_in_region(dataset:str, chrom:str, start_pos:int, end_pos:int, d
     return variants
 
 
-def get_variants_in_transcript(dataset:str, transcript_id:str, ds_version:str=None):
+def get_variants_in_transcript(dataset: str, transcript_id: str, ds_version: str=None) -> dict:
     """
     Retrieve variants inside a transcript.
 

From 54b55dfce006fd8afa48db38402c9403ab96348c Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 7 Aug 2019 12:46:23 +0200
Subject: [PATCH 029/126] Annotations improved and mypy fixes in utils.

---
 backend/modules/browser/utils.py | 68 +++++++++++++++++---------------
 1 file changed, 36 insertions(+), 32 deletions(-)

diff --git a/backend/modules/browser/utils.py b/backend/modules/browser/utils.py
index b673f6f54..44cbeda52 100644
--- a/backend/modules/browser/utils.py
+++ b/backend/modules/browser/utils.py
@@ -81,9 +81,10 @@
 }
 
 
-def add_consequence_to_variants(variant_list:list):
+def add_consequence_to_variants(variant_list: list):
     """
     Add information about variant consequence to multiple variants.
+    Changes are performed in-place.
 
     Args:
         variant_list (list): list of variants
@@ -94,9 +95,10 @@ def add_consequence_to_variants(variant_list:list):
         add_consequence_to_variant(variant)
 
 
-def add_consequence_to_variant(variant:dict):
+def add_consequence_to_variant(variant: dict):
     """
     Add information about variant consequence to a variant.
+    Changes are performed in-place.
 
     Args:
         variant (dict): variant information
@@ -134,7 +136,7 @@ def add_consequence_to_variant(variant:dict):
     return
 
 
-def annotation_severity(annotation:dict):
+def annotation_severity(annotation: dict) -> float:
     """
     Evaluate severity of the consequences; "bigger is more important".
 
@@ -145,13 +147,13 @@ def annotation_severity(annotation:dict):
         float: severity score
 
     """
-    rv = -CSQ_ORDER_DICT[worst_csq_from_csq(annotation['Consequence'])]
+    rv = float(-CSQ_ORDER_DICT[worst_csq_from_csq(annotation['Consequence'])])
     if annotation['CANONICAL'] == 'YES':
         rv += 0.1
     return rv
 
 
-def get_coverage(dataset:str, datatype:str, item:str, ds_version:str=None):
+def get_coverage(dataset: str, datatype: str, item: str, ds_version: str=None) -> dict:
     """
     Retrieve coverage for a gene/region/transcript.
 
@@ -165,7 +167,7 @@ def get_coverage(dataset:str, datatype:str, item:str, ds_version:str=None):
         dict: start, stop, coverage list
 
     """
-    ret = {'coverage':[]}
+    ret: dict = {'coverage':[]}
 
     if datatype == 'gene':
         gene = lookups.get_gene(dataset, item)
@@ -193,7 +195,7 @@ def get_coverage(dataset:str, datatype:str, item:str, ds_version:str=None):
     return ret
 
 
-def get_coverage_pos(dataset:str, datatype:str, item:str, ds_version:str=None):
+def get_coverage_pos(dataset: str, datatype: str, item: str, ds_version: str=None) -> dict:
     """
     Retrieve coverage range.
 
@@ -229,7 +231,7 @@ def get_coverage_pos(dataset:str, datatype:str, item:str, ds_version:str=None):
     return ret
 
 
-def get_flags_from_variant(variant:dict):
+def get_flags_from_variant(variant: dict) -> list:
     """
     Get flags from variant.
 
@@ -259,7 +261,7 @@ def get_flags_from_variant(variant:dict):
     return flags
 
 
-def get_proper_hgvs(annotation:dict):
+def get_proper_hgvs(annotation: dict) -> str:
     """
     Get HGVS for change, either at transcript or protein level.
 
@@ -278,10 +280,10 @@ def get_proper_hgvs(annotation:dict):
             return get_transcript_hgvs(annotation)
         return get_protein_hgvs(annotation)
     except KeyError:
-        return None
+        return ''
 
 
-def get_protein_hgvs(annotation):
+def get_protein_hgvs(annotation: dict) -> str:
     """
     Aa changes in HGVS format.
 
@@ -299,10 +301,10 @@ def get_protein_hgvs(annotation):
         return annotation['HGVSp'].split(':')[-1]
     except KeyError:
         logging.error("Could not fetch protein hgvs")
-        return None
+        return ''
 
 
-def get_transcript_hgvs(annotation:dict):
+def get_transcript_hgvs(annotation: dict) -> str:
     """
     Nucleotide change in HGVS format.
 
@@ -316,10 +318,10 @@ def get_transcript_hgvs(annotation:dict):
     try:
         return annotation['HGVSc'].split(':')[-1]
     except KeyError:
-        return None
+        return ''
 
 
-def get_variant_list(dataset:str, datatype:str, item:str, ds_version:str=None):
+def get_variant_list(dataset: str, datatype: str, item: str, ds_version: str=None) -> dict:
     """
     Retrieve variants for a datatype.
 
@@ -354,7 +356,7 @@ def get_variant_list(dataset:str, datatype:str, item:str, ds_version:str=None):
     if datatype == 'transcript':
         transcript = lookups.get_transcript(dataset, item, ds_version)
         if not transcript:
-            return None
+            return {}
         refgene = transcript['gene_id']
 
     if variants:
@@ -389,7 +391,7 @@ def format_variant(variant):
     return {'variants': variants, 'headers': headers}
 
 
-def order_vep_by_csq(annotation_list:list):
+def order_vep_by_csq(annotation_list: list) -> list:
     """
     Will add "major_consequence" to each annotation and order by severity.
 
@@ -408,7 +410,7 @@ def order_vep_by_csq(annotation_list:list):
     return sorted(annotation_list, key=(lambda ann:CSQ_ORDER_DICT[ann['major_consequence']]))
 
 
-def is_region_too_large(start:int, stop:int):
+def is_region_too_large(start: int, stop: int) -> bool:
     """
     Evaluate whether the size of a region is larger than maximum query.
 
@@ -424,7 +426,7 @@ def is_region_too_large(start:int, stop:int):
     return int(stop)-int(start) > region_limit
 
 
-def parse_dataset(dataset:str, ds_version:str=None):
+def parse_dataset(dataset: str, ds_version: str=None) -> tuple:
     """
     Check/parse if the dataset name is in the beacon form (``reference:dataset:version``).
 
@@ -442,7 +444,7 @@ def parse_dataset(dataset:str, ds_version:str=None):
     return (dataset, ds_version)
 
 
-def parse_region(region:str):
+def parse_region(region: str) -> tuple:
     """
     Parse a region with either one or two positions
 
@@ -453,26 +455,28 @@ def parse_region(region:str):
         tuple: (chrom, start, pos)
     """
     parts = region.split('-')
+    
     if len(parts) == 2:
-        chrom, start = parts
-        stop = start
+        chrom, str_start = parts
+        str_stop = str_start
     elif len(parts) == 3:
-        chrom, start, stop = parts
+        chrom, str_start, str_stop = parts
     else:
         raise error.ParsingError(f'Unable to parse region {region}.')
 
     try:
-        start = int(start)
-        stop = int(stop)
+        start = int(str_start)
+        stop = int(str_stop)
     except ValueError as err:
         raise error.ParsingError(f'Unable to parse region {region} (positions not integers).') from err
 
     return chrom, start, stop
 
 
-def remove_extraneous_information(variant:dict):
+def remove_extraneous_information(variant: dict):
     """
     Remove information that is not used in the frontend from a variant.
+    Changes are performed in-place.
 
     Args:
         variant (dict): variant data from database
@@ -485,7 +489,7 @@ def remove_extraneous_information(variant:dict):
     del variant['vep_annotations']
 
 
-def remove_extraneous_vep_annotations(annotation_list:list):
+def remove_extraneous_vep_annotations(annotation_list: list) -> list:
     """
     Remove annotations with low-impact consequences (less than intron variant).
 
@@ -500,7 +504,7 @@ def remove_extraneous_vep_annotations(annotation_list:list):
             if worst_csq_index(ann['Consequence'].split('&')) <= CSQ_ORDER_DICT['intron_variant']]
 
 
-def worst_csq_from_list(csq_list:list):
+def worst_csq_from_list(csq_list: list) -> str:
     """
     Choose the worst consequence.
 
@@ -514,7 +518,7 @@ def worst_csq_from_list(csq_list:list):
     return REV_CSQ_ORDER_DICT[worst_csq_index(csq_list)]
 
 
-def worst_csq_from_csq(csq:str):
+def worst_csq_from_csq(csq: str) -> str:
     """
     Find worst consequence in a possibly &-filled consequence string.
 
@@ -528,7 +532,7 @@ def worst_csq_from_csq(csq:str):
     return REV_CSQ_ORDER_DICT[worst_csq_index(csq.split('&'))]
 
 
-def worst_csq_index(csq_list:list):
+def worst_csq_index(csq_list: list) -> int:
     """
     Find the index of the worst consequence.
 
@@ -544,7 +548,7 @@ def worst_csq_index(csq_list:list):
     return min([CSQ_ORDER_DICT[csq] for csq in csq_list])
 
 
-def worst_csq_with_vep(annotation_list:list):
+def worst_csq_with_vep(annotation_list: list) -> dict:
     """
     Choose the vep annotation with the most severe consequence.
 
@@ -558,7 +562,7 @@ def worst_csq_with_vep(annotation_list:list):
 
     """
     if not annotation_list:
-        return None
+        return {}
     worst = max(annotation_list, key=annotation_severity)
     worst['major_consequence'] = worst_csq_from_csq(worst['Consequence'])
     return worst

From 2cff33fb0e0912218b6c2ea8cee5783c1cfea72d Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 7 Aug 2019 12:51:55 +0200
Subject: [PATCH 030/126] Remove unused modules from auth.

---
 backend/auth.py | 5 -----
 1 file changed, 5 deletions(-)

diff --git a/backend/auth.py b/backend/auth.py
index b22a038dd..d48882df3 100644
--- a/backend/auth.py
+++ b/backend/auth.py
@@ -1,12 +1,9 @@
 import logging
-import handlers
 from handlers import BaseHandler
 import tornado.auth
 import urllib.parse
 import base64
 import uuid
-import db
-import peewee
 
 class DeveloperLoginHandler(BaseHandler):
     def get(self):
@@ -147,5 +144,3 @@ def get(self):
 
         redirect = self.get_argument("next", '/')
         self.redirect(redirect)
-
-

From 76b7f9279b7cb48aa18c0d90c3cc1a18c8788e2c Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 7 Aug 2019 12:52:22 +0200
Subject: [PATCH 031/126] Minor mypy fixing in lookups.

---
 backend/modules/browser/lookups.py | 8 ++++----
 1 file changed, 4 insertions(+), 4 deletions(-)

diff --git a/backend/modules/browser/lookups.py b/backend/modules/browser/lookups.py
index 712b74779..00de401ca 100644
--- a/backend/modules/browser/lookups.py
+++ b/backend/modules/browser/lookups.py
@@ -509,14 +509,14 @@ def get_variants_by_rsid(dataset: str, rsid: str, ds_version: str=None) -> list:
         raise error.ParsingError('rsid not starting with rs')
 
     try:
-        rsid = int(rsid.lstrip('rs'))
+        int_rsid = int(rsid.lstrip('rs'))
     except ValueError as err:
         logging.error('get_variants_by_rsid({}, {}): not an integer after rs'.format(dataset, rsid))
         raise error.ParsingError('Not an integer after rs') from err
 
     variants = (db.Variant
                 .select()
-                .where((db.Variant.rsid == rsid) &
+                .where((db.Variant.rsid == int_rsid) &
                        (db.Variant.dataset_version == dataset_version))
                 .dicts())
 
@@ -603,7 +603,7 @@ def get_variants_in_region(dataset: str, chrom: str, start_pos: int, end_pos: in
     return variants
 
 
-def get_variants_in_transcript(dataset: str, transcript_id: str, ds_version: str=None) -> dict:
+def get_variants_in_transcript(dataset: str, transcript_id: str, ds_version: str=None) -> list:
     """
     Retrieve variants inside a transcript.
 
@@ -613,7 +613,7 @@ def get_variants_in_transcript(dataset: str, transcript_id: str, ds_version: str
         ds_version (str): version of the dataset
 
     Returns:
-        dict: values for the variant; None if not found
+        list: values for the variant; None if not found
 
     """
     dataset_version = db.get_dataset_version(dataset, ds_version)

From d6001a6c7f92752559400cddbaea62fc9806ed19 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 7 Aug 2019 13:57:32 +0200
Subject: [PATCH 032/126] Value is now empty list, not None.

---
 backend/modules/browser/utils.py | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/backend/modules/browser/utils.py b/backend/modules/browser/utils.py
index 44cbeda52..cc551b554 100644
--- a/backend/modules/browser/utils.py
+++ b/backend/modules/browser/utils.py
@@ -110,7 +110,7 @@ def add_consequence_to_variant(variant: dict):
     variant['category'] = ''
     variant['flags'] = ''
 
-    if worst_csq is None:
+    if not worst_csq:
         return
 
     variant['major_consequence'] = worst_csq['major_consequence']
@@ -455,7 +455,7 @@ def parse_region(region: str) -> tuple:
         tuple: (chrom, start, pos)
     """
     parts = region.split('-')
-    
+
     if len(parts) == 2:
         chrom, str_start = parts
         str_stop = str_start

From 510f213b1fb88919276c21014644621ffe8d9e27 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 8 Aug 2019 08:17:49 +0200
Subject: [PATCH 033/126] Multiple pylint fixes for raw_data_importer.

---
 .../data_importer/raw_data_importer.py        | 38 ++++++++++---------
 1 file changed, 20 insertions(+), 18 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index b1594b04a..657b3a3d3 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -1,4 +1,6 @@
 #!/usr/bin/env python3
+"""Read data from a vcf file and add the variants to a database"""
+
 import re
 import sys
 import time
@@ -22,6 +24,7 @@
 
 
 class RawDataImporter(DataImporter):
+    """Read data from a vcf file and add the variants to a database"""
     def __init__(self, settings):
         super().__init__(settings)
         self.dataset_version = None
@@ -51,21 +54,19 @@ def _set_dataset_info(self):
             self.dataset.save()
 
     def _select_dataset_version(self):
-        datasets = []
-
         # Make sure that the dataset exists
         try:
-            ds = db.Dataset.get(short_name=self.settings.dataset)
+            chosen_ds = db.Dataset.get(short_name=self.settings.dataset)
         except db.Dataset.DoesNotExist:
             logging.error("Unknown dataset '%s'", self.settings.dataset)
             logging.info("Available datasets are:")
             for dataset in db.Dataset.select():
                 logging.info(" * %s", dataset.short_name)
             sys.exit(1)
-        logging.info("Using dataset {}".format(ds.short_name))
-        self.dataset = ds
+        logging.info("Using dataset {}".format(chosen_ds.short_name))
+        self.dataset = chosen_ds
 
-        versions = [v for v in db.DatasetVersion.select().where(db.DatasetVersion.dataset == ds)]
+        versions = [v for v in db.DatasetVersion.select().where(db.DatasetVersion.dataset == chosen_ds)]
 
         # Make sure that the dataset version exists
         if not versions:
@@ -171,6 +172,7 @@ def _insert_coverage(self):
         self.log_insertion(counter, "coverage", start)
 
     def _parse_manta(self):
+        """Parse a manta file"""
         header = [("chrom", str), ("pos", int), ("chrom_id", str), ("ref", str), ("alt", str)]
 
         batch = []
@@ -193,7 +195,7 @@ def _parse_manta(self):
                         base[header[i][0]] = header[i][1](item)
                     elif i == 7:
                         # only parse column 7 (maybe also for non-beacon-import?)
-                        info = dict([(x.split('=', 1)) if '=' in x else (x, x) for x in re.split(';(?=\w)', item)])
+                        info = dict([(x.split('=', 1)) if '=' in x else (x, x) for x in re.split(r';(?=\w)', item)])
 
                 if info.get('SVTYPE') != 'BND':
                     continue
@@ -210,7 +212,7 @@ def _parse_manta(self):
                 for i, alt in enumerate(alt_alleles):
                     data = dict(base)
                     data['allele_freq'] = float(info.get('FRQ'))
-                    data['alt'], data['mate_chrom'], data['mate_start'] = re.search('(.+)[[\]](.*?):(\d+)[[\]]', alt).groups()
+                    data['alt'], data['mate_chrom'], data['mate_start'] = re.search(r'(.+)[[\]](.*?):(\d+)[[\]]', alt).groups()
                     if data['mate_chrom'].startswith('GL') or data['mate_chrom'].startswith('MT'):
                         # A BND from a chromosome to GL or MT.
                         # TODO ask a bioinformatician if these cases should be included or not
@@ -222,15 +224,15 @@ def _parse_manta(self):
                     batch += [data]
                     if self.settings.add_reversed_mates:
                         # If the vcf only contains one line per breakend, add the reversed version to the database here.
-                        reversed = dict(data)
+                        reversed_mates = dict(data)
                         # Note: in general, ref and alt cannot be assumed to be the same in the reversed direction,
                         # but our data (so far) only contains N, so we just keep them as is for now.
-                        reversed.update({'mate_chrom': data['chrom'], 'chrom': data['mate_chrom'],
+                        reversed_mates.update({'mate_chrom': data['chrom'], 'chrom': data['mate_chrom'],
                                          'mate_start': data['pos'], 'pos': data['mate_start'],
                                          'chrom_id': data['mate_id'], 'mate_id': data['chrom_id']})
-                        reversed['variant_id'] = '{}-{}-{}-{}'.format(reversed['chrom'], reversed['pos'], reversed['ref'], alt)
+                        reversed_mates['variant_id'] = '{}-{}-{}-{}'.format(reversed_mates['chrom'], reversed_mates['pos'], reversed_mates['ref'], alt)
                         counter += 1  # increase the counter; reversed BNDs are usually kept at their own vcf row
-                        batch += [reversed]
+                        batch += [reversed_mates]
 
                 counter += 1  # count variants (one per vcf row)
 
@@ -257,9 +259,7 @@ def _parse_manta(self):
         self.log_insertion(counter, "breakend", start)
 
     def _insert_variants(self):
-        """
-        Insert variants from a VCF file
-        """
+        """Insert variants from a VCF file"""
         logging.info("Inserting variants%s", " (dry run)" if self.settings.dry_run else "")
         header = [("chrom", str), ("pos", int), ("rsid", str), ("ref", str),
                   ("alt", str), ("site_quality", float), ("filter_string", str)]
@@ -315,7 +315,7 @@ def _insert_variants(self):
                             base[header[i][0]] = header[i][1](item)
                         elif i == 7 or not self.settings.beacon_only:
                             # only parse column 7 (maybe also for non-beacon-import?)
-                            info = dict([(x.split('=', 1)) if '=' in x else (x, x) for x in re.split(';(?=\w)', item)])
+                            info = dict([(x.split('=', 1)) if '=' in x else (x, x) for x in re.split(r';(?=\w)', item)])
 
                     if base["chrom"].startswith('GL') or base["chrom"].startswith('MT'):
                         continue
@@ -465,6 +465,7 @@ def get_callcount(self, data):
         self.counter['tmp_calls'].add(data['ref'])
 
     def count_entries(self):
+        """Count the number of entries"""
         start = time.time()
         if self.settings.coverage_file:
             self.counter['coverage'] = 0
@@ -491,6 +492,7 @@ def count_entries(self):
         logging.info("Counted input data lines in {} ".format(self._time_since(start)))
 
     def prepare_data(self):
+        """Prepare for inserting data into db"""
         self._select_dataset_version()
 
     def start_import(self):
@@ -506,7 +508,7 @@ def start_import(self):
         if not self.settings.beacon_only and self.settings.coverage_file:
             self._insert_coverage()
 
-    def add_variant_genes(self, variant_indexes:list, genes_to_add:list, ref_genes:dict):
+    def add_variant_genes(self, variant_indexes: list, genes_to_add: list, ref_genes: dict):
         batch = []
         for i in range(len(variant_indexes)):
             connected_genes = [{'variant':variant_indexes[i], 'gene':ref_genes[gene]} for gene in genes_to_add[i] if gene]
@@ -514,7 +516,7 @@ def add_variant_genes(self, variant_indexes:list, genes_to_add:list, ref_genes:d
         if not self.settings.dry_run:
             db.VariantGenes.insert_many(batch).execute()
 
-    def add_variant_transcripts(self, variant_indexes:list, transcripts_to_add:list, ref_transcripts:dict):
+    def add_variant_transcripts(self, variant_indexes: list, transcripts_to_add: list, ref_transcripts: dict):
         batch = []
         for i in range(len(variant_indexes)):
             connected_transcripts = [{'variant':variant_indexes[i], 'transcript':ref_transcripts[transcript]}

From c0a9f875d76b242867a9b3e914ad3e61ccf6d697 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 8 Aug 2019 08:18:46 +0200
Subject: [PATCH 034/126] Indentation fix.

---
 scripts/importer/data_importer/raw_data_importer.py | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 657b3a3d3..61cf36f7a 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -228,8 +228,8 @@ def _parse_manta(self):
                         # Note: in general, ref and alt cannot be assumed to be the same in the reversed direction,
                         # but our data (so far) only contains N, so we just keep them as is for now.
                         reversed_mates.update({'mate_chrom': data['chrom'], 'chrom': data['mate_chrom'],
-                                         'mate_start': data['pos'], 'pos': data['mate_start'],
-                                         'chrom_id': data['mate_id'], 'mate_id': data['chrom_id']})
+                                               'mate_start': data['pos'], 'pos': data['mate_start'],
+                                               'chrom_id': data['mate_id'], 'mate_id': data['chrom_id']})
                         reversed_mates['variant_id'] = '{}-{}-{}-{}'.format(reversed_mates['chrom'], reversed_mates['pos'], reversed_mates['ref'], alt)
                         counter += 1  # increase the counter; reversed BNDs are usually kept at their own vcf row
                         batch += [reversed_mates]

From 38d0a3b299d48efc2795e1934804fedc263a0d24 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 8 Aug 2019 09:12:39 +0200
Subject: [PATCH 035/126] More pylint fixes for raw_data_importer.

---
 .../data_importer/raw_data_importer.py        | 180 ++++++++++++------
 1 file changed, 127 insertions(+), 53 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 61cf36f7a..bd30b007f 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -39,7 +39,7 @@ def __init__(self, settings):
         self.chrom = None
 
     def _set_dataset_info(self):
-        """ Save dataset information given as parameters """
+        """Save dataset information given as parameters"""
         if self.settings.beacon_description:
             self.dataset.description = self.settings.beacon_description
             self.dataset.save()
@@ -54,6 +54,7 @@ def _set_dataset_info(self):
             self.dataset.save()
 
     def _select_dataset_version(self):
+        """Select the dataset version to use"""
         # Make sure that the dataset exists
         try:
             chosen_ds = db.Dataset.get(short_name=self.settings.dataset)
@@ -66,14 +67,16 @@ def _select_dataset_version(self):
         logging.info("Using dataset {}".format(chosen_ds.short_name))
         self.dataset = chosen_ds
 
-        versions = [v for v in db.DatasetVersion.select().where(db.DatasetVersion.dataset == chosen_ds)]
+        versions = [v for v in (db.DatasetVersion.select().
+                                where(db.DatasetVersion.dataset == chosen_ds))]
 
         # Make sure that the dataset version exists
         if not versions:
             raise db.DatasetVersion.DoesNotExist("No versions exist for this dataset")
 
         if self.settings.version not in [v.version for v in versions]:
-            logging.error("Unknown version '%s' for dataset '%s'.", self.settings.version, self.dataset.short_name)
+            logging.error("Unknown version '%s' for dataset '%s'.",
+                          self.settings.version, self.dataset.short_name)
             logging.info("Available versions are:")
             for version in versions:
                 logging.info(" * %s", version.version)
@@ -109,7 +112,8 @@ def _create_beacon_counts(self):
         datarow = {'datasetid': datasetid,
                    'callcount': self.counter['calls'],
                    'variantcount': self.counter['beaconvariants']}
-        logging.info('Dataset counts: callcount: %s, variantcount: %s', datarow['callcount'], datarow['variantcount'])
+        logging.info('Dataset counts: callcount: %s, variantcount: %s',
+                     datarow['callcount'], datarow['variantcount'])
         if not self.settings.dry_run:
             db.BeaconCounts.insert(datarow).execute()
 
@@ -164,11 +168,16 @@ def _insert_coverage(self):
                         batch = []
                         # Update progress
                         if self.counter['coverage'] is not None:
-                            last_progress = self._update_progress_bar(counter, self.counter['coverage'], last_progress)
+                            last_progress = self._update_progress_bar(counter,
+                                                                      self.counter['coverage'],
+                                                                      last_progress)
             if batch and not self.settings.dry_run:
                 db.Coverage.insert_many(batch).execute()
         if self.counter['coverage'] is not None:
-            last_progress = self._update_progress_bar(counter, self.counter['coverage'], last_progress, finished=True)
+            last_progress = self._update_progress_bar(counter,
+                                                      self.counter['coverage'],
+                                                      last_progress,
+                                                      finished=True)
         self.log_insertion(counter, "coverage", start)
 
     def _parse_manta(self):
@@ -195,7 +204,8 @@ def _parse_manta(self):
                         base[header[i][0]] = header[i][1](item)
                     elif i == 7:
                         # only parse column 7 (maybe also for non-beacon-import?)
-                        info = dict([(x.split('=', 1)) if '=' in x else (x, x) for x in re.split(r';(?=\w)', item)])
+                        info = dict([(x.split('=', 1)) if '=' in x else (x, x)
+                                     for x in re.split(r';(?=\w)', item)])
 
                 if info.get('SVTYPE') != 'BND':
                     continue
@@ -218,20 +228,32 @@ def _parse_manta(self):
                         # TODO ask a bioinformatician if these cases should be included or not
                         continue
                     data['mate_id'] = info.get('MATEID', '')
-                    data['variant_id'] = '{}-{}-{}-{}'.format(data['chrom'], data['pos'], data['ref'], alt)
+                    data['variant_id'] = '{}-{}-{}-{}'.format(data['chrom'],
+                                                              data['pos'],
+                                                              data['ref'],
+                                                              alt)
                     data['allele_count'] = data.get('allele_count', 0)
                     data['allele_num'] = data.get('allele_num', 0)
                     batch += [data]
                     if self.settings.add_reversed_mates:
-                        # If the vcf only contains one line per breakend, add the reversed version to the database here.
+                        # If the vcf only contains one line per breakend,
+                        # add the reversed version to the database here.
                         reversed_mates = dict(data)
-                        # Note: in general, ref and alt cannot be assumed to be the same in the reversed direction,
-                        # but our data (so far) only contains N, so we just keep them as is for now.
-                        reversed_mates.update({'mate_chrom': data['chrom'], 'chrom': data['mate_chrom'],
-                                               'mate_start': data['pos'], 'pos': data['mate_start'],
-                                               'chrom_id': data['mate_id'], 'mate_id': data['chrom_id']})
-                        reversed_mates['variant_id'] = '{}-{}-{}-{}'.format(reversed_mates['chrom'], reversed_mates['pos'], reversed_mates['ref'], alt)
-                        counter += 1  # increase the counter; reversed BNDs are usually kept at their own vcf row
+                        # Note: in general, ref and alt cannot be assumed to be the same in the
+                        # reversed direction, but our data (so far) only contains N, so we just
+                        # keep them as is for now.
+                        reversed_mates.update({'mate_chrom': data['chrom'],
+                                               'chrom': data['mate_chrom'],
+                                               'mate_start': data['pos'],
+                                               'pos': data['mate_start'],
+                                               'chrom_id': data['mate_id'],
+                                               'mate_id': data['chrom_id']})
+                        reversed_mates['variant_id'] = '{}-{}-{}-{}'.format(reversed_mates['chrom'],
+                                                                            reversed_mates['pos'],
+                                                                            reversed_mates['ref'],
+                                                                            alt)
+                        # increase the counter; reversed BNDs are usually kept at their own vcf row
+                        counter += 1
                         batch += [reversed_mates]
 
                 counter += 1  # count variants (one per vcf row)
@@ -243,7 +265,9 @@ def _parse_manta(self):
                     batch = []
                     # Update progress
                     if not self.counter['variants']:
-                        last_progress = self._update_progress_bar(counter, self.counter['variants'], last_progress)
+                        last_progress = self._update_progress_bar(counter,
+                                                                  self.counter['variants'],
+                                                                  last_progress)
 
         if batch and not self.settings.dry_run:
             db.VariantMate.insert_many(batch).execute()
@@ -255,7 +279,10 @@ def _parse_manta(self):
         self.dataset_version.num_variants = counter
         self.dataset_version.save()
         if not self.counter['variants']:
-            last_progress = self._update_progress_bar(counter, self.counter['variants'], last_progress, finished=True)
+            last_progress = self._update_progress_bar(counter,
+                                                      self.counter['variants'],
+                                                      last_progress,
+                                                      finished=True)
         self.log_insertion(counter, "breakend", start)
 
     def _insert_variants(self):
@@ -280,13 +307,14 @@ def _insert_variants(self):
                 ref_set = self.dataset_version.reference_set
 
                 # Get all genes and transcripts for foreign keys
-                ref_genes = {gene.gene_id: gene.id for gene in (db.Gene.select(db.Gene.id, db.Gene.gene_id)
-                                                                .where(db.Gene.reference_set == ref_set))}
-                ref_transcripts = {tran.transcript_id: tran.id for tran in (db.Transcript
-                                                                            .select(db.Transcript.id,
-                                                                                    db.Transcript.transcript_id)
-                                                                            .join(db.Gene)
-                                                                            .where(db.Gene.reference_set == ref_set))}
+                ref_genes = {gene.gene_id: gene.id
+                             for gene in (db.Gene.select(db.Gene.id, db.Gene.gene_id)
+                                          .where(db.Gene.reference_set == ref_set))}
+                ref_transcripts = {tran.transcript_id: tran.id
+                                   for tran in (db.Transcript.select(db.Transcript.id,
+                                                                     db.Transcript.transcript_id)
+                                                .join(db.Gene)
+                                                .where(db.Gene.reference_set == ref_set))}
                 for line in self._open(filename, binary=False):
                     line = line.strip()
 
@@ -315,17 +343,22 @@ def _insert_variants(self):
                             base[header[i][0]] = header[i][1](item)
                         elif i == 7 or not self.settings.beacon_only:
                             # only parse column 7 (maybe also for non-beacon-import?)
-                            info = dict([(x.split('=', 1)) if '=' in x else (x, x) for x in re.split(r';(?=\w)', item)])
+                            info = dict([(x.split('=', 1)) if '=' in x else (x, x)
+                                         for x in re.split(r';(?=\w)', item)])
 
                     if base["chrom"].startswith('GL') or base["chrom"].startswith('MT'):
                         continue
 
                     consequence_array = info['CSQ'].split(',') if 'CSQ' in info else []
                     if not self.settings.beacon_only:
-                        annotations = [dict(zip(vep_field_names, x.split('|'))) for x in consequence_array if len(vep_field_names) == len(x.split('|'))]
+                        annotations = [dict(zip(vep_field_names, x.split('|')))
+                                       for x in consequence_array
+                                       if len(vep_field_names) == len(x.split('|'))]
 
                     alt_alleles = base['alt'].split(",")
-                    rsids = [int(rsid.strip('rs')) for rsid in base['rsid'].split(';') if rsid.startswith('rs')]
+                    rsids = [int(rsid.strip('rs'))
+                             for rsid in base['rsid'].split(';')
+                             if rsid.startswith('rs')]
                     if not rsids:
                         rsids = [None]
 
@@ -336,11 +369,13 @@ def _insert_variants(self):
                     except ValueError:
                         hom_counts = [int(count) for count in info['AC_Hom'].split(',')]
 
-                    fmt_alleles = [f'{base["chrom"]}-{base["pos"]}-{base["ref"]}-{x}' for x in alt_alleles]
+                    fmt_alleles = [f'{base["chrom"]}-{base["pos"]}-{base["ref"]}-{x}'
+                                   for x in alt_alleles]
 
                     for i, alt in enumerate(alt_alleles):
                         if not self.settings.beacon_only:
-                            vep_annotations = [ann for ann in annotations if int(ann['ALLELE_NUM']) == i + 1]
+                            vep_annotations = [ann for ann in annotations
+                                               if int(ann['ALLELE_NUM']) == i + 1]
 
                         data = dict(base)
                         data['pos'], data['ref'], data['alt'] = base['pos'], base['ref'], alt
@@ -370,24 +405,34 @@ def _insert_variants(self):
                         if not self.settings.beacon_only:
                             data['vep_annotations'] = vep_annotations
 
-                            genes.append(list(set({annotation['Gene'] for annotation in vep_annotations if annotation['Gene'][:4] == 'ENSG'})))
-                            transcripts.append(list(set({annotation['Feature'] for annotation in vep_annotations if annotation['Feature'][:4] == 'ENST'})))
+                            genes.append(list({annotation['Gene']
+                                               for annotation in vep_annotations
+                                               if annotation['Gene'][:4] == 'ENSG'}))
+                            transcripts.append(list({annotation['Feature']
+                                                     for annotation in vep_annotations
+                                                     if annotation['Feature'][:4] == 'ENST'}))
 
                         data['hom_count'] = hom_counts[i] if hom_counts else None
 
-                        data['variant_id'] = '{}-{}-{}-{}'.format(data['chrom'], data['pos'], data['ref'], data['alt'])
+                        data['variant_id'] = '{}-{}-{}-{}'.format(data['chrom'],
+                                                                  data['pos'],
+                                                                  data['ref'],
+                                                                  data['alt'])
                         data['quality_metrics'] = dict([(x, info[x]) for x in METRICS if x in info])
                         batch += [data]
                         if self.settings.count_calls:
                             self.get_callcount(data)  # count calls (one per reference)
-                            self.counter['beaconvariants'] += 1  # count variants (one per alternate)
+                            self.counter['beaconvariants'] += 1  # count variants (one/alternate)
                     counter += 1  # count variants (one per vcf row)
 
                     if len(batch) >= self.settings.batch_size:
                         if not self.settings.dry_run:
                             if not self.settings.beacon_only:
                                 try:
-                                    curr_id = db.Variant.select(db.Variant.id).order_by(db.Variant.id.desc()).limit(1).get().id
+                                    curr_id = (db.Variant.select(db.Variant.id)
+                                               .order_by(db.Variant.id.desc())
+                                               .limit(1)
+                                               .get().id)
                                 except db.Variant.DoesNotExist:
                                     # assumes next id will be 1 if table is empty
                                     curr_id = 0
@@ -395,27 +440,39 @@ def _insert_variants(self):
                             db.Variant.insert_many(batch).execute()
 
                             if not self.settings.beacon_only:
-                                last_id = db.Variant.select(db.Variant.id).order_by(db.Variant.id.desc()).limit(1).get().id
+                                last_id = (db.Variant.select(db.Variant.id)
+                                           .order_by(db.Variant.id.desc())
+                                           .limit(1)
+                                           .get().id)
                                 if  last_id-curr_id == len(batch):
                                     indexes = list(range(curr_id+1, last_id+1))
                                 else:
                                     indexes = []
                                     for entry in batch:
-                                        indexes.append(db.Variant.select(db.Variant.id).where(db.Variant.variant_id == entry['variant_id']).get().id)
+                                        indexes.append(db.Variant.select(db.Variant.id)
+                                                       .where(db.Variant.variant_id == entry['variant_id'])
+                                                       .get().id)
                                 self.add_variant_genes(indexes, genes, ref_genes)
-                                self.add_variant_transcripts(indexes, transcripts, ref_transcripts)
+                                self.add_variant_transcripts(indexes,
+                                                             transcripts,
+                                                             ref_transcripts)
 
                         genes = []
                         transcripts = []
                         batch = []
                         # Update progress
-                        if self.counter['variants'] != None:
-                            last_progress = self._update_progress_bar(counter, self.counter['variants'], last_progress)
+                        if self.counter['variants'] is not None:
+                            last_progress = self._update_progress_bar(counter,
+                                                                      self.counter['variants'],
+                                                                      last_progress)
 
             if batch and not self.settings.dry_run:
                 if not self.settings.beacon_only:
                     try:
-                        curr_id = db.Variant.select(db.Variant.id).order_by(db.Variant.id.desc()).limit(1).get().id
+                        curr_id = (db.Variant.select(db.Variant.id)
+                                   .order_by(db.Variant.id.desc())
+                                   .limit(1)
+                                   .get().id)
                     except db.Variant.DoesNotExist:
                         # assumes next id will be 1 if table is empty
                         curr_id = 0
@@ -423,13 +480,18 @@ def _insert_variants(self):
                 db.Variant.insert_many(batch).execute()
 
                 if not self.settings.beacon_only:
-                    last_id = db.Variant.select(db.Variant.id).order_by(db.Variant.id.desc()).limit(1).get().id
+                    last_id = (db.Variant.select(db.Variant.id)
+                               .order_by(db.Variant.id.desc())
+                               .limit(1)
+                               .get().id)
                     if  last_id-curr_id == len(batch):
                         indexes = list(range(curr_id+1, last_id+1))
                     else:
                         indexes = []
                         for entry in batch:
-                            indexes.append(db.Variant.select(db.Variant.id).where(db.Variant.variant_id == entry['variant_id']).get().id)
+                            indexes.append(db.Variant.select(db.Variant.id)
+                                           .where(db.Variant.variant_id == entry['variant_id'])
+                                           .get().id)
                     self.add_variant_genes(indexes, genes, ref_genes)
                     self.add_variant_transcripts(indexes, transcripts, ref_transcripts)
 
@@ -439,8 +501,11 @@ def _insert_variants(self):
 
         self.dataset_version.num_variants = counter
         self.dataset_version.save()
-        if self.counter['variants'] != None:
-            last_progress = self._update_progress_bar(counter, self.counter['variants'], last_progress, finished=True)
+        if self.counter['variants'] is not None:
+            last_progress = self._update_progress_bar(counter,
+                                                      self.counter['variants'],
+                                                      last_progress,
+                                                      finished=True)
 
         self.log_insertion(counter, "variant", start)
 
@@ -449,7 +514,8 @@ def get_callcount(self, data):
         if data['chrom'] == self.chrom and data['pos'] < self.lastpos:
             # If this position is smaller than the last, the file order might be invalid.
             # Give a warning, but keep on counting.
-            msg = "VCF file not ok, variants not given in incremental order. Callcount may not be valid!!!\n\n"
+            msg = ("VCF file not ok, variants not given in incremental order." +
+                   "Callcount may not be valid!\n\n")
             logging.warning(msg)
 
         if data['chrom'] != self.chrom or data['pos'] != self.lastpos:
@@ -476,7 +542,7 @@ def count_entries(self):
                     if line.startswith("#"):
                         continue
                     self.counter['coverage'] += 1
-            logging.info("Found {:,} coverage lines".format(self.counter['coverage']))
+            logging.info(f"Found {self.counter['coverage']:,} coverage lines")
 
         if self.settings.variant_file:
             self.counter['variants'] = 0
@@ -496,11 +562,12 @@ def prepare_data(self):
         self._select_dataset_version()
 
     def start_import(self):
+        """Start importing data"""
         self._set_dataset_info()
         if self.settings.add_mates:
             self._parse_manta()
             if self.settings.count_calls:
-                logging.warning('Do not know how to count calls in the manta file. Skipping this...')
+                logging.warning('Cannot count calls in the manta file. Skipping this...')
         elif self.settings.variant_file:
             self._insert_variants()
             if self.settings.count_calls:
@@ -511,20 +578,27 @@ def start_import(self):
     def add_variant_genes(self, variant_indexes: list, genes_to_add: list, ref_genes: dict):
         batch = []
         for i in range(len(variant_indexes)):
-            connected_genes = [{'variant':variant_indexes[i], 'gene':ref_genes[gene]} for gene in genes_to_add[i] if gene]
+            connected_genes = [{'variant':variant_indexes[i], 'gene':ref_genes[gene]}
+                               for gene in genes_to_add[i]
+                               if gene]
             batch += connected_genes
         if not self.settings.dry_run:
             db.VariantGenes.insert_many(batch).execute()
 
-    def add_variant_transcripts(self, variant_indexes: list, transcripts_to_add: list, ref_transcripts: dict):
+    def add_variant_transcripts(self, variant_indexes: list,
+                                transcripts_to_add: list, ref_transcripts: dict):
         batch = []
         for i in range(len(variant_indexes)):
-            connected_transcripts = [{'variant':variant_indexes[i], 'transcript':ref_transcripts[transcript]}
+            connected_transcripts = [{'variant':variant_indexes[i],
+                                      'transcript':ref_transcripts[transcript]}
                                      for transcript in transcripts_to_add[i]]
             batch += connected_transcripts
         if not self.settings.dry_run:
             db.VariantTranscripts.insert_many(batch).execute()
 
-    def log_insertion(self, counter, type, start):
+    def log_insertion(self, counter, insertion_type, start):
         action = "Inserted" if not self.settings.dry_run else "Dry-ran insertion of"
-        logging.info("{} {} {} records in {}".format(action, counter, type, self._time_since(start)))
+        logging.info("{} {} {} records in {}".format(action,
+                                                     counter,
+                                                     insertion_type,
+                                                     self._time_since(start)))

From 2f968badb0ee732804abd3c8084d21130052a4d3 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 8 Aug 2019 09:26:30 +0200
Subject: [PATCH 036/126] A few style fixes for docstrings.

---
 .../data_importer/raw_data_importer.py        | 27 ++++++++++++-------
 1 file changed, 18 insertions(+), 9 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index bd30b007f..5eb92fd89 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -1,5 +1,5 @@
 #!/usr/bin/env python3
-"""Read data from a vcf file and add the variants to a database"""
+"""Read data from a vcf file and add the variants to a database."""
 
 import re
 import sys
@@ -24,8 +24,10 @@
 
 
 class RawDataImporter(DataImporter):
-    """Read data from a vcf file and add the variants to a database"""
+    """Read data from a vcf file and add the variants to a database."""
+
     def __init__(self, settings):
+        """Set the provided settings and prepare the main variables."""
         super().__init__(settings)
         self.dataset_version = None
         self.dataset = None
@@ -39,7 +41,7 @@ def __init__(self, settings):
         self.chrom = None
 
     def _set_dataset_info(self):
-        """Save dataset information given as parameters"""
+        """Save dataset information given as parameters."""
         if self.settings.beacon_description:
             self.dataset.description = self.settings.beacon_description
             self.dataset.save()
@@ -54,7 +56,7 @@ def _set_dataset_info(self):
             self.dataset.save()
 
     def _select_dataset_version(self):
-        """Select the dataset version to use"""
+        """Select the dataset version to use."""
         # Make sure that the dataset exists
         try:
             chosen_ds = db.Dataset.get(short_name=self.settings.dataset)
@@ -96,6 +98,8 @@ def _select_dataset_version(self):
 
     def _create_beacon_counts(self):
         """
+        Prepare counts for the beacon.
+
         Add the number of unique references at each position (callcount),
         the number of unique ref-alt pairs at each position (variantount)
         and the datasetid (eg GRCh37:swegen:2019-01-01)
@@ -119,6 +123,8 @@ def _create_beacon_counts(self):
 
     def _insert_coverage(self):
         """
+        Import coverage.
+
         Header columns are chromosome, position, mean coverage, median coverage,
         and then coverage under 1, 5 10, 15, 20, 25, 30, 50, 100.
         """
@@ -181,7 +187,7 @@ def _insert_coverage(self):
         self.log_insertion(counter, "coverage", start)
 
     def _parse_manta(self):
-        """Parse a manta file"""
+        """Parse a manta file."""
         header = [("chrom", str), ("pos", int), ("chrom_id", str), ("ref", str), ("alt", str)]
 
         batch = []
@@ -286,7 +292,7 @@ def _parse_manta(self):
         self.log_insertion(counter, "breakend", start)
 
     def _insert_variants(self):
-        """Insert variants from a VCF file"""
+        """Import variants from a VCF file."""
         logging.info("Inserting variants%s", " (dry run)" if self.settings.dry_run else "")
         header = [("chrom", str), ("pos", int), ("rsid", str), ("ref", str),
                   ("alt", str), ("site_quality", float), ("filter_string", str)]
@@ -531,7 +537,7 @@ def get_callcount(self, data):
         self.counter['tmp_calls'].add(data['ref'])
 
     def count_entries(self):
-        """Count the number of entries"""
+        """Count the number of entries."""
         start = time.time()
         if self.settings.coverage_file:
             self.counter['coverage'] = 0
@@ -558,11 +564,11 @@ def count_entries(self):
         logging.info("Counted input data lines in {} ".format(self._time_since(start)))
 
     def prepare_data(self):
-        """Prepare for inserting data into db"""
+        """Prepare for inserting data into db."""
         self._select_dataset_version()
 
     def start_import(self):
-        """Start importing data"""
+        """Start importing data."""
         self._set_dataset_info()
         if self.settings.add_mates:
             self._parse_manta()
@@ -576,6 +582,7 @@ def start_import(self):
             self._insert_coverage()
 
     def add_variant_genes(self, variant_indexes: list, genes_to_add: list, ref_genes: dict):
+        """Add genes associated with the provided variants."""
         batch = []
         for i in range(len(variant_indexes)):
             connected_genes = [{'variant':variant_indexes[i], 'gene':ref_genes[gene]}
@@ -587,6 +594,7 @@ def add_variant_genes(self, variant_indexes: list, genes_to_add: list, ref_genes
 
     def add_variant_transcripts(self, variant_indexes: list,
                                 transcripts_to_add: list, ref_transcripts: dict):
+        """Add genes associated with the provided variants."""
         batch = []
         for i in range(len(variant_indexes)):
             connected_transcripts = [{'variant':variant_indexes[i],
@@ -597,6 +605,7 @@ def add_variant_transcripts(self, variant_indexes: list,
             db.VariantTranscripts.insert_many(batch).execute()
 
     def log_insertion(self, counter, insertion_type, start):
+        """Log the progress of the import."""
         action = "Inserted" if not self.settings.dry_run else "Dry-ran insertion of"
         logging.info("{} {} {} records in {}".format(action,
                                                      counter,

From 1971c5530c700e71eaf7aaa8982adc3f50009e5c Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 8 Aug 2019 09:46:58 +0200
Subject: [PATCH 037/126] pylint fixes in reference_set_importer.

---
 .../data_importer/reference_set_importer.py   | 89 ++++++++++++-------
 1 file changed, 56 insertions(+), 33 deletions(-)

diff --git a/scripts/importer/data_importer/reference_set_importer.py b/scripts/importer/data_importer/reference_set_importer.py
index 66a9bed1f..ca3ba34aa 100644
--- a/scripts/importer/data_importer/reference_set_importer.py
+++ b/scripts/importer/data_importer/reference_set_importer.py
@@ -1,4 +1,5 @@
 #!/usr/bin/env python3
+"""Import a reference set into db."""
 
 import os
 import re
@@ -7,16 +8,20 @@
 import shutil
 import logging
 import zipfile
-from peewee import IntegrityError, fn
+from peewee import fn
 import db
 from .data_importer import DataImporter
 
 class ReferenceSetImporter(DataImporter):
-    GENCODE = "ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_human/release_{a.gencode_version}/gencode.v{a.gencode_version}.annotation.gtf.gz"
+    """Import a reference set into db."""
+
+    GENCODE = ("ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_human/" +
+               "release_{a.gencode_version}/gencode.v{a.gencode_version}.annotation.gtf.gz")
     DBNSFP = "ftp://dbnsfp:dbnsfp@dbnsfp.softgenetics.com/dbNSFPv{a.dbnsfp_version}.zip"
     ENSEMBL = ("ensembldb.ensembl.org", "anonymous", "")
 
     def __init__(self, settings):
+        """Set the provided settings and prepare variables."""
         super().__init__(settings)
 
         # counters for statistics and progress
@@ -27,7 +32,7 @@ def __init__(self, settings):
                          'transcripts': 0,
                          'features': 0}
 
-        # dictionaries to hold data while processing
+        # lists to hold data while processing
         self.genes = []
         self.transcripts = []
         self.features = []
@@ -37,7 +42,18 @@ def __init__(self, settings):
         self.dbnsfp = None
         self.ensembl = None
 
+        # database ids for genes, transcripts
+        self.gene_db_ids = {}
+        self.transcript_db_ids = {}
+
+        self.db_reference = db.ReferenceSet(name=self.settings.ref_name,
+                                            reference_build=self.settings.assembly_id,
+                                            ensembl_version=self.settings.ensembl_version,
+                                            gencode_version=self.settings.gencode_version,
+                                            dbnsfp_version=self.settings.dbnsfp_version)
+
     def _insert_features(self):
+        """Insert gene features (e.g. intron) into db."""
         logging.info("Inserting features into database")
         start = time.time()
         last_progress = -1
@@ -61,14 +77,15 @@ def _insert_features(self):
             if batch:
                 if not self.settings.dry_run:
                     db.Feature.insert_many(batch).execute()
-        last_progress = self._update_progress_bar(i, len(self.features), last_progress, finished=True)
+        last_progress = self._update_progress_bar(i, len(self.features),
+                                                  last_progress, finished=True)
 
         logging.info("Features inserted in {}".format(self._time_since(start)))
 
     def _insert_genes(self):
+        """Insert gene intformation into db."""
         logging.info("Inserting genes into database")
         start = time.time()
-        self.gene_db_ids = {}
         last_progress = -1
         for i, gene in enumerate(self.genes):
             # As far as I know I can't batch insert these and still get the id's back
@@ -98,15 +115,11 @@ def _insert_genes(self):
             last_progress = self._update_progress_bar(i, len(self.genes), last_progress)
         last_progress = self._update_progress_bar(i, len(self.genes), last_progress, finished=True)
 
-        logging.info("Genes inserted in {}".format(self._time_since(start)))
+        logging.info(f"Genes inserted in {self._time_since(start)}")
 
     def _insert_reference(self):
+        """Insert information (header) about the references into db."""
         logging.info("inserting reference header")
-        self.db_reference = db.ReferenceSet(name=self.settings.ref_name,
-                                            reference_build=self.settings.assembly_id,
-                                            ensembl_version=self.settings.ensembl_version,
-                                            gencode_version=self.settings.gencode_version,
-                                            dbnsfp_version=self.settings.dbnsfp_version)
 
         if self.settings.dry_run:
             max_id = db.ReferenceSet.select(fn.Max(db.ReferenceSet.id)).get()
@@ -119,10 +132,10 @@ def _insert_reference(self):
         logging.info("Reference %s created", self.db_reference.id)
 
     def _insert_transcripts(self):
+        """Insert trabscripts into db."""
         logging.info("Inserting transcripts into database")
         start = time.time()
 
-        self.transcript_db_ids = {}
         last_progress = -1
         for i, transcript in enumerate(self.transcripts):
             db_transcript = db.Transcript(transcript_id=transcript['transcript_id'],
@@ -141,13 +154,14 @@ def _insert_transcripts(self):
                 self.transcript_db_ids[transcript['transcript_id']] = db_transcript.id
 
             last_progress = self._update_progress_bar(i, len(self.transcripts), last_progress)
-        last_progress = self._update_progress_bar(i, len(self.transcripts), last_progress, finished=True)
+        last_progress = self._update_progress_bar(i, len(self.transcripts),
+                                                  last_progress, finished=True)
 
         logging.info("Transcripts inserted in {}".format(self._time_since(start)))
 
     def _open_dbnsfp(self):
         """
-        Downloads (if needed) and opens the given dbNSFP file.
+        Download (if needed) and open the given dbNSFP file.
 
         Only a small part, 'dbNSFP2.9_gene' of the ~13Gb file is needed, but in
         order to get it we have to download the entire file, extract the part
@@ -156,7 +170,7 @@ def _open_dbnsfp(self):
         logging.info("----- Opening dbNSFP file -----")
         url = ReferenceSetImporter.DBNSFP.format(a=self.settings)
         filename = url.split("/")[-1]
-        match = re.match("^\d+.\d+", self.settings.dbnsfp_version)
+        match = re.match(r"^\d+.\d+", self.settings.dbnsfp_version)
         if match:
             dbnsfp_gene_version = match.group(0)
         else:
@@ -186,16 +200,12 @@ def _open_dbnsfp(self):
         self.dbnsfp = self._open(dbnsfp_gzip)
 
     def _open_ensembl(self):
-        """
-        Connects to the given ensembl database.
-        """
+        """Connect to the given ensembl database."""
         logging.info("----- Opening ensembl database connection -----")
         self.ensembl = self._connect(*(ReferenceSetImporter.ENSEMBL + (self.settings.ensembl_version,)))
 
     def _open_gencode(self):
-        """
-        Downloads (if needed) and opens the given gencode file
-        """
+        """Download (if needed) and opens the given gencode file."""
         logging.info("----- Opening gencode file -----")
         url = ReferenceSetImporter.GENCODE.format(a=self.settings)
         filename = url.split("/")[-1]
@@ -206,6 +216,7 @@ def _open_gencode(self):
             self.gencode = self._download_and_open(url)
 
     def _read_dbnsfp(self):
+        """Read dbNSFP data."""
         start = time.time()
         header = None
         logging.info("Adding dbNSFP annotation")
@@ -237,9 +248,7 @@ def _read_dbnsfp(self):
         logging.info("dbNSFP information added in {}.".format(self._time_since(start)))
 
     def _read_ensembl(self):
-        """
-        Reads the ensembl information into the gene dictionary
-        """
+        """Read the ensembl information into the gene dictionary."""
         query = """SELECT g.stable_id,
                           t.stable_id
                      FROM gene g
@@ -260,13 +269,16 @@ def _read_ensembl(self):
                 self.genes[i]['canonical_transcript'] = canonical_dict[gene['gene_id']]
 
             self.counters['genes'] += 1
-            if self.numbers['genes'] != None:
+            if self.numbers['genes'] is not None:
                 last_progress = self._update_progress_bar(i, self.numbers['genes'], last_progress)
-        if self.numbers['genes'] != None:
-            last_progress = self._update_progress_bar(i, self.numbers['genes'], last_progress, finished=True)
-        logging.info("Canonical transcript information from ensembl added in {}.".format(self._time_since(start)))
+        if self.numbers['genes'] is not None:
+            last_progress = self._update_progress_bar(i, self.numbers['genes'],
+                                                      last_progress, finished=True)
+        logging.info("Canonical transcript information from ensembl " +
+                     f"added in {self._time_since(start)}.")
 
     def count_entries(self):
+        """Count the number of entries."""
         logging.info("Counting features in gencode file (for progress bar)")
         start = time.time()
         self.numbers['genes'] = 0
@@ -292,18 +304,21 @@ def count_entries(self):
 
         self.gencode.rewind()
 
-        pad = max([len("{:,}".format(self.numbers[t])) for t in ["genes", "transcripts", "features"]])
+        pad = max([len("{:,}".format(self.numbers[t]))
+                   for t in ["genes", "transcripts", "features"]])
         logging.info("Parsed file in {:3.1f}s".format(time.time()-start))
         logging.info("Genes      : {0:>{pad},}".format(self.numbers['genes'], pad=pad))
         logging.info("Transcripts: {0:>{pad},}".format(self.numbers['transcripts'], pad=pad))
         logging.info("Features   : {0:>{pad},}".format(self.numbers['features'], pad=pad))
 
     def prepare_data(self):
+        """Prepare for import of data."""
         self._open_gencode()
         self._open_dbnsfp()
         self._open_ensembl()
 
     def start_import(self):
+        """Start the data import."""
         start = time.time()
         logging.info("Reading gencode data into buffers.")
         last_progress = -1.0
@@ -328,7 +343,9 @@ def start_import(self):
 
                 # only progress for genes to keep it simple
                 if self.numbers['genes'] is not None:
-                    last_progress = self._update_progress_bar(self.counters['genes'], self.numbers['genes'], last_progress)
+                    last_progress = self._update_progress_bar(self.counters['genes'],
+                                                              self.numbers['genes'],
+                                                              last_progress)
                 if values[2] == 'gene':
                     data['name'] = info['gene_name']
                     self.genes += [data]
@@ -351,7 +368,10 @@ def start_import(self):
                 logging.error("{}".format(error))
                 break
         if self.numbers['genes'] is not None:
-            last_progress = self._update_progress_bar(self.counters['genes'], self.numbers['genes'], last_progress, finished=True)
+            last_progress = self._update_progress_bar(self.counters['genes'],
+                                                      self.numbers['genes'],
+                                                      last_progress,
+                                                      finished=True)
         logging.info("Gencode data read into buffers in {}.".format(self._time_since(start)))
         self._read_ensembl()
         self._read_dbnsfp()
@@ -360,9 +380,12 @@ def start_import(self):
         self._insert_transcripts()
         self._insert_features()
 
-    def add_other_names(self, gene_dbid:int, other_names:list):
+    def add_other_names(self, gene_dbid: int, other_names: list):
+        """Add alternative names for the gene."""
         if not gene_dbid or not other_names:
             return
-        batch = [{'gene':gene_dbid, 'name':other_name} for other_name in other_names if other_name != '.' and other_name]
+        batch = [{'gene':gene_dbid, 'name':other_name}
+                 for other_name in other_names
+                 if other_name != '.' and other_name]
         if not self.settings.dry_run and batch:
             db.GeneOtherNames.insert_many(batch).execute()

From 51825e6b4b2d3ed5b51c10898da9bacdb4b9f7fb Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 8 Aug 2019 12:50:43 +0200
Subject: [PATCH 038/126] Remove old importer from system.

---
 scripts/importer/data_importer/old_db.py      | 303 ------------
 .../importer/data_importer/old_db_importer.py | 447 ------------------
 scripts/importer/importer.py                  |   9 -
 3 files changed, 759 deletions(-)
 delete mode 100644 scripts/importer/data_importer/old_db.py
 delete mode 100644 scripts/importer/data_importer/old_db_importer.py

diff --git a/scripts/importer/data_importer/old_db.py b/scripts/importer/data_importer/old_db.py
deleted file mode 100644
index 7decaf19d..000000000
--- a/scripts/importer/data_importer/old_db.py
+++ /dev/null
@@ -1,303 +0,0 @@
-from peewee import (
-        BlobField,
-        CharField,
-        DateTimeField,
-        Field,
-        FloatField,
-        ForeignKeyField,
-        IntegerField,
-        Model,
-        MySQLDatabase,
-        PrimaryKeyField,
-        TextField,
-        fn,
-    )
-import settings
-
-mysql_database = MySQLDatabase(
-        settings.mysql_schema,
-        host=settings.mysql_host,
-        user=settings.mysql_user,
-        password=settings.mysql_passwd,
-        port=settings.mysql_port
-    )
-
-
-class MySQLModel(Model):
-    class Meta:
-        database = mysql_database
-
-
-class EnumField(Field):
-    db_field = 'string' # The same as for CharField
-
-    def __init__(self, values=None, *args, **kwargs):
-        self.values = values or []
-        super().__init__(*args, **kwargs)
-
-    def db_value(self, value):
-        if value not in self.values:
-            raise ValueError("Illegal value for '{}'".format(self.db_column))
-        return value
-
-    def python_value(self, value):
-        if value not in self.values:
-            raise ValueError("Illegal value for '{}'".format(self.db_column))
-        return value
-
-
-class User(MySQLModel):
-    user          = PrimaryKeyField(db_column='user_pk')
-    name          = CharField(null=True)
-    email         = CharField(unique=True)
-    identity      = CharField(unique=True)
-    identity_type = EnumField(null=False, values=['google', 'elixir'])
-    affiliation   = CharField(null=True)
-    country       = CharField(null=True)
-
-    def is_admin(self, dataset):
-        return (DatasetAccess.select()
-                .where(DatasetAccess.dataset == dataset,
-                       DatasetAccess.user == self,
-                       DatasetAccess.is_admin)
-                .count())
-
-    def has_access(self, dataset):
-        return DatasetAccessCurrent.select().where(
-                DatasetAccessCurrent.dataset == dataset,
-                DatasetAccessCurrent.user    == self,
-            ).count()
-
-    def has_requested_access(self, dataset):
-        return DatasetAccessPending.select().where(
-                DatasetAccessPending.dataset == dataset,
-                DatasetAccessPending.user    == self
-            ).count()
-
-    class Meta:
-        db_table = 'user'
-
-
-class Study(MySQLModel):
-    study            = PrimaryKeyField(db_column='study_pk')
-    pi_name          = CharField()
-    pi_email         = CharField()
-    contact_name     = CharField()
-    contact_email    = CharField()
-    title            = CharField()
-    description      = TextField(null=True)
-    publication_date = DateTimeField()
-    ref_doi          = CharField(null=True)
-
-    class Meta:
-        db_table = 'study'
-
-
-class Dataset(MySQLModel):
-    dataset            = PrimaryKeyField(db_column='dataset_pk')
-    study              = ForeignKeyField(Study, db_column='study_pk', to_field='study', related_name='datasets')
-    short_name         = CharField()
-    full_name          = CharField()
-    browser_uri        = CharField(null=True)
-    beacon_uri         = CharField(null=True)
-    avg_seq_depth      = FloatField(null=True)
-    seq_type           = CharField(null=True)
-    seq_tech           = CharField(null=True)
-    seq_center         = CharField(null=True)
-    dataset_size       = IntegerField()
-    mongodb_collection = CharField(null=False)
-
-    def has_image(self):
-        try:
-            DatasetLogo.get(DatasetLogo.dataset == self)
-            return True
-        except DatasetLogo.DoesNotExist:
-            return False
-
-    class Meta:
-        db_table = 'dataset'
-
-
-class DatasetVersion(MySQLModel):
-    dataset_version   = PrimaryKeyField(db_column='dataset_version_pk')
-    dataset           = ForeignKeyField(Dataset, db_column='dataset_pk', to_field='dataset', related_name='versions')
-    version           = CharField()
-    description       = TextField()
-    terms             = TextField()
-    var_call_ref      = CharField(null=True)
-    available_from    = DateTimeField()
-    ref_doi           = CharField(null=True)
-    data_contact_name = CharField(null=True)
-    data_contact_link = CharField(null=True)
-
-    class Meta:
-        db_table = 'dataset_version'
-
-
-class Collection(MySQLModel):
-    collection = PrimaryKeyField(db_column = 'collection_pk')
-    name       = CharField(null = True)
-    ethnicity  = CharField(null = True)
-
-    class Meta:
-        db_table = 'collection'
-
-
-class SampleSet(MySQLModel):
-    sample_set  = PrimaryKeyField(db_column='sample_set_pk')
-    dataset     = ForeignKeyField(Dataset, db_column='dataset_pk', to_field='dataset', related_name='sample_sets')
-    collection  = ForeignKeyField(Collection, db_column='collection_pk', to_field='collection', related_name='sample_sets')
-    sample_size = IntegerField()
-    phenotype   = CharField(null=True)
-
-    class Meta:
-        db_table = 'sample_set'
-
-
-class DatasetFile(MySQLModel):
-    dataset_file    = PrimaryKeyField(db_column='dataset_file_pk')
-    dataset_version = ForeignKeyField(DatasetVersion, db_column='dataset_version_pk', to_field='dataset_version', related_name='files')
-    name            = CharField()
-    uri             = CharField()
-    bytes           = IntegerField()
-
-    class Meta:
-        db_table = 'dataset_file'
-
-
-class UserAccessLog(MySQLModel):
-    user_access_log = PrimaryKeyField(db_column='user_access_log_pk')
-    user            = ForeignKeyField(User, db_column='user_pk', to_field='user', related_name='access_logs')
-    dataset         = ForeignKeyField(Dataset, db_column='dataset_pk', to_field='dataset', related_name='access_logs')
-    action          = EnumField(null=True, values=['access_requested','access_granted','access_revoked','private_link'])
-    ts              = DateTimeField()
-
-    class Meta:
-        db_table = 'user_access_log'
-
-
-class UserConsentLog(MySQLModel):
-    user_consent_log = PrimaryKeyField(db_column='user_consent_log_pk')
-    user             = ForeignKeyField(User, db_column='user_pk', to_field='user', related_name='consent_logs')
-    dataset_version  = ForeignKeyField(DatasetVersion, db_column='dataset_version_pk', to_field='dataset_version', related_name='consent_logs')
-    ts               = DateTimeField()
-
-    class Meta:
-        db_table = 'user_consent_log'
-
-
-class UserDownloadLog(MySQLModel):
-    user_download_log = PrimaryKeyField(db_column='user_download_log_pk')
-    user              = ForeignKeyField(User, db_column='user_pk', to_field='user', related_name='download_logs')
-    dataset_file      = ForeignKeyField(DatasetFile, db_column='dataset_file_pk', to_field='dataset_file', related_name='download_logs')
-    ts                = DateTimeField()
-
-    class Meta:
-        db_table = 'user_download_log'
-
-
-class DatasetAccess(MySQLModel):
-    dataset_access   = PrimaryKeyField(db_column='dataset_access_pk')
-    dataset          = ForeignKeyField(Dataset, db_column='dataset_pk', to_field='dataset', related_name='access')
-    user             = ForeignKeyField(User, db_column='user_pk', to_field='user', related_name='access')
-    wants_newsletter = IntegerField(null=True)
-    is_admin         = IntegerField(null=True)
-
-    class Meta:
-        db_table = 'dataset_access'
-
-
-class DatasetAccessCurrent(DatasetAccess):
-    dataset          = ForeignKeyField(Dataset, db_column='dataset_pk', to_field='dataset', related_name='access_current')
-    user             = ForeignKeyField(User, db_column='user_pk', to_field='user', related_name='access_current')
-    has_access       = IntegerField()
-    access_requested = DateTimeField()
-
-    class Meta:
-        db_table = 'dataset_access_current'
-
-
-class DatasetAccessPending(DatasetAccess):
-    dataset          = ForeignKeyField(Dataset, db_column='dataset_pk', to_field='dataset', related_name='access_pending')
-    user             = ForeignKeyField(User, db_column='user_pk', to_field='user', related_name='access_pending')
-    has_access       = IntegerField()
-    access_requested = DateTimeField()
-
-    class Meta:
-        db_table = 'dataset_access_pending'
-
-
-class DatasetLogo(MySQLModel):
-    dataset_logo = PrimaryKeyField(db_column='dataset_logo_pk')
-    dataset      = ForeignKeyField(Dataset, db_column='dataset_pk', to_field='dataset', related_name='logo')
-    mimetype     = CharField()
-    data         = BlobField()
-
-    class Meta:
-        db_table = 'dataset_logo'
-
-
-class Linkhash(MySQLModel):
-    linkhash        = PrimaryKeyField(db_column='linkhash_pk')
-    dataset_version = ForeignKeyField(DatasetVersion, db_column='dataset_version_pk', to_field='dataset_version', related_name='link_hashes')
-    user            = ForeignKeyField(User, db_column='user_pk', to_field='user', related_name='link_hashes')
-    hash            = CharField()
-    expires_on      = DateTimeField()
-
-    class Meta:
-        db_table = 'linkhash'
-
-
-class DatasetVersionCurrent(DatasetVersion):
-    dataset = ForeignKeyField(Dataset, db_column='dataset_pk', to_field='dataset', related_name='current_version')
-
-    class Meta:
-        db_table = 'dataset_version_current'
-
-
-class SFTPUser(MySQLModel):
-    sftp_user     = PrimaryKeyField(db_column='sftp_user_pk')
-    user          = ForeignKeyField(User, db_column='user_pk', to_field='user', related_name='sftp_user')
-    user_uid      = IntegerField(unique=True)
-    user_name     = CharField(null=False)
-    password_hash = CharField(null=False)
-    account_expires = DateTimeField(null=False)
-
-    class Meta:
-        db_table = 'sftp_user'
-
-
-def get_next_free_uid():
-    """
-    Returns the next free uid >= 10000, and higher than the current uid's
-    from the sftp_user table in the database.
-    """
-    default = 10000
-    next_uid = default
-    try:
-        current_max_uid = SFTPUser.select(fn.MAX(SFTPUser.user_uid)).get().user_uid
-        if current_max_uid:
-            next_uid = current_max_uid+1
-    except SFTPUser.DoesNotExist:
-        pass
-
-    return next_uid
-
-
-def get_admin_datasets(user):
-    return DatasetAccess.select().where( DatasetAccess.user == user, DatasetAccess.is_admin)
-
-
-def get_dataset(dataset):
-    dataset = Dataset.select().where( Dataset.short_name == dataset).get()
-    return dataset
-
-
-def build_dict_from_row(row):
-    d = {}
-    for field in row._meta.sorted_fields: #pylint: disable=protected-access
-        column = field.db_column
-        if column.endswith("_pk"):
-            continue
-        d[column] = getattr(row, column)
-    return d
diff --git a/scripts/importer/data_importer/old_db_importer.py b/scripts/importer/data_importer/old_db_importer.py
deleted file mode 100644
index a1beb077c..000000000
--- a/scripts/importer/data_importer/old_db_importer.py
+++ /dev/null
@@ -1,447 +0,0 @@
-#!/usr/bin/env python3
-
-import sys
-import time
-import logging
-import db
-from peewee import OperationalError, InterfaceError
-from . import old_db
-
-from .data_importer import DataImporter
-
-class OldDbImporter( DataImporter ):
-
-    def __init__(self, settings):
-        super().__init__(settings)
-        self.reference_sets = []
-        self.id_map = {'collection':{},
-                       'study':{},
-                       'dataset':{},
-                       'dataset_version':{},
-                       'dataset_file':{},
-                       'user':{}
-                       }
-
-    def _select_reference_set(self, short_name):
-        if len(self.reference_sets) == 1:
-            logging.info(("Only one reference set is available, %s, "
-                          "will default to this set for all datasets"),
-                         self.reference_sets[0].name)
-            return self.reference_sets[0].id
-        elif short_name.lower() in [r.name.lower() for r in self.reference_sets]:
-            refset = [r for r in self.reference_sets if r.name.lower() == short_name.lower()][0]
-            logging.info("Auto-selecting reference set '%s' based on name.", refset.name)
-            return refset
-        else:
-            print("Select a reference set to use with this dataset")
-            retval = -1
-            while retval not in [r.id for r in self.reference_sets]:
-                for reference_set in self.reference_sets:
-                    print("  {}  : {}".format(reference_set.id, reference_set.name))
-                try:
-                    retval = int(input("Please select a reference: "))
-                except ValueError:
-                    print("Please select a number in {}".format([r.id for r in self.reference_sets]))
-            return retval
-
-    def _move_collections(self):
-        logging.info("Moving Collections")
-        for collection in old_db.Collection.select():
-            logging.info(" - Moving '{}'".format(collection.name))
-
-            try:
-                new_id = db.Collection.get(name = collection.name,
-                                           ethnicity = collection.ethnicity).id
-            except db.Collection.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                new_id = (db.Collection
-                            .insert(name = collection.name,
-                                    ethnicity = collection.ethnicity)
-                            .execute())
-
-            self.id_map['collection'][collection.collection] = new_id
-
-    def _move_studies(self):
-        logging.info("Moving Studies")
-        for study in old_db.Study.select():
-            logging.info(" - Moving '{}'".format(study.title))
-
-            try:
-                new_id = db.Study.get(pi_name          = study.pi_name,
-                                      pi_email         = study.pi_email,
-                                      contact_name     = study.contact_name,
-                                      contact_email    = study.contact_email,
-                                      title            = study.title,
-                                      description      = study.description,
-                                      publication_date = study.publication_date,
-                                      ref_doi          = study.ref_doi).id
-            except db.Study.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                new_id = (db.Study
-                            .insert(pi_name          = study.pi_name,
-                                    pi_email         = study.pi_email,
-                                    contact_name     = study.contact_name,
-                                    contact_email    = study.contact_email,
-                                    title            = study.title,
-                                    description      = study.description,
-                                    publication_date = study.publication_date,
-                                    ref_doi          = study.ref_doi)
-                            .execute())
-
-            self.id_map['study'][study.study] = new_id
-
-    def _move_datasets(self):
-        logging.info("Moving Datasets")
-        for dataset in old_db.Dataset.select():
-            logging.info(" - Moving '{}'".format(dataset.short_name))
-            try:
-                study_ref_id = self.id_map['study'][dataset.study.study]
-            except KeyError:
-                if not self.settings.dry_run:
-                    raise
-                study_ref_id = -1
-            try:
-                # short_name is unique, so we only really need to check that.
-                new_id = db.Dataset.get(study         = study_ref_id,
-                                        short_name    = dataset.short_name).id
-            except db.Dataset.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                new_id = (db.Dataset
-                            .insert(study         = study_ref_id,
-                                    short_name    = dataset.short_name,
-                                    full_name     = dataset.full_name,
-                                    browser_uri   = dataset.browser_uri,
-                                    beacon_uri    = dataset.beacon_uri,
-                                    avg_seq_depth = dataset.avg_seq_depth,
-                                    seq_type      = dataset.seq_type,
-                                    seq_tech      = dataset.seq_tech,
-                                    seq_center    = dataset.seq_center,
-                                    dataset_size  = dataset.dataset_size)
-                            .execute())
-
-            self.id_map['dataset'][dataset.dataset] = new_id
-
-    def _move_dataset_logos(self):
-        logging.info("Moving Dataset Logos")
-        for dataset_file in old_db.DatasetLogo.select():
-            try:
-                dataset_ref_id = self.id_map['dataset'][dataset_file.dataset.dataset]
-            except KeyError:
-                if not self.settings.dry_run:
-                    raise
-                dataset_ref_id = -1
-            try:
-                db.DatasetLogo.get(dataset  = dataset_ref_id,
-                                   mimetype = dataset_file.mimetype,
-                                   data     = dataset_file.data)
-            except db.DatasetLogo.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                db.DatasetLogo.insert(dataset  = dataset_ref_id,
-                                      mimetype = dataset_file.mimetype,
-                                      data     = dataset_file.data).execute()
-
-    def _move_dataset_versions(self):
-        logging.info("Moving Dataset Versions")
-        for dataset_version in old_db.DatasetVersion.select():
-            try:
-                dataset_ref_id = self.id_map['dataset'][dataset_version.dataset.dataset]
-                dataset = db.Dataset.get(id = dataset_ref_id)
-            except KeyError:
-                if not self.settings.dry_run:
-                    raise
-                dataset_ref_id = -1
-            try:
-                new_id = db.DatasetVersion.get(dataset           = dataset_ref_id,
-                                               version           = dataset_version.version,
-                                               description       = dataset_version.description,
-                                               terms             = dataset_version.terms,
-                                               var_call_ref      = dataset_version.var_call_ref,
-                                               available_from    = dataset_version.available_from,
-                                               ref_doi           = dataset_version.ref_doi,
-                                               data_contact_name = dataset_version.data_contact_name,
-                                               data_contact_link = dataset_version.data_contact_link).id
-            except db.DatasetVersion.DoesNotExist:
-                target_reference_id = self._select_reference_set(dataset.short_name)
-                if self.settings.dry_run:
-                    continue
-                new_id = (db.DatasetVersion
-                            .insert(dataset           = dataset_ref_id,
-                                    reference_set     = target_reference_id,
-                                    version           = dataset_version.version,
-                                    description       = dataset_version.description,
-                                    terms             = dataset_version.terms,
-                                    var_call_ref      = dataset_version.var_call_ref,
-                                    available_from    = dataset_version.available_from,
-                                    ref_doi           = dataset_version.ref_doi,
-                                    data_contact_name = dataset_version.data_contact_name,
-                                    data_contact_link = dataset_version.data_contact_link,
-                                    coverage_levels   = [1,5,10,15,20,25,30,50,100]
-                                    )
-                            .execute())
-
-            self.id_map['dataset_version'][dataset_version.dataset_version] = new_id
-
-    def _move_dataset_files(self):
-        logging.info("Moving Dataset Files")
-        for dataset_file in old_db.DatasetFile.select():
-            logging.info(" - Moving '{}'".format(dataset_file.name))
-            try:
-                dataset_version_ref_id = self.id_map['dataset_version'][dataset_file.dataset_version.dataset_version]
-            except KeyError:
-                if not self.settings.dry_run:
-                    raise
-                dataset_version_ref_id = -1
-            try:
-                new_id = db.DatasetFile.get(dataset_version = dataset_version_ref_id,
-                                            name            = dataset_file.name,
-                                            uri             = dataset_file.uri,
-                                            file_size       = dataset_file.bytes).id
-            except db.DatasetFile.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                new_id = (db.DatasetFile
-                            .insert(dataset_version = dataset_version_ref_id,
-                                    name            = dataset_file.name,
-                                    uri             = dataset_file.uri,
-                                    file_size       = dataset_file.bytes).execute())
-
-            self.id_map['dataset_file'][dataset_file.dataset_file] = new_id
-
-    def _move_sample_sets(self):
-        logging.info("Moving Sample Sets")
-        for sample_set in old_db.SampleSet.select():
-            try:
-                dataset_ref_id = self.id_map['dataset'][sample_set.dataset.dataset]
-                collection_ref_id = self.id_map['collection'][sample_set.collection.collection]
-            except KeyError:
-                if not self.settings.dry_run:
-                    raise
-                dataset_ref_id = -1
-                collection_ref_id = -1
-            try:
-                db.SampleSet.get(dataset     = dataset_ref_id,
-                                 collection  = collection_ref_id,
-                                 sample_size = sample_set.sample_size,
-                                 phenotype   = sample_set.phenotype)
-            except db.SampleSet.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                db.SampleSet.insert(dataset     = dataset_ref_id,
-                                    collection  = collection_ref_id,
-                                    sample_size = sample_set.sample_size,
-                                    phenotype   = sample_set.phenotype).execute()
-
-    def _move_database(self):
-        self._move_collections()
-        self._move_studies()
-        self._move_datasets()
-        self._move_dataset_logos()
-        self._move_dataset_versions()
-        self._move_sample_sets()
-        self._move_dataset_files()
-
-    def _move_users(self):
-        logging.info("Moving Users")
-        for user in old_db.User.select():
-            try:
-                new_id = (db.User
-                            .get(name          = user.name,
-                                 email         = user.email,
-                                 identity      = user.identity,
-                                 identity_type = user.identity_type,
-                                 affiliation   = user.affiliation,
-                                 country       = user.country).id)
-            except db.User.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                new_id = (db.User
-                            .insert(name          = user.name,
-                                    email         = user.email,
-                                    identity      = user.identity,
-                                    identity_type = user.identity_type,
-                                    affiliation   = user.affiliation,
-                                    country       = user.country).execute())
-
-            self.id_map['user'][user.user] = new_id
-
-    def _move_sftp_users(self):
-        logging.info("Moving SFTP Users")
-        for user in old_db.SFTPUser.select():
-            try:
-                user_ref_id = self.id_map['user'][user.user.user]
-            except KeyError:
-                if not self.settings.dry_run:
-                    raise
-                user_ref_id = -1
-            try:
-                # user_uid is unique, so we rely on that
-                db.SFTPUser.get(user     = user_ref_id,
-                                 user_uid = user.user_uid)
-            except db.SFTPUser.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                db.SFTPUser.insert(user            = user_ref_id,
-                                    user_uid        = user.user_uid,
-                                    user_name       = user.user_name,
-                                    password_hash   = user.password_hash,
-                                    account_expires = user.account_expires).execute()
-
-    def _move_user_access_logs(self):
-        logging.info("Moving User Access Logs")
-        for log in old_db.UserAccessLog.select():
-            try:
-                user_ref_id = self.id_map['user'][log.user.user]
-                dataset_ref_id = self.id_map['dataset'][log.dataset.dataset]
-            except KeyError:
-                if not self.settings.dry_run:
-                    raise
-                user_ref_id = -1
-                dataset_ref_id = -1
-            try:
-                db.UserAccessLog.get(user    = user_ref_id,
-                                     dataset = dataset_ref_id,
-                                     action  = log.action,
-                                     ts      = log.ts)
-            except db.UserAccessLog.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                db.UserAccessLog.insert(user    = user_ref_id,
-                                        dataset = dataset_ref_id,
-                                        action  = log.action,
-                                        ts      = log.ts).execute()
-
-    def _move_user_consent_logs(self):
-        logging.info("Moving User Consent Logs")
-        for log in old_db.UserConsentLog.select():
-            try:
-                user_ref_id = self.id_map['user'][log.user.user]
-                version_ref_id = self.id_map['dataset_version'][log.dataset_version.dataset_version]
-            except KeyError:
-                if not self.settings.dry_run:
-                    raise
-                user_ref_id = -1
-                version_ref_id = -1
-            try:
-                db.UserConsentLog.get(user            = user_ref_id,
-                                     dataset_version = version_ref_id,
-                                     ts              = log.ts)
-            except db.UserConsentLog.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                db.UserConsentLog.insert(user            = user_ref_id,
-                                        dataset_version = version_ref_id,
-                                        ts              = log.ts).execute()
-
-    def _move_user_download_logs(self):
-        logging.info("Moving User Download Logs")
-        for log in old_db.UserDownloadLog.select():
-            try:
-                user_ref_id = self.id_map['user'][log.user.user]
-                file_ref_id = self.id_map['dataset_file'][log.dataset_file.dataset_file]
-            except KeyError:
-                if not self.settings.dry_run:
-                    raise
-                user_ref_id = -1
-                file_ref_id = -1
-            try:
-                db.UserDownloadLog.get(user         = user_ref_id,
-                                       dataset_file = file_ref_id,
-                                       ts           = log.ts)
-            except db.UserDownloadLog.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                db.UserDownloadLog.insert(user         = user_ref_id,
-                                          dataset_file = file_ref_id,
-                                          ts           = log.ts).execute()
-
-    def _move_dataset_access(self):
-        logging.info("Moving Dataset Access Records")
-        for access in old_db.DatasetAccess.select():
-            try:
-                user_ref_id = self.id_map['user'][access.user.user]
-                dataset_ref_id = self.id_map['dataset'][access.dataset.dataset]
-            except KeyError:
-                if not self.settings.dry_run:
-                    raise
-                user_ref_id = -1
-                dataset_ref_id = -1
-            try:
-                db.DatasetAccess.get(dataset          = dataset_ref_id,
-                                     user             = user_ref_id,
-                                     wants_newsletter = access.wants_newsletter,
-                                     is_admin         = access.is_admin)
-            except db.DatasetAccess.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                db.DatasetAccess.insert(dataset          = dataset_ref_id,
-                                        user             = user_ref_id,
-                                        wants_newsletter = access.wants_newsletter,
-                                        is_admin         = access.is_admin).execute()
-
-    def _move_linkhashes(self):
-        logging.info("Moving Linkhashes")
-        for linkhash in old_db.Linkhash.select():
-            try:
-                user_ref_id = self.id_map['user'][linkhash.user.user]
-                version_ref_id = self.id_map['dataset_version'][linkhash.dataset_version.dataset_version]
-            except KeyError:
-                if not self.settings.dry_run:
-                    raise
-                user_ref_id = -1
-                version_ref_id = -1
-            try:
-                db.Linkhash.get(dataset_version = version_ref_id,
-                                user            = user_ref_id,
-                                hash            = linkhash.hash,
-                                expires_on      = linkhash.expires_on)
-            except db.Linkhash.DoesNotExist:
-                if self.settings.dry_run:
-                    continue
-                db.Linkhash.insert(dataset_version = version_ref_id,
-                                   user            = user_ref_id,
-                                   hash            = linkhash.hash,
-                                   expires_on      = linkhash.expires_on).execute()
-
-    def _move_userbase(self):
-        self._move_users()
-        self._move_sftp_users()
-        self._move_user_access_logs()
-        self._move_user_consent_logs()
-        self._move_user_download_logs()
-        self._move_dataset_access()
-        self._move_linkhashes()
-
-    def prepare_data(self):
-        """
-        Connects to the old and new databases.
-        """
-        logging.info("Checking connection to old database")
-        try:
-            old_db.Collection.get()
-        except OperationalError:
-            logging.error("Could not connect to old database")
-            sys.exit(1)
-        logging.info("Checking connection to new database")
-        try:
-            db.ReferenceSet.get()
-            for reference_set in db.ReferenceSet.select():
-                self.reference_sets += [reference_set]
-        except db.ReferenceSet.DoesNotExist:
-            logging.error(("Connection works, but no reference sets are available."
-                           "use '--add_reference' to add a new reference set and"
-                           "Then use this tool again."))
-            sys.exit(1)
-        except (OperationalError, InterfaceError):
-            logging.error("Could not connect to new database")
-            sys.exit(1)
-
-    def start_import(self):
-        start = time.time()
-        self._move_database()
-        self._move_userbase()
-
-        logging.info("Moved data in {}".format(self._time_since(start)))
diff --git a/scripts/importer/importer.py b/scripts/importer/importer.py
index e489efae6..28717925b 100755
--- a/scripts/importer/importer.py
+++ b/scripts/importer/importer.py
@@ -12,7 +12,6 @@
 """
 
 from data_importer.reference_set_importer import ReferenceSetImporter
-from data_importer.old_db_importer import OldDbImporter
 from data_importer.raw_data_importer import RawDataImporter
 
 if __name__ == '__main__':
@@ -77,9 +76,6 @@
                         help="Insert new reference set.")
     PARSER.add_argument("--add_raw_data", action="store_true",
                         help="Adds a Coverage and Variants to the database.")
-    PARSER.add_argument("--move_studies", action="store_true",
-                        help=("Moves studies and datasets from an old database "
-                              "to a new one."))
     PARSER.add_argument("--dry_run", action="store_true",
                         help="Do not insert anything into the database")
 
@@ -121,11 +117,6 @@
             IMPORTER.count_entries()
         IMPORTER.start_import()
 
-    if ARGS.move_studies:
-        IMPORTER = OldDbImporter(ARGS)
-        IMPORTER.prepare_data()
-        IMPORTER.start_import()
-
     if ARGS.add_raw_data:
         logging.info("Adding raw data %s", "(dry run)" if ARGS.dry_run else '')
         IMPORTER = RawDataImporter(ARGS)

From 4c57295cb3a1e238fe0b4aa361d8531122826db5 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Mon, 12 Aug 2019 13:31:36 +0200
Subject: [PATCH 039/126] Check coverage for mates, reorder tests

---
 test/travis_script.sh | 21 +++++++++++----------
 1 file changed, 11 insertions(+), 10 deletions(-)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index 07f10c2c9..2bb053dca 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -153,18 +153,9 @@ diff sdump.psql ref.psql
 
 RETURN_VALUE=$((RETURN_VALUE + $?))
 
-echo '>>> Finalising: Combine coverage'
-
-coverage combine .coverage_pytest .coverage_server .coverage_import_1 .coverage_import_2 .coverage_import_3 .coverage_import_4
-
-if [ -f .coverage ]; then
-    coveralls
-    coverage report
-fi
-
 echo '>>> Test 6. Reading manta file'
 
-
+sed -i -e 's/import_4/mate_1/' scripts/manage.sh
 ./scripts/manage.sh import --add_raw_data \
                    --dataset "Dataset 1" \
                    --version "Version 1" \
@@ -177,4 +168,14 @@ psql -U postgres -h localhost -p 5435 postgres -c "select chrom_id, pos, ref, al
 diff mates_res.txt "$BASE/tests/data/mates_reference.txt"
 RETURN_VALUE=$((RETURN_VALUE + $?))
 
+
+echo '>>> Finalising: Combine coverage'
+
+coverage combine .coverage_pytest .coverage_server .coverage_import_1 .coverage_import_2 .coverage_import_3 .coverage_import_4 .coverage_mate_1
+
+if [ -f .coverage ]; then
+    coveralls
+    coverage report
+fi
+
 exit "$RETURN_VALUE"

From 02aa73ae54a51f237020d192987e7fe21b06005f Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Mon, 12 Aug 2019 13:33:24 +0200
Subject: [PATCH 040/126] Remove assembly_id from import call

---
 test/travis_script.sh | 1 -
 1 file changed, 1 deletion(-)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index 2bb053dca..074189495 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -160,7 +160,6 @@ sed -i -e 's/import_4/mate_1/' scripts/manage.sh
                    --dataset "Dataset 1" \
                    --version "Version 1" \
                    --add_mates \
-                   --assembly_id "GRCh37p13" \
                    --add_reversed_mates \
                    --variant_file "$BASE/tests/data/manta.vcf"
 

From 406b78fbf862eca72770d752ea6c9cd6d342e1b0 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Mon, 12 Aug 2019 13:30:09 +0200
Subject: [PATCH 041/126] Correct beacon reference counts and version name

---
 scripts/importer/tests/data/reference.psql | 5 ++---
 1 file changed, 2 insertions(+), 3 deletions(-)

diff --git a/scripts/importer/tests/data/reference.psql b/scripts/importer/tests/data/reference.psql
index a5aa3b87f..fbd062989 100644
--- a/scripts/importer/tests/data/reference.psql
+++ b/scripts/importer/tests/data/reference.psql
@@ -1,7 +1,6 @@
 COPY beacon.beacon_dataset_counts_table (datasetid, callcount, variantcount) FROM stdin;
-GRCh37p13:Dataset 1:2001-01-01 00:00:00	18	18
-GRCh37p13:Dataset 2:2001-01-01 00:00:00	12	15
-
+GRCh37p13:Dataset 1:Version 1	18	18
+GRCh37p13:Dataset 2:Version 1	12	17
 \.
 COPY data.collections (id, study_name, ethnicity) FROM stdin;
 1	reg	undefined

From a12b9f9ef5f46d6344a7d8b16484594f1e741516 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Mon, 12 Aug 2019 14:16:58 +0200
Subject: [PATCH 042/126] Use correct dataset id

---
 scripts/importer/tests/data/reference.psql | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/scripts/importer/tests/data/reference.psql b/scripts/importer/tests/data/reference.psql
index fbd062989..79cf7fd97 100644
--- a/scripts/importer/tests/data/reference.psql
+++ b/scripts/importer/tests/data/reference.psql
@@ -1,6 +1,6 @@
-COPY beacon.beacon_dataset_counts_table (datasetid, callcount, variantcount) FROM stdin;
-GRCh37p13:Dataset 1:Version 1	18	18
-GRCh37p13:Dataset 2:Version 1	12	17
+COPY beacon.beacon_dataset_counts_table (datasetid, dataset, callcount, variantcount) FROM stdin;
+GRCh37p13:Dataset 1:Version 1	\N	18	18
+GRCh37p13:Dataset 2:Version 1	\N	12	17
 \.
 COPY data.collections (id, study_name, ethnicity) FROM stdin;
 1	reg	undefined

From 3f2084c2ef344ce2f5724cb9072d436b869ca899 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Mon, 12 Aug 2019 14:39:40 +0200
Subject: [PATCH 043/126] Fix broken regex

---
 test/travis_script.sh | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index 074189495..987d7cce7 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -143,9 +143,9 @@ scripts/manage.sh import --add_raw_data \
 # make pg_dump
 # compare file to reference; must remove comments, empty rows and id column
 pg_dump -U postgres -h 127.0.0.1 -p 5433 "$DBNAME" -f dbdump.psql --data-only
-sed -i -r -e '/^--/d;/^$/d;s/[0-9]+[^I]//' dbdump.psql
+sed -i -r -e '/^--/d;/^$/d;s/^[0-9]+[^I]//' dbdump.psql
 grep -v -P "^SE[TL]" dbdump.psql | sort > sdump.psql
-sed -i -r -e 's/[0-9]+[^I]//' "$BASE/tests/data/reference.psql"
+sed -i -r -e 's/^[0-9]+[^I]//' "$BASE/tests/data/reference.psql"
 sort "$BASE/tests/data/reference.psql" > ref.psql
 
 # compare dump to reference

From f4e9803b01d13b5a8f0d15451d03397a7462b1ef Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Mon, 12 Aug 2019 15:16:11 +0200
Subject: [PATCH 044/126] Use correct psql port

---
 test/travis_script.sh | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index 987d7cce7..a6fb9e47d 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -163,7 +163,7 @@ sed -i -e 's/import_4/mate_1/' scripts/manage.sh
                    --add_reversed_mates \
                    --variant_file "$BASE/tests/data/manta.vcf"
 
-psql -U postgres -h localhost -p 5435 postgres -c "select chrom_id, pos, ref, alt, chrom, mate_chrom, mate_start, mate_id, allele_freq, variant_id, allele_count, allele_num from data.mates ;" > mates_res.txt
+psql -U postgres -h 127.0.0.1 -p 5433 "$DBNAME" -c "select chrom_id, pos, ref, alt, chrom, mate_chrom, mate_start, mate_id, allele_freq, variant_id, allele_count, allele_num from data.mates ;" > mates_res.txt
 diff mates_res.txt "$BASE/tests/data/mates_reference.txt"
 RETURN_VALUE=$((RETURN_VALUE + $?))
 

From 3f261d38ffb76ddf8838fb376157d5e28fa59bf1 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 07:15:57 +0200
Subject: [PATCH 045/126] Remove mysql from settings.

---
 backend/settings.py  | 7 -------
 settings_sample.json | 6 ------
 2 files changed, 13 deletions(-)

diff --git a/backend/settings.py b/backend/settings.py
index c6543e4b5..c2e255ca0 100644
--- a/backend/settings.py
+++ b/backend/settings.py
@@ -34,13 +34,6 @@
 psql_user = json_settings["postgresUser"]
 psql_pass = json_settings["postgresPass"]
 
-# MySql settings
-mysql_host = json_settings["mysqlHost"]
-mysql_schema = json_settings["mysqlSchema"]
-mysql_user = json_settings["mysqlUser"]
-mysql_passwd = json_settings["mysqlPasswd"]
-mysql_port = json_settings["mysqlPort"]
-
 # e-mail config
 mail_server = json_settings["mailServer"]
 from_address = json_settings["fromAddress"]
diff --git a/settings_sample.json b/settings_sample.json
index a530f12f0..11cfbe695 100644
--- a/settings_sample.json
+++ b/settings_sample.json
@@ -1,12 +1,6 @@
 {
     "cookieSecret" : "Something random for tornado to sign cookies with",
 
-    "mysqlHost" : "127.0.0.1",
-    "mysqlPasswd" : "password",
-    "mysqlSchema" : "swefreq",
-    "mysqlUser" : "swefreq",
-    "mysqlPort" : 3306,
-
     "postgresHost" : "postgres host",
     "postgresPort" : 5432,
     "postgresUser" : "postgres",

From 4107a0bc435ce741372e3ac2f41ef2828ac9618d Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 8 Aug 2019 13:11:23 +0200
Subject: [PATCH 046/126] A bit more cleanup in raw_data_importer, including
 initialising a forgotten variable.

---
 .../data_importer/raw_data_importer.py        | 20 ++++++++-----------
 1 file changed, 8 insertions(+), 12 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 5eb92fd89..e0a345047 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -193,6 +193,7 @@ def _parse_manta(self):
         batch = []
         samples = 0
         counter = 0
+        last_progress = 0
         start = time.time()
         for filename in self.settings.variant_file:
             for line in self._open(filename):
@@ -225,6 +226,7 @@ def _parse_manta(self):
                     samples = int(info['NSAMPLES'])
 
                 alt_alleles = base['alt'].split(",")
+
                 for i, alt in enumerate(alt_alleles):
                     data = dict(base)
                     data['allele_freq'] = float(info.get('FRQ'))
@@ -305,8 +307,6 @@ def _insert_variants(self):
         counter = 0
         samples = 0
         vep_field_names = None
-        dp_mids = None
-        gq_mids = None
         with db.database.atomic():
             for filename in self.settings.variant_file:
                 # Get reference set for the variant
@@ -328,10 +328,6 @@ def _insert_variants(self):
                         # Check for some information that we need
                         if line.startswith('##INFO=<ID=CSQ'):
                             vep_field_names = line.split('Format: ')[-1].strip('">').split('|')
-                        if line.startswith('##INFO=<ID=DP_HIST'):
-                            dp_mids = map(float, line.split('Mids: ')[-1].strip('">').split('|'))
-                        if line.startswith('##INFO=<ID=GQ_HIST'):
-                            gq_mids = map(float, line.split('Mids: ')[-1].strip('">').split('|'))
                         if line.startswith('#CHROM'):
                             samples = len(line.split('\t')[9:])
                         continue
@@ -371,7 +367,7 @@ def _insert_variants(self):
                     try:
                         hom_counts = [int(info['AC_Hom'])]
                     except KeyError:
-                        hom_counts = None # null is better than 0, as 0 has a meaning
+                        hom_counts = None  # null is better than 0, as 0 has a meaning
                     except ValueError:
                         hom_counts = [int(count) for count in info['AC_Hom'].split(',')]
 
@@ -450,7 +446,7 @@ def _insert_variants(self):
                                            .order_by(db.Variant.id.desc())
                                            .limit(1)
                                            .get().id)
-                                if  last_id-curr_id == len(batch):
+                                if last_id-curr_id == len(batch):
                                     indexes = list(range(curr_id+1, last_id+1))
                                 else:
                                     indexes = []
@@ -490,7 +486,7 @@ def _insert_variants(self):
                                .order_by(db.Variant.id.desc())
                                .limit(1)
                                .get().id)
-                    if  last_id-curr_id == len(batch):
+                    if last_id-curr_id == len(batch):
                         indexes = list(range(curr_id+1, last_id+1))
                     else:
                         indexes = []
@@ -585,7 +581,7 @@ def add_variant_genes(self, variant_indexes: list, genes_to_add: list, ref_genes
         """Add genes associated with the provided variants."""
         batch = []
         for i in range(len(variant_indexes)):
-            connected_genes = [{'variant':variant_indexes[i], 'gene':ref_genes[gene]}
+            connected_genes = [{'variant': variant_indexes[i], 'gene': ref_genes[gene]}
                                for gene in genes_to_add[i]
                                if gene]
             batch += connected_genes
@@ -597,8 +593,8 @@ def add_variant_transcripts(self, variant_indexes: list,
         """Add genes associated with the provided variants."""
         batch = []
         for i in range(len(variant_indexes)):
-            connected_transcripts = [{'variant':variant_indexes[i],
-                                      'transcript':ref_transcripts[transcript]}
+            connected_transcripts = [{'variant': variant_indexes[i],
+                                      'transcript': ref_transcripts[transcript]}
                                      for transcript in transcripts_to_add[i]]
             batch += connected_transcripts
         if not self.settings.dry_run:

From 76389702ec5259759ba72627ab0139dc9d924398 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 08:27:29 +0200
Subject: [PATCH 047/126] Pylint fixes in auth.py. Also some other changes,
 e.g. use of fstrings."

---
 backend/auth.py | 72 +++++++++++++++++++++----------------------------
 1 file changed, 30 insertions(+), 42 deletions(-)

diff --git a/backend/auth.py b/backend/auth.py
index d48882df3..091921cef 100644
--- a/backend/auth.py
+++ b/backend/auth.py
@@ -27,10 +27,10 @@ def get(self):
 
 
 class ElixirLoginHandler(BaseHandler, tornado.auth.OAuth2Mixin):
-    _OAUTH_AUTHORIZE_URL     = "https://login.elixir-czech.org/oidc/authorize"
-    _OAUTH_ACCESS_TOKEN_URL  = "https://login.elixir-czech.org/oidc/token"
+    _OAUTH_AUTHORIZE_URL = "https://login.elixir-czech.org/oidc/authorize"
+    _OAUTH_ACCESS_TOKEN_URL = "https://login.elixir-czech.org/oidc/token"
     _OAUTH_USERINFO_ENDPOINT = "https://login.elixir-czech.org/oidc/userinfo"
-    _OAUTH_SETTINGS_KEY      = 'elixir_oauth'
+    _OAUTH_SETTINGS_KEY = 'elixir_oauth'
 
     def _generate_state(self):
         state = uuid.uuid4().hex
@@ -50,7 +50,7 @@ async def get(self):
                 return
 
             user_token = await self.get_user_token(self.get_argument('code'))
-            user       = await self.get_user(user_token["access_token"])
+            user = await self.get_user(user_token["access_token"])
 
             try:
                 self.set_secure_cookie('access_token', user_token["access_token"])
@@ -69,40 +69,34 @@ async def get(self):
             self.redirect(redirect)
 
         elif self.get_argument("error", False):
-            logging.error("Elixir error: {}".format( self.get_argument("error") ))
-            logging.error(" Description: {}".format( self.get_argument("error_description") ))
+            logging.error("Elixir error: {}".format(self.get_argument("error")))
+            logging.error(" Description: {}".format(self.get_argument("error_description")))
 
-            self.set_user_msg("Elixir Error: %s, %s" % (self.get_argument("error"),
-                                                        self.get_argument("error_description")))
+            self.set_user_msg(f"Elixir Error: ,{self.get_argument('error')} " +
+                              f"{self.get_argument('error_description')}")
             self.redirect("/error")
 
         else:
             self.set_secure_cookie('login_redirect', self.get_argument("next", '/'), 1)
             state = self._generate_state()
-            self.authorize_redirect(
-                    redirect_uri  = self.settings['elixir_oauth']['redirect_uri'],
-                    client_id     = self.settings['elixir_oauth']['id'],
-                    scope         = ['openid', 'profile', 'email', 'bona_fide_status'],
-                    response_type = 'code',
-                    extra_params  = {'state': state}
-                )
+            self.authorize_redirect(redirect_uri=self.settings['elixir_oauth']['redirect_uri'],
+                                    client_id=self.settings['elixir_oauth']['id'],
+                                    scope=['openid', 'profile', 'email', 'bona_fide_status'],
+                                    response_type='code',
+                                    extra_params={'state': state})
 
     async def get_user(self, access_token):
         http = self.get_auth_http_client()
 
-        response = await http.fetch(
-                self._OAUTH_USERINFO_ENDPOINT,
-                headers = {
-                    'Content-Type':  'application/x-www-form-urlencoded',
-                    'Authorization': "Bearer {}".format(access_token),
-                }
-            )
+        response = await http.fetch(self._OAUTH_USERINFO_ENDPOINT,
+                                    headers={'Content-Type':  'application/x-www-form-urlencoded',
+                                             'Authorization': "Bearer {}".format(access_token)})
 
         if response.error:
-            logging.error("get_user error: {}".format(response))
+            logging.error(f"get_user error: {response}")
             return
 
-        return tornado.escape.json_decode( response.body )
+        return tornado.escape.json_decode(response.body)
 
     async def get_user_token(self, code):
         redirect_uri = self.settings['elixir_oauth']['redirect_uri']
@@ -114,28 +108,22 @@ async def get_user_token(self, code):
             })
 
         client_id = self.settings['elixir_oauth']['id']
-        secret    = self.settings['elixir_oauth']['secret']
-
-        authorization = base64.b64encode(
-                bytes("{}:{}".format(client_id, secret),
-                      'ascii' )
-            ).decode('ascii')
-
-        response = await http.fetch(
-                self._OAUTH_ACCESS_TOKEN_URL,
-                method  = "POST",
-                body    = body,
-                headers = {
-                    'Content-Type': 'application/x-www-form-urlencoded',
-                    'Authorization': "Basic {}".format(authorization),
-                },
-            )
+        secret = self.settings['elixir_oauth']['secret']
+
+        authorization = base64.b64encode(bytes(f"{client_id}:{secret}",
+                                               'ascii')).decode('ascii')
+
+        response = await http.fetch(self._OAUTH_ACCESS_TOKEN_URL,
+                                    method="POST",
+                                    body=body,
+                                    headers={'Content-Type': 'application/x-www-form-urlencoded',
+                                             'Authorization': "Basic {}".format(authorization)})
 
         if response.error:
-            logging.error("get_user_token error: {}".format(response))
+            logging.error(f"get_user_token error: {response}")
             return
 
-        return tornado.escape.json_decode( response.body )
+        return tornado.escape.json_decode(response.body)
 
 
 class ElixirLogoutHandler(BaseHandler):

From 3fa38b12bf42e23154ed9fd6477ebc00b95fc81b Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 08:55:23 +0200
Subject: [PATCH 048/126] Whitespace cleanup, style changes etc (mostly based
 on pylint).

---
 backend/application.py | 199 +++++++++++++++++++----------------------
 1 file changed, 91 insertions(+), 108 deletions(-)

diff --git a/backend/application.py b/backend/application.py
index 1f4cecbcd..4a642b958 100644
--- a/backend/application.py
+++ b/backend/application.py
@@ -29,7 +29,7 @@ def build_dataset_structure(dataset_version, user=None, dataset=None):
     r['version'] = db.build_dict_from_row(dataset_version)
     r['version']['available_from'] = r['version']['available_from'].strftime('%Y-%m-%d')
 
-    r['has_image']  = dataset.has_image()
+    r['has_image'] = dataset.has_image()
 
     if user:
         r['is_admin'] = user.is_admin(dataset)
@@ -77,14 +77,17 @@ def get(self):
         base = {"@context": "http://schema.org/",
                 "@type": "DataCatalog",
                 "name": "SweFreq",
-                "alternateName": [ "The Swedish Frequency resource for genomics" ],
-                "description": "The Swedish Frequency resource for genomics (SweFreq) is a website developed to make genomic datasets more findable and accessible in order to promote collaboration, new research and increase public benefit.",
+                "alternateName": ["The Swedish Frequency resource for genomics"],
+                "description": ("The Swedish Frequency resource for genomics (SweFreq) is a " +
+                                "website developed to make genomic datasets more findable and " +
+                                "accessible in order to promote collaboration, new research and " +
+                                "increase public benefit."),
                 "url": "https://swefreq.nbis.se/",
                 "provider": {
                     "@type": "Organization",
                     "name": "National Bioinformatics Infrastructure Sweden",
-                    "alternateName": [ "NBIS",
-                                       "ELIXIR Sweden" ],
+                    "alternateName": ["NBIS",
+                                       "ELIXIR Sweden"],
                     "logo": "http://nbis.se/assets/img/logos/nbislogo-green.svg",
                     "url": "https://nbis.se/"
                 },
@@ -114,12 +117,12 @@ def get(self):
                         return
 
                 base_url = "%s://%s" % (self.request.protocol, self.request.host)
-                dataset_schema['url']         = base_url + "/dataset/" + dataset_version.dataset.short_name
-                dataset_schema['@id']         = dataset_schema['url']
-                dataset_schema['name']        = dataset_version.dataset.short_name
+                dataset_schema['url'] = base_url + "/dataset/" + dataset_version.dataset.short_name
+                dataset_schema['@id'] = dataset_schema['url']
+                dataset_schema['name'] = dataset_version.dataset.short_name
                 dataset_schema['description'] = dataset_version.description
-                dataset_schema['identifier']  = dataset_schema['name']
-                dataset_schema['citation']    = dataset_version.ref_doi
+                dataset_schema['identifier'] = dataset_schema['name']
+                dataset_schema['citation'] = dataset_version.ref_doi
 
                 base["dataset"] = dataset_schema
 
@@ -163,12 +166,12 @@ def get(self):
             for f in futures:
                 dataset = build_dataset_structure(f, user)
                 dataset['future'] = True
-                ret.append( dataset )
+                ret.append(dataset)
 
         for version in db.DatasetVersionCurrent.select():
             dataset = build_dataset_structure(version, user)
             dataset['current'] = True
-            ret.append( dataset )
+            ret.append(dataset)
 
         self.finish({'data':ret})
 
@@ -210,7 +213,7 @@ def get(self, dataset):
         versions = sorted(versions, key=lambda version: version.version)
         for v in reversed(versions):
             current = False
-            future  = False
+            future = False
 
             # Skip future versions unless admin
             if v.available_from > datetime.now():
@@ -221,14 +224,12 @@ def get(self, dataset):
             # Figure out if this is the current version
             if not found_current and v.available_from < datetime.now():
                 found_current = True
-                current       = True
+                current = True
 
-            data.insert(0, {
-                'name':           v.version,
-                'available_from': v.available_from.strftime('%Y-%m-%d'),
-                'current':        current,
-                'future':         future,
-            })
+            data.insert(0, {'name': v.version,
+                            'available_from': v.available_from.strftime('%Y-%m-%d'),
+                            'current': current,
+                            'future': future})
 
         self.finish({'data': data})
 
@@ -242,25 +243,20 @@ def post(self, dataset, ds_version=None):
             self.send_error(status_code=404)
             return
 
-        lh = db.Linkhash.create(
-                user            = user,
-                dataset_version = dataset_version,
-                hash            = uuid.uuid4().hex,
-                expires_on      = datetime.now() + timedelta(hours=3),
-            )
+        lh = db.Linkhash.create(user=user,
+                                dataset_version=dataset_version,
+                                hash=uuid.uuid4().hex,
+                                expires_on=datetime.now() + timedelta(hours=3))
 
         try:
             (db.Linkhash.delete()
-                        .where(db.Linkhash.expires_on < datetime.now())
-                        .execute()
-                        )
+            .where(db.Linkhash.expires_on < datetime.now())
+            .execute())
         except peewee.OperationalError as e:
             logging.error("Could not clean old linkhashes: {}".format(e))
 
-        self.finish({
-                'hash':       lh.hash,
-                'expires_on': lh.expires_on.strftime("%Y-%m-%d %H:%M") #pylint: disable=no-member
-            })
+        self.finish({'hash': lh.hash,
+                     'expires_on': lh.expires_on.strftime("%Y-%m-%d %H:%M")}) #pylint: no-member
 
 
 class DatasetFiles(handlers.AuthorizedHandler):
@@ -283,12 +279,13 @@ def get(self, dataset, ds_version=None):
 
 def format_bytes(nbytes):
     postfixes = ['b', 'Kb', 'Mb', 'Gb', 'Tb', 'Pb', 'Eb']
-    exponent = math.floor( math.log(nbytes) / math.log(1000) )
-    return "{} {}".format( round(nbytes/1000**exponent, 2), postfixes[exponent])
+    exponent = math.floor(math.log(nbytes) / math.log(1000))
+    return f"{round(nbytes/1000**exponent, 2)} {postfixes[exponent]}"
 
 
 class Collection(handlers.UnsafeHandler):
     def get(self, dataset, ds_version=None):
+        del ds_version
         dataset, _ = utils.parse_dataset(dataset)
         dataset = db.get_dataset(dataset)
 
@@ -301,7 +298,7 @@ def get(self, dataset, ds_version=None):
                         'sample_sets': [],
                         'ethnicity': collection.ethnicity,
                     }
-            collections[collection.name]['sample_sets'].append( db.build_dict_from_row(sample_set) )
+            collections[collection.name]['sample_sets'].append(db.build_dict_from_row(sample_set))
 
 
         ret = {
@@ -317,14 +314,12 @@ class GetUser(handlers.UnsafeHandler):
     def get(self):
         user = self.current_user
 
-        ret = { 'user': None, 'email': None, 'login_type': 'none' }
+        ret = {'user': None, 'email': None, 'login_type': 'none'}
         if user:
-            ret = {
-                'user':        user.name,
-                'email':       user.email,
-                'affiliation': user.affiliation,
-                'country':     user.country,
-            }
+            ret = {'user': user.name,
+                   'email': user.email,
+                   'affiliation': user.affiliation,
+                   'country': user.country}
 
         self.finish(ret)
 
@@ -388,18 +383,18 @@ def country_list(self):
                 "Uganda", "Ukraine", "United Arab Emirates", "United Kingdom",
                 "United States", "Uruguay", "Uzbekistan", "Vanuatu", "Vatican",
                 "Venezuela", "Vietnam", "Wallis and Futuna", "Western Sahara",
-                "Yemen", "Zambia", "Zimbabwe" ]
+                "Yemen", "Zambia", "Zimbabwe"]
 
 
 class RequestAccess(handlers.SafeHandler):
     def post(self, dataset):
         dataset, _ = utils.parse_dataset(dataset)
-        user    = self.current_user
+        user = self.current_user
         dataset = db.get_dataset(dataset)
 
         affiliation = self.get_argument("affiliation", strip=False)
-        country     = self.get_argument("country", strip=False)
-        newsletter  = self.get_argument("newsletter", strip=False)
+        country = self.get_argument("country", strip=False)
+        newsletter = self.get_argument("newsletter", strip=False)
 
         user.affiliation = affiliation
         user.country = country
@@ -409,19 +404,15 @@ def post(self, dataset):
         try:
             with db.database.atomic():
                 user.save() # Save to database
-                (da,_) = db.DatasetAccess.get_or_create(
-                        user    = user,
-                        dataset = dataset
-                    )
+                (da, _) = db.DatasetAccess.get_or_create(user=user,
+                                                         dataset=dataset)
                 da.wants_newsletter = newsletter
                 da.save()
-                db.UserAccessLog.create(
-                        user = user,
-                        dataset = dataset,
-                        action = 'access_requested'
-                    )
+                db.UserAccessLog.create(user=user,
+                                        dataset=dataset,
+                                        action='access_requested')
         except peewee.OperationalError as e:
-            logging.error("Database Error: {}".format(e))
+            logging.error(f"Database Error: {e}")
 
 
 class LogEvent(handlers.SafeHandler):
@@ -432,16 +423,13 @@ def post(self, dataset, event, target):
         if event == 'consent':
             user.save()
             dv = (db.DatasetVersion
-                    .select()
-                    .join(db.Dataset)
-                    .where(
-                        db.DatasetVersion.version == target,
-                        db.Dataset.short_name     == dataset)
-                    .get())
-            db.UserConsentLog.create(
-                    user = user,
-                    dataset_version = dv,
-                )
+                  .select()
+                  .join(db.Dataset)
+                  .where(db.DatasetVersion.version == target,
+                         db.Dataset.short_name == dataset)
+                  .get())
+            db.UserConsentLog.create(user=user,
+                                     dataset_version=dv)
         else:
             raise tornado.web.HTTPError(400, reason="Can't log that")
 
@@ -461,11 +449,9 @@ def post(self, dataset, email):
             da.has_access = True
             da.save()
 
-            db.UserAccessLog.create(
-                    user = user,
-                    dataset = dataset,
-                    action = 'access_granted'
-                )
+            db.UserAccessLog.create(user=user,
+                                    dataset=dataset,
+                                    action='access_granted')
 
         try:
             msg = MIMEMultipart()
@@ -496,11 +482,9 @@ def post(self, dataset, email):
             dataset = db.get_dataset(dataset)
             user = db.User.select().where(db.User.email == email).get()
 
-            db.UserAccessLog.create(
-                    user = user,
-                    dataset = dataset,
-                    action = 'access_revoked'
-                )
+            db.UserAccessLog.create(user=user,
+                                    dataset=dataset,
+                                    action='access_revoked')
 
 def _build_json_response(query, access_for):
     json_response = []
@@ -533,9 +517,7 @@ def get(self, dataset):
         users = db.User.select()
         access = (db.DatasetAccessPending
                    .select()
-                   .where(
-                       db.DatasetAccessPending.dataset == dataset,
-                   ))
+                   .where(db.DatasetAccessPending.dataset == dataset))
         query = peewee.prefetch(users, access)
 
         self.finish({'data': _build_json_response(query, lambda u: u.access_pending)})
@@ -550,34 +532,32 @@ def get(self, dataset):
                   .where(db.DatasetAccessCurrent.dataset == dataset))
         query = peewee.prefetch(users, access)
         self.finish({'data': sorted(_build_json_response(
-            query, lambda u: u.access_current),key=lambda u: u['applyDate'])})
+            query, lambda u: u.access_current), key=lambda u: u['applyDate'])})
 
 
 class UserDatasetAccess(handlers.SafeHandler):
     def get(self):
         user = self.current_user
 
-        ret = {
-            "data": [],
-        }
+        ret = {"data": []}
 
         for access in user.access_pending:
             d = {}
-            d['short_name']       = access.dataset.short_name
+            d['short_name'] = access.dataset.short_name
             d['wants_newsletter'] = access.wants_newsletter
-            d['is_admin']         = False
-            d['access']           = False
+            d['is_admin'] = False
+            d['access'] = False
 
-            ret['data'].append( d )
+            ret['data'].append(d)
 
         for access in user.access_current:
             d = {}
-            d['short_name']       = access.dataset.short_name
+            d['short_name'] = access.dataset.short_name
             d['wants_newsletter'] = access.wants_newsletter
-            d['is_admin']         = access.is_admin
-            d['access']           = True
+            d['is_admin'] = access.is_admin
+            d['access'] = True
 
-            ret['data'].append( d )
+            ret['data'].append(d)
 
         self.finish(ret)
 
@@ -603,13 +583,9 @@ def get(self, dataset):
 
 
 class SFTPAccess(handlers.SafeHandler):
-    """
-    Creates, or re-enables, sFTP users in the database.
-    """
+    """Creates, or re-enables, sFTP users in the database."""
     def get(self):
-        """
-        Returns sFTP credentials for the current user.
-        """
+        """Returns sFTP credentials for the current user."""
         if db.get_admin_datasets(self.current_user).count() <= 0:
             self.finish({'user':None, 'expires':None, 'password':None})
             return
@@ -651,26 +627,33 @@ def post(self):
         try:
             self.current_user.sftp_user.get()
             # if we have a user, update it
-            db.SFTPUser.update(password_hash = passwd_hash,
-                               account_expires = expires
-                               ).where(db.SFTPUser.user == self.current_user).execute()
+            (db.SFTPUser.update(password_hash=passwd_hash,
+                                account_expires=expires)
+             .where(db.SFTPUser.user == self.current_user)
+             .execute())
         except db.SFTPUser.DoesNotExist:
             # if there is no user, insert the user in the database
-            db.SFTPUser.insert(user = self.current_user,
-                               user_uid = db.get_next_free_uid(),
-                               user_name = username,
-                               password_hash = passwd_hash,
-                               account_expires = expires
-                               ).execute()
+            (db.SFTPUser.insert(user=self.current_user,
+                                user_uid=db.get_next_free_uid(),
+                                user_name=username,
+                                password_hash=passwd_hash,
+                                account_expires=expires).execute())
 
         self.finish({'user':username,
                      'expires':expires.strftime("%Y-%m-%d %H:%M"),
                      'password':password})
 
-    def generate_password(self, size = 12):
+    def generate_password(self, size: int = 12) -> str:
         """
         Generates a password of length 'size', comprised of random lowercase and
         uppercase letters, and numbers.
+
+        Args:
+            size: The length of the password that will be generated
+
+        Returns:
+            str: The generated password
+
         """
         chars = string.ascii_letters + string.digits
         return ''.join(random.SystemRandom().choice(chars) for _ in range(size))

From ecd61e3e2566ba72297a6cc8edadc7d7e8a1d2db Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 09:20:08 +0200
Subject: [PATCH 049/126] Code style fixes (mainly whitespace); main source is
 pylint and flake.

---
 backend/db.py | 246 ++++++++++++++++++++++++++++----------------------
 1 file changed, 137 insertions(+), 109 deletions(-)

diff --git a/backend/db.py b/backend/db.py
index 8485126d3..7cb1d5442 100644
--- a/backend/db.py
+++ b/backend/db.py
@@ -12,16 +12,16 @@
                     ForeignKeyField,
                     Model,
                     TextField,
-                    fn,
-                )
+                    fn)
 from playhouse.postgres_ext import ArrayField, BinaryJSONField, PostgresqlExtDatabase
 
 database = PostgresqlExtDatabase(settings.psql_name,
-                                 user            = settings.psql_user,
-                                 password        = settings.psql_pass,
-                                 host            = settings.psql_host,
-                                 port            = settings.psql_port,
-                                 register_hstore = False)
+                                 user=settings.psql_user,
+                                 password=settings.psql_pass,
+                                 host=settings.psql_host,
+                                 port=settings.psql_port,
+                                 register_hstore=False)
+
 
 class BaseModel(Model):
     class Meta:
@@ -29,7 +29,7 @@ class Meta:
 
 
 class EnumField(Field):
-    db_field = 'string' # The same as for CharField
+    db_field = 'string'  # The same as for CharField
 
     def __init__(self, choices=None, *args, **kwargs):
         self.values = choices or []
@@ -37,12 +37,12 @@ def __init__(self, choices=None, *args, **kwargs):
 
     def db_value(self, value):
         if value not in self.values:
-            raise ValueError("Illegal value for '{}'".format(self.db_column))
+            raise ValueError("Illegal value for '{}'".format(self.column_name))
         return value
 
     def python_value(self, value):
         if value not in self.values:
-            raise ValueError("Illegal value for '{}'".format(self.db_column))
+            raise ValueError("Illegal value for '{}'".format(self.column_name))
         return value
 
 ###
@@ -80,7 +80,8 @@ class Meta:
     chrom = CharField(max_length=10)
     start = IntegerField(column_name="start_pos")
     stop = IntegerField(column_name="end_pos")
-    strand = EnumField(choices=['+','-'])
+    strand = EnumField(choices=['+', '-'])
+
 
 class GeneOtherNames(BaseModel):
     class Meta:
@@ -90,6 +91,7 @@ class Meta:
     gene = ForeignKeyField(Gene, column_name="gene", backref="other_names")
     name = CharField(null=True)
 
+
 class Transcript(BaseModel):
     class Meta:
         table_name = 'transcripts'
@@ -102,7 +104,7 @@ class Meta:
     chrom = CharField(max_length=10)
     start = IntegerField(column_name="start_pos")
     stop = IntegerField(column_name="stop_pos")
-    strand = EnumField(choices = ['+', '-'])
+    strand = EnumField(choices=['+', '-'])
 
 
 class Feature(BaseModel):
@@ -115,9 +117,10 @@ class Meta:
     chrom = CharField(max_length=10)
     start = IntegerField(column_name="start_pos")
     stop = IntegerField(column_name="stop_pos")
-    strand = EnumField(choices = ['+', '-'])
+    strand = EnumField(choices=['+', '-'])
     feature_type = CharField()
 
+
 ###
 # Study and Dataset fields
 ##
@@ -130,8 +133,8 @@ class Meta:
         table_name = 'collections'
         schema = 'data'
 
-    name       = CharField(column_name="study_name", null = True)
-    ethnicity  = CharField(null = True)
+    name = CharField(column_name="study_name", null=True)
+    ethnicity = CharField(null=True)
 
 
 class Study(BaseModel):
@@ -143,14 +146,14 @@ class Meta:
         table_name = 'studies'
         schema = 'data'
 
-    pi_name          = CharField()
-    pi_email         = CharField()
-    contact_name     = CharField()
-    contact_email    = CharField()
-    title            = CharField()
-    description      = TextField(column_name="study_description", null=True)
+    pi_name = CharField()
+    pi_email = CharField()
+    contact_name = CharField()
+    contact_email = CharField()
+    title = CharField()
+    description = TextField(column_name="study_description", null=True)
     publication_date = DateTimeField()
-    ref_doi          = CharField(null=True)
+    ref_doi = CharField(null=True)
 
 
 class Dataset(BaseModel):
@@ -163,17 +166,17 @@ class Meta:
         table_name = 'datasets'
         schema = 'data'
 
-    study              = ForeignKeyField(Study, column_name="study", backref='datasets')
-    short_name         = CharField()
-    full_name          = CharField()
-    browser_uri        = CharField(null=True)
-    beacon_uri         = CharField(null=True)
-    description        = TextField(column_name="beacon_description", null=True)
-    avg_seq_depth      = FloatField(null=True)
-    seq_type           = CharField(null=True)
-    seq_tech           = CharField(null=True)
-    seq_center         = CharField(null=True)
-    dataset_size       = IntegerField()
+    study = ForeignKeyField(Study, column_name="study", backref='datasets')
+    short_name = CharField()
+    full_name = CharField()
+    browser_uri = CharField(null=True)
+    beacon_uri = CharField(null=True)
+    description = TextField(column_name="beacon_description", null=True)
+    avg_seq_depth = FloatField(null=True)
+    seq_type = CharField(null=True)
+    seq_tech = CharField(null=True)
+    seq_center = CharField(null=True)
+    dataset_size = IntegerField()
 
     def has_image(self):
         try:
@@ -188,10 +191,10 @@ class Meta:
         table_name = 'sample_sets'
         schema = 'data'
 
-    dataset     = ForeignKeyField(Dataset, column_name="dataset", backref='sample_sets')
-    collection  = ForeignKeyField(Collection, column_name="collection", backref='sample_sets')
+    dataset = ForeignKeyField(Dataset, column_name="dataset", backref='sample_sets')
+    collection = ForeignKeyField(Collection, column_name="collection", backref='sample_sets')
     sample_size = IntegerField()
-    phenotype   = CharField(null=True)
+    phenotype = CharField(null=True)
 
 
 class DatasetVersion(BaseModel):
@@ -199,20 +202,24 @@ class Meta:
         table_name = 'dataset_versions'
         schema = 'data'
 
-    dataset           = ForeignKeyField(Dataset, column_name="dataset", backref='versions')
-    reference_set     = ForeignKeyField(ReferenceSet, column_name="reference_set", backref='dataset_versions')
-    version           = CharField(column_name="dataset_version")
-    description       = TextField(column_name="dataset_description")
-    terms             = TextField()
-    available_from    = DateTimeField()
-    ref_doi           = CharField(null=True)
+    dataset = ForeignKeyField(Dataset, column_name="dataset", backref='versions')
+    reference_set = ForeignKeyField(ReferenceSet,
+                                    column_name="reference_set",
+                                    backref='dataset_versions')
+    version = CharField(column_name="dataset_version")
+    description = TextField(column_name="dataset_description")
+    terms = TextField()
+    available_from = DateTimeField()
+    ref_doi = CharField(null=True)
     data_contact_name = CharField(null=True)
     data_contact_link = CharField(null=True)
-    num_variants      = IntegerField(null=True)
-    coverage_levels   = ArrayField(IntegerField, null=True)
+    num_variants = IntegerField(null=True)
+    coverage_levels = ArrayField(IntegerField, null=True)
     portal_avail = BooleanField(null=True)
-    file_access = EnumField(null=False, choices=['PRIVATE', 'CONTROLLED', 'REGISTERED', 'PUBLIC'])
-    beacon_access = EnumField(null=False, choices=['PRIVATE', 'CONTROLLED', 'REGISTERED', 'PUBLIC'])
+    file_access = EnumField(null=False, choices=['PRIVATE', 'CONTROLLED',
+                                                 'REGISTERED', 'PUBLIC'])
+    beacon_access = EnumField(null=False, choices=['PRIVATE', 'CONTROLLED',
+                                                   'REGISTERED', 'PUBLIC'])
 
 
 class DatasetFile(BaseModel):
@@ -220,10 +227,12 @@ class Meta:
         table_name = 'dataset_files'
         schema = 'data'
 
-    dataset_version = ForeignKeyField(DatasetVersion, column_name="dataset_version", backref='files')
-    name            = CharField(column_name="basename")
-    uri             = CharField()
-    file_size       = IntegerField()
+    dataset_version = ForeignKeyField(DatasetVersion,
+                                      column_name="dataset_version",
+                                      backref='files')
+    name = CharField(column_name="basename")
+    uri = CharField()
+    file_size = IntegerField()
 
 
 class DatasetLogo(BaseModel):
@@ -231,9 +240,9 @@ class Meta:
         table_name = 'dataset_logos'
         schema = 'data'
 
-    dataset      = ForeignKeyField(Dataset, column_name="dataset", backref='logo')
-    mimetype     = CharField()
-    data         = BlobField(column_name="bytes")
+    dataset = ForeignKeyField(Dataset, column_name="dataset", backref='logo')
+    mimetype = CharField()
+    data = BlobField(column_name="bytes")
 
 
 ###
@@ -245,7 +254,9 @@ class Meta:
         table_name = "variants"
         schema = 'data'
 
-    dataset_version = ForeignKeyField(DatasetVersion, column_name="dataset_version", backref="variants")
+    dataset_version = ForeignKeyField(DatasetVersion,
+                                      column_name="dataset_version",
+                                      backref="variants")
     rsid = IntegerField()
     chrom = CharField(max_length=10)
     pos = IntegerField()
@@ -268,7 +279,9 @@ class Meta:
         table_name = "mates"
         schema = 'data'
 
-    dataset_version = ForeignKeyField(DatasetVersion, column_name="dataset_version", backref="mates")
+    dataset_version = ForeignKeyField(DatasetVersion,
+                                      column_name="dataset_version",
+                                      backref="mates")
     chrom = CharField(max_length=10)
     pos = IntegerField()
     ref = CharField()
@@ -340,23 +353,23 @@ class Meta:
         table_name = "users"
         schema = 'users'
 
-    name          = CharField(column_name="username", null=True)
-    email         = CharField(unique=True)
-    identity      = CharField(unique=True)
+    name = CharField(column_name="username", null=True)
+    email = CharField(unique=True)
+    identity = CharField(unique=True)
     identity_type = EnumField(null=False, choices=['google', 'elixir'], default='elixir')
-    affiliation   = CharField(null=True)
-    country       = CharField(null=True)
+    affiliation = CharField(null=True)
+    country = CharField(null=True)
 
     def is_admin(self, dataset):
-        return DatasetAccess.select().where(
-                DatasetAccess.dataset == dataset,
-                DatasetAccess.user == self,
-                DatasetAccess.is_admin
-            ).count()
+        return (DatasetAccess.select()
+                .where(DatasetAccess.dataset == dataset,
+                       DatasetAccess.user == self,
+                       DatasetAccess.is_admin)
+                .count())
 
     def has_access(self, dataset, ds_version=None):
         """
-        Check whether user has permission to access a dataset
+        Check whether user has permission to access a dataset.
 
         Args:
             dataset (Database): peewee Database object
@@ -380,10 +393,10 @@ def has_access(self, dataset, ds_version=None):
                 .count()) > 0
 
     def has_requested_access(self, dataset):
-        return DatasetAccessPending.select().where(
-                DatasetAccessPending.dataset == dataset,
-                DatasetAccessPending.user == self
-            ).count()
+        return (DatasetAccessPending.select()
+                .where(DatasetAccessPending.dataset == dataset,
+                       DatasetAccessPending.user == self)
+                .count())
 
 
 class SFTPUser(BaseModel):
@@ -391,9 +404,9 @@ class Meta:
         table_name = "sftp_users"
         schema = 'users'
 
-    user          = ForeignKeyField(User, backref='sftp_user')
-    user_uid      = IntegerField(unique=True)
-    user_name     = CharField(null=False)
+    user = ForeignKeyField(User, backref='sftp_user')
+    user_uid = IntegerField(unique=True)
+    user_name = CharField(null=False)
     password_hash = CharField(null=False)
     account_expires = DateTimeField(null=False)
 
@@ -403,10 +416,11 @@ class Meta:
         table_name = "user_access_log"
         schema = 'users'
 
-    user            = ForeignKeyField(User, backref='access_logs')
-    dataset         = ForeignKeyField(Dataset, column_name='dataset', backref='access_logs')
-    action          = EnumField(null=True, choices=['access_granted','access_revoked','access_requested','private_link'])
-    ts              = DateTimeField()
+    user = ForeignKeyField(User, backref='access_logs')
+    dataset = ForeignKeyField(Dataset, column_name='dataset', backref='access_logs')
+    action = EnumField(null=True, choices=['access_granted', 'access_revoked',
+                                           'access_requested', 'private_link'])
+    ts = DateTimeField()
 
 
 class UserConsentLog(BaseModel):
@@ -414,9 +428,11 @@ class Meta:
         table_name = "user_consent_log"
         schema = 'users'
 
-    user             = ForeignKeyField(User, backref='consent_logs')
-    dataset_version  = ForeignKeyField(DatasetVersion, column_name='dataset_version', backref='consent_logs')
-    ts               = DateTimeField()
+    user = ForeignKeyField(User, backref='consent_logs')
+    dataset_version = ForeignKeyField(DatasetVersion,
+                                      column_name='dataset_version',
+                                      backref='consent_logs')
+    ts = DateTimeField()
 
 
 class UserDownloadLog(BaseModel):
@@ -424,9 +440,11 @@ class Meta:
         table_name = "user_download_log"
         schema = 'users'
 
-    user              = ForeignKeyField(User, backref='download_logs')
-    dataset_file      = ForeignKeyField(DatasetFile, column_name='dataset_file', backref='download_logs')
-    ts                = DateTimeField()
+    user = ForeignKeyField(User, backref='download_logs')
+    dataset_file = ForeignKeyField(DatasetFile,
+                                   column_name='dataset_file',
+                                   backref='download_logs')
+    ts = DateTimeField()
 
 
 class DatasetAccess(BaseModel):
@@ -434,10 +452,10 @@ class Meta:
         table_name = "dataset_access"
         schema = 'users'
 
-    dataset          = ForeignKeyField(Dataset, column_name='dataset', backref='access')
-    user             = ForeignKeyField(User, backref='dataset_access')
+    dataset = ForeignKeyField(Dataset, column_name='dataset', backref='access')
+    user = ForeignKeyField(User, backref='dataset_access')
     wants_newsletter = BooleanField(null=True)
-    is_admin         = BooleanField(null=True)
+    is_admin = BooleanField(null=True)
 
 
 class Linkhash(BaseModel):
@@ -445,10 +463,12 @@ class Meta:
         table_name = "linkhash"
         schema = 'users'
 
-    dataset_version = ForeignKeyField(DatasetVersion, column_name='dataset_version', backref='link_hashes')
-    user            = ForeignKeyField(User, backref='link_hashes')
-    hash            = CharField()
-    expires_on      = DateTimeField()
+    dataset_version = ForeignKeyField(DatasetVersion,
+                                      column_name='dataset_version',
+                                      backref='link_hashes')
+    user = ForeignKeyField(User, backref='link_hashes')
+    hash = CharField()
+    expires_on = DateTimeField()
 
 
 class BeaconCounts(BaseModel):
@@ -456,8 +476,8 @@ class Meta:
         table_name = "beacon_dataset_counts_table"
         schema = 'beacon'
 
-    datasetid    = CharField(primary_key=True)
-    callcount    = IntegerField()
+    datasetid = CharField(primary_key=True)
+    callcount = IntegerField()
     variantcount = IntegerField()
 
 
@@ -470,8 +490,10 @@ class Meta:
         table_name = 'dataset_version_current'
         schema = 'data'
 
-    dataset           = ForeignKeyField(Dataset, column_name="dataset", backref='current_version')
-    reference_set     = ForeignKeyField(ReferenceSet, column_name="reference_set", backref='current_version')
+    dataset = ForeignKeyField(Dataset, column_name="dataset", backref='current_version')
+    reference_set = ForeignKeyField(ReferenceSet,
+                                    column_name="reference_set",
+                                    backref='current_version')
 
 
 class DatasetAccessCurrent(DatasetAccess):
@@ -479,9 +501,9 @@ class Meta:
         table_name = 'dataset_access_current'
         schema = 'users'
 
-    dataset          = ForeignKeyField(Dataset, column_name='dataset', backref='access_current')
-    user             = ForeignKeyField(User, backref='access_current')
-    has_access       = IntegerField()
+    dataset = ForeignKeyField(Dataset, column_name='dataset', backref='access_current')
+    user = ForeignKeyField(User, backref='access_current')
+    has_access = IntegerField()
     access_requested = DateTimeField()
 
 
@@ -490,22 +512,24 @@ class Meta:
         table_name = 'dataset_access_pending'
         schema = 'users'
 
-    dataset          = ForeignKeyField(Dataset, column_name='dataset', backref='access_pending')
-    user             = ForeignKeyField(User, backref='access_pending')
-    has_access       = IntegerField()
+    dataset = ForeignKeyField(Dataset, column_name='dataset', backref='access_pending')
+    user = ForeignKeyField(User, backref='access_pending')
+    has_access = IntegerField()
     access_requested = DateTimeField()
 
+
 #####
 # Help functions
 ##
 
-def get_next_free_uid():
+def get_next_free_uid() -> int:
     """
     Get the next free uid >= 10000 and > than the current uids
     from the sftp_user table in the db.
 
     Returns:
         int: the next free uid
+
     """
     default = 10000
     next_uid = default
@@ -528,11 +552,12 @@ def get_admin_datasets(user):
 
     Returns:
         DataSetAccess:
+
     """
-    return DatasetAccess.select().where( DatasetAccess.user == user, DatasetAccess.is_admin)
+    return DatasetAccess.select().where(DatasetAccess.user == user, DatasetAccess.is_admin)
 
 
-def get_dataset(dataset:str):
+def get_dataset(dataset: str):
     """
     Given dataset name get Dataset
 
@@ -541,12 +566,13 @@ def get_dataset(dataset:str):
 
     Returns:
         Dataset: the corresponding DatasetVersion entry
+
     """
-    dataset = Dataset.select().where( Dataset.short_name == dataset).get()
+    dataset = Dataset.select().where(Dataset.short_name == dataset).get()
     return dataset
 
 
-def get_dataset_version(dataset:str, version:str=None):
+def get_dataset_version(dataset: str, version: str = None):
     """
     Given dataset get DatasetVersion
 
@@ -555,6 +581,7 @@ def get_dataset_version(dataset:str, version:str=None):
 
     Returns:
         DatasetVersion: the corresponding DatasetVersion entry
+
     """
     if version:
         try:
@@ -564,8 +591,8 @@ def get_dataset_version(dataset:str, version:str=None):
                                .where(DatasetVersion.version == version,
                                       Dataset.short_name == dataset)).get()
         except DatasetVersion.DoesNotExist:
-            logging.error(f"get_dataset_version({dataset}, {version}): " +
-                          "cannot retrieve dataset version")
+            logging.error(f"get_dataset_version(%s, %s): " +
+                          "cannot retrieve dataset version", dataset, version)
             return None
     else:
         try:
@@ -580,7 +607,8 @@ def get_dataset_version(dataset:str, version:str=None):
     return dataset_version
 
 
-def build_dict_from_row(row):
+def build_dict_from_row(row) -> dict:
+    """Build a dictionary from a row object"""
     d = {}
 
     for field, value in row.__dict__['__data__'].items():

From 22994b21488929995288b7edf1797f0b78a6994b Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 09:22:50 +0200
Subject: [PATCH 050/126] Minor style fix.

---
 backend/auth.py | 4 +++-
 1 file changed, 3 insertions(+), 1 deletion(-)

diff --git a/backend/auth.py b/backend/auth.py
index 091921cef..443d68144 100644
--- a/backend/auth.py
+++ b/backend/auth.py
@@ -5,6 +5,7 @@
 import base64
 import uuid
 
+
 class DeveloperLoginHandler(BaseHandler):
     def get(self):
         if not self.get_argument("user", False):
@@ -58,7 +59,8 @@ async def get(self):
                 self.set_secure_cookie('email', user["email"])
                 self.set_secure_cookie('identity', user["sub"])
             except KeyError as err:
-                logging.error(f'ElixirLoginHandler: data missing ({err}); user: {user}, user_token: {user_token}')
+                logging.error(f'ElixirLoginHandler: data missing ({err}); user: {user}' +
+                              f', user_token: {user_token}')
                 self.redirect("/error")
                 return
 

From 163a213445900c2d801b3551777cd32c628973a5 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 09:27:43 +0200
Subject: [PATCH 051/126] A few more pylint fixes.

---
 backend/auth.py | 21 ++++++++++++---------
 1 file changed, 12 insertions(+), 9 deletions(-)

diff --git a/backend/auth.py b/backend/auth.py
index 443d68144..b8637cfbe 100644
--- a/backend/auth.py
+++ b/backend/auth.py
@@ -1,9 +1,14 @@
-import logging
-from handlers import BaseHandler
-import tornado.auth
-import urllib.parse
+"""Authentication handlers."""
+
 import base64
+import logging
 import uuid
+import urllib.parse
+
+import tornado.auth
+
+from handlers import BaseHandler
+
 
 
 class DeveloperLoginHandler(BaseHandler):
@@ -103,11 +108,9 @@ async def get_user(self, access_token):
     async def get_user_token(self, code):
         redirect_uri = self.settings['elixir_oauth']['redirect_uri']
         http = self.get_auth_http_client()
-        body = urllib.parse.urlencode({
-                "redirect_uri": redirect_uri,
-                "code": code,
-                "grant_type": "authorization_code",
-            })
+        body = urllib.parse.urlencode({"redirect_uri": redirect_uri,
+                                       "code": code,
+                                       "grant_type": "authorization_code"})
 
         client_id = self.settings['elixir_oauth']['id']
         secret = self.settings['elixir_oauth']['secret']

From 02b246380e7e66c86c474a7da627fbd90f54f6db Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 10:00:32 +0200
Subject: [PATCH 052/126] pylintrc updated to match new default settings from
 pylint. Disabled tests removed.

---
 .pylintrc | 122 ++++++++++++++----------------------------------------
 1 file changed, 32 insertions(+), 90 deletions(-)

diff --git a/.pylintrc b/.pylintrc
index 5b77e41e8..c8f1f04a7 100644
--- a/.pylintrc
+++ b/.pylintrc
@@ -18,7 +18,12 @@ ignore-patterns=
 #init-hook=
 
 # Use multiple processes to speed up Pylint.
-jobs=1
+jobs=2
+
+# Control the amount of potential inferred values when inferring a single
+# object. This can help the performance when dealing with large functions or
+# complex, nested conditions.
+limit-inference-results=100
 
 # List of plugins (as comma separated values of python modules names) to load,
 # usually to register additional checkers.
@@ -54,92 +59,7 @@ confidence=
 # --enable=similarities". If you want to run only the classes checker, but have
 # no Warning level messages displayed, use"--disable=all --enable=classes
 # --disable=W"
-disable=print-statement,
-        parameter-unpacking,
-        unpacking-in-except,
-        old-raise-syntax,
-        backtick,
-        long-suffix,
-        old-ne-operator,
-        old-octal-literal,
-        import-star-module-level,
-        non-ascii-bytes-literal,
-        raw-checker-failed,
-        bad-inline-option,
-        locally-disabled,
-        locally-enabled,
-        file-ignored,
-        suppressed-message,
-        useless-suppression,
-        deprecated-pragma,
-        apply-builtin,
-        basestring-builtin,
-        buffer-builtin,
-        cmp-builtin,
-        coerce-builtin,
-        execfile-builtin,
-        file-builtin,
-        long-builtin,
-        raw_input-builtin,
-        reduce-builtin,
-        standarderror-builtin,
-        unicode-builtin,
-        xrange-builtin,
-        coerce-method,
-        delslice-method,
-        getslice-method,
-        setslice-method,
-        no-absolute-import,
-        old-division,
-        dict-iter-method,
-        dict-view-method,
-        next-method-called,
-        metaclass-assignment,
-        indexing-exception,
-        raising-string,
-        reload-builtin,
-        oct-method,
-        hex-method,
-        nonzero-method,
-        cmp-method,
-        input-builtin,
-        round-builtin,
-        intern-builtin,
-        unichr-builtin,
-        map-builtin-not-iterating,
-        zip-builtin-not-iterating,
-        range-builtin-not-iterating,
-        filter-builtin-not-iterating,
-        using-cmp-argument,
-        eq-without-hash,
-        div-method,
-        idiv-method,
-        rdiv-method,
-        exception-message-attribute,
-        invalid-str-codec,
-        sys-max-int,
-        bad-python3-import,
-        deprecated-string-function,
-        deprecated-str-translate-call,
-        deprecated-itertools-function,
-        deprecated-types-field,
-        next-method-defined,
-        dict-items-not-iterating,
-        dict-keys-not-iterating,
-        dict-values-not-iterating,
-        missing-docstring,
-        abstract-method,
-        bad-continuation,
-        logging-format-interpolation,
-        invalid-name,
-        bad-whitespace,
-        wrong-import-order,
-        too-few-public-methods,
-        keyword-arg-before-vararg,
-        arguments-differ,
-        line-too-long,
-        import-error,
-        no-self-use
+disable=
 
 # Enable the message, report, category or checker with the given id(s). You can
 # either give multiple identifier separated by comma (,) or put this option
@@ -178,6 +98,11 @@ score=yes
 # Maximum number of nested blocks for function / method body
 max-nested-blocks=5
 
+# Complete name of functions that never returns. When checking for
+# inconsistent-return-statements if a never returning function is called then
+# it will be considered as an explicit return statement and no message will be
+# printed.
+never-returning-functions=sys.exit
 
 [BASIC]
 
@@ -329,6 +254,10 @@ single-line-if-stmt=no
 # function parameter format
 logging-modules=logging
 
+# Format style used to check logging format string. `old` means using %
+# formatting, while `new` is for `{}` formatting.
+logging-format-style=new
+
 
 [MISCELLANEOUS]
 
@@ -373,6 +302,14 @@ spelling-private-dict-file=
 spelling-store-unknown-words=no
 
 
+[STRING]
+
+# This flag controls whether the implicit-str-concat-in-sequence should
+# generate a warning on implicit string concatenation in sequences defined over
+# several lines.
+check-str-concat-over-line-jumps=no
+
+
 [TYPECHECK]
 
 # List of decorators that produce context managers, such as
@@ -389,6 +326,10 @@ generated-members=
 # mixin class is detected if its name ends with "mixin" (case insensitive).
 ignore-mixin-members=yes
 
+# Tells whether to warn about missing members when the owner of the attribute
+# is inferred to be None.
+ignore-none=yes
+
 # This flag controls whether pylint should warn about no-member and similar
 # checks whenever an opaque object is returned when inferring. The inference
 # can return multiple potential results while evaluating a Python object, but
@@ -470,7 +411,7 @@ exclude-protected=_asdict,
 valid-classmethod-first-arg=cls
 
 # List of valid names for the first argument in a metaclass class method.
-valid-metaclass-classmethod-first-arg=mcs
+valid-metaclass-classmethod-first-arg=cls
 
 
 [DESIGN]
@@ -542,5 +483,6 @@ known-third-party=enchant
 [EXCEPTIONS]
 
 # Exceptions that will emit a warning when being caught. Defaults to
-# "Exception"
-overgeneral-exceptions=Exception
+# "BaseException, Exception".
+overgeneral-exceptions=BaseException,
+                       Exception

From 84a3c8f681d1b7eff0073977e3449e6366e7660e Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 10:34:39 +0200
Subject: [PATCH 053/126] Even more pylint and flake8 fixes.

---
 backend/application.py | 241 ++++++++++++++++++++---------------------
 1 file changed, 117 insertions(+), 124 deletions(-)

diff --git a/backend/application.py b/backend/application.py
index 4a642b958..bf566c5bd 100644
--- a/backend/application.py
+++ b/backend/application.py
@@ -1,19 +1,20 @@
+from datetime import datetime, timedelta
 from email.mime.multipart import MIMEMultipart
 from email.mime.text import MIMEText
-from os import path
 import logging
-from datetime import datetime, timedelta
-from peewee import fn
-import peewee
+import math
+from os import path
+import re
+import random
 import smtplib
 import socket
-import tornado.web
-import tornado
-import random
 import string
 import uuid
-import math
-import re
+
+from peewee import fn
+import peewee
+import tornado.web
+import tornado
 
 import db
 import handlers
@@ -24,23 +25,23 @@
 def build_dataset_structure(dataset_version, user=None, dataset=None):
     if dataset is None:
         dataset = dataset_version.dataset
-    r = db.build_dict_from_row(dataset)
+    row = db.build_dict_from_row(dataset)
 
-    r['version'] = db.build_dict_from_row(dataset_version)
-    r['version']['available_from'] = r['version']['available_from'].strftime('%Y-%m-%d')
+    row['version'] = db.build_dict_from_row(dataset_version)
+    row['version']['available_from'] = row['version']['available_from'].strftime('%Y-%m-%d')
 
-    r['has_image'] = dataset.has_image()
+    row['has_image'] = dataset.has_image()
 
     if user:
-        r['is_admin'] = user.is_admin(dataset)
+        row['is_admin'] = user.is_admin(dataset)
         if user.has_access(dataset, dataset_version.version):
-            r['authorization_level'] = 'has_access'
+            row['authorization_level'] = 'has_access'
         elif user.has_requested_access(dataset):
-            r['authorization_level'] = 'has_requested_access'
+            row['authorization_level'] = 'has_requested_access'
         else:
-            r['authorization_level'] = 'no_access'
+            row['authorization_level'] = 'no_access'
 
-    return r
+    return row
 
 
 class QuitHandler(handlers.UnsafeHandler):
@@ -87,7 +88,7 @@ def get(self):
                     "@type": "Organization",
                     "name": "National Bioinformatics Infrastructure Sweden",
                     "alternateName": ["NBIS",
-                                       "ELIXIR Sweden"],
+                                      "ELIXIR Sweden"],
                     "logo": "http://nbis.se/assets/img/logos/nbislogo-green.svg",
                     "url": "https://nbis.se/"
                 },
@@ -97,11 +98,10 @@ def get(self):
                     "@type": "CreativeWork",
                     "name": "GNU General Public License v3.0",
                     "url": "https://www.gnu.org/licenses/gpl-3.0.en.html"
-                }
-            }
+                }}
 
         if dataset:
-            dataset_schema = {'@type':"Dataset"}
+            dataset_schema = {'@type': "Dataset"}
 
             try:
                 dataset_version = db.get_dataset_version(dataset, version)
@@ -109,10 +109,10 @@ def get(self):
                     self.send_error(status_code=404)
                     return
 
-
                 if dataset_version.available_from > datetime.now():
                     # If it's not available yet, only return if user is admin.
-                    if not (self.current_user and self.current_user.is_admin(dataset_version.dataset)):
+                    if not (self.current_user and
+                            self.current_user.is_admin(dataset_version.dataset)):
                         self.send_error(status_code=403)
                         return
 
@@ -126,14 +126,15 @@ def get(self):
 
                 base["dataset"] = dataset_schema
 
-            except db.DatasetVersion.DoesNotExist as e:
-                logging.error("Dataset version does not exist: {}".format(e))
-            except db.DatasetVersionCurrent.DoesNotExist as e:
-                logging.error("Dataset does not exist: {}".format(e))
+            except db.DatasetVersion.DoesNotExist as err:
+                logging.error(f"Dataset version does not exist: {err}")
+            except db.DatasetVersionCurrent.DoesNotExist as err:
+                logging.error(f"Dataset does not exist: {err}")
 
         if beacon:
             base = {"@context": "http://schema.org",
-                    "@id": "https://swefreq.nbis.se/api/beacon-elixir/",  # or maybe "se.nbis.swefreq" as in the beacon api?
+                    # or maybe "se.nbis.swefreq" as in the beacon api?
+                    "@id": "https://swefreq.nbis.se/api/beacon-elixir/",
                     "@type": "Beacon",
                     "dataset": [dataset_schema],
                     "dct:conformsTo": "https://bioschemas.org/specifications/drafts/Beacon/",
@@ -143,8 +144,7 @@ def get(self):
                     "description": "Beacon API Web Server based on the GA4GH Beacon API",
                     "version": "1.1.0",  # beacon api version
                     "aggregator": False,
-                    "url": "https://swefreq.nbis.se/api/beacon-elixir/"
-                   }
+                    "url": "https://swefreq.nbis.se/api/beacon-elixir/"}
 
         self.finish(base)
 
@@ -163,8 +163,8 @@ def get(self):
                        .where(db.DatasetVersion.available_from > datetime.now(),
                               db.DatasetAccess.user == user,
                               db.DatasetAccess.is_admin))
-            for f in futures:
-                dataset = build_dataset_structure(f, user)
+            for fut in futures:
+                dataset = build_dataset_structure(fut, user)
                 dataset['future'] = True
                 ret.append(dataset)
 
@@ -173,7 +173,7 @@ def get(self):
             dataset['current'] = True
             ret.append(dataset)
 
-        self.finish({'data':ret})
+        self.finish({'data': ret})
 
 
 class GetDataset(handlers.UnsafeHandler):
@@ -211,23 +211,23 @@ def get(self, dataset):
         data = []
         found_current = False
         versions = sorted(versions, key=lambda version: version.version)
-        for v in reversed(versions):
+        for ver in reversed(versions):
             current = False
             future = False
 
             # Skip future versions unless admin
-            if v.available_from > datetime.now():
+            if ver.available_from > datetime.now():
                 if not (user and user.is_admin(dataset)):
                     continue
                 future = True
 
             # Figure out if this is the current version
-            if not found_current and v.available_from < datetime.now():
+            if not found_current and ver.available_from < datetime.now():
                 found_current = True
                 current = True
 
-            data.insert(0, {'name': v.version,
-                            'available_from': v.available_from.strftime('%Y-%m-%d'),
+            data.insert(0, {'name': ver.version,
+                            'available_from': ver.available_from.strftime('%Y-%m-%d'),
                             'current': current,
                             'future': future})
 
@@ -243,20 +243,20 @@ def post(self, dataset, ds_version=None):
             self.send_error(status_code=404)
             return
 
-        lh = db.Linkhash.create(user=user,
-                                dataset_version=dataset_version,
-                                hash=uuid.uuid4().hex,
-                                expires_on=datetime.now() + timedelta(hours=3))
+        link_hash = db.Linkhash.create(user=user,
+                                       dataset_version=dataset_version,
+                                       hash=uuid.uuid4().hex,
+                                       expires_on=datetime.now() + timedelta(hours=3))
 
         try:
             (db.Linkhash.delete()
-            .where(db.Linkhash.expires_on < datetime.now())
-            .execute())
-        except peewee.OperationalError as e:
-            logging.error("Could not clean old linkhashes: {}".format(e))
+             .where(db.Linkhash.expires_on < datetime.now())
+             .execute())
+        except peewee.OperationalError as err:
+            logging.error(f"Could not clean old linkhashes: {err}")
 
-        self.finish({'hash': lh.hash,
-                     'expires_on': lh.expires_on.strftime("%Y-%m-%d %H:%M")}) #pylint: no-member
+        self.finish({'hash': link_hash.hash,
+                     'expires_on': link_hash.expires_on.strftime("%Y-%m-%d %H:%M")})
 
 
 class DatasetFiles(handlers.AuthorizedHandler):
@@ -268,11 +268,11 @@ def get(self, dataset, ds_version=None):
             return
 
         ret = []
-        for f in dataset_version.files:
-            d = db.build_dict_from_row(f)
-            d['dirname'] = path.dirname(d['uri'])
-            d['human_size'] = format_bytes(d['file_size'])
-            ret.append(d)
+        for dv_file in dataset_version.files:
+            file_dict = db.build_dict_from_row(dv_file)
+            file_dict['dirname'] = path.dirname(file_dict['uri'])
+            file_dict['human_size'] = format_bytes(file_dict['file_size'])
+            ret.append(file_dict)
 
         self.finish({'files': ret})
 
@@ -293,14 +293,11 @@ def get(self, dataset, ds_version=None):
 
         for sample_set in dataset.sample_sets:
             collection = sample_set.collection
-            if not collection.name in collections:
-                collections[collection.name] = {
-                        'sample_sets': [],
-                        'ethnicity': collection.ethnicity,
-                    }
+            if collection.name not in collections:
+                collections[collection.name] = {'sample_sets': [],
+                                                'ethnicity': collection.ethnicity}
             collections[collection.name]['sample_sets'].append(db.build_dict_from_row(sample_set))
 
-
         ret = {
             'collections': collections,
             'study':       db.build_dict_from_row(dataset.study)
@@ -399,20 +396,20 @@ def post(self, dataset):
         user.affiliation = affiliation
         user.country = country
 
-        logging.info("Inserting into database: {}, {}".format(user.name, user.email))
+        logging.info(f"Inserting into database: {user.name}, {user.email}")
 
         try:
             with db.database.atomic():
-                user.save() # Save to database
-                (da, _) = db.DatasetAccess.get_or_create(user=user,
-                                                         dataset=dataset)
-                da.wants_newsletter = newsletter
-                da.save()
+                user.save()  # Save to database
+                ds_access, _ = db.DatasetAccess.get_or_create(user=user,
+                                                              dataset=dataset)
+                ds_access.wants_newsletter = newsletter
+                ds_access.save()
                 db.UserAccessLog.create(user=user,
                                         dataset=dataset,
                                         action='access_requested')
-        except peewee.OperationalError as e:
-            logging.error(f"Database Error: {e}")
+        except peewee.OperationalError as err:
+            logging.error(f"Database Error: {err}")
 
 
 class LogEvent(handlers.SafeHandler):
@@ -422,14 +419,14 @@ def post(self, dataset, event, target):
 
         if event == 'consent':
             user.save()
-            dv = (db.DatasetVersion
-                  .select()
-                  .join(db.Dataset)
-                  .where(db.DatasetVersion.version == target,
-                         db.Dataset.short_name == dataset)
-                  .get())
+            ds_version = (db.DatasetVersion
+                          .select()
+                          .join(db.Dataset)
+                          .where(db.DatasetVersion.version == target,
+                                 db.Dataset.short_name == dataset)
+                          .get())
             db.UserConsentLog.create(user=user,
-                                     dataset_version=dv)
+                                     dataset_version=ds_version)
         else:
             raise tornado.web.HTTPError(400, reason="Can't log that")
 
@@ -442,12 +439,12 @@ def post(self, dataset, email):
 
             user = db.User.select().where(db.User.email == email).get()
 
-            da = db.DatasetAccess.select().where(
-                        db.DatasetAccess.user == user,
-                        db.DatasetAccess.dataset == dataset
-                ).get()
-            da.has_access = True
-            da.save()
+            ds_access = (db.DatasetAccess.select()
+                         .where(db.DatasetAccess.user == user,
+                                db.DatasetAccess.dataset == dataset)
+                         .get())
+            ds_access.has_access = True
+            ds_access.save()
 
             db.UserAccessLog.create(user=user,
                                     dataset=dataset,
@@ -467,10 +464,10 @@ def post(self, dataset, email):
 
             server = smtplib.SMTP(settings.mail_server)
             server.sendmail(msg['from'], [msg['to']], msg.as_string())
-        except smtplib.SMTPException as e:
-            logging.error("Email error: {}".format(e))
-        except socket.gaierror as e:
-            logging.error("Email error: {}".format(e))
+        except smtplib.SMTPException as err:
+            logging.error(f"Email error: {err}")
+        except socket.gaierror as err:
+            logging.error(f"Email error: {err}")
 
         self.finish()
 
@@ -486,26 +483,25 @@ def post(self, dataset, email):
                                     dataset=dataset,
                                     action='access_revoked')
 
+
 def _build_json_response(query, access_for):
     json_response = []
     for user in query:
-        applyDate = '-'
+        apply_date = '-'
         access = access_for(user)
         if not access:
             continue
         access = access[0]
         if access.access_requested:
-            applyDate = access.access_requested.strftime('%Y-%m-%d')
+            apply_date = access.access_requested.strftime('%Y-%m-%d')
 
-        data = {
-                'user':        user.name,
-                'email':       user.email,
+        data = {'user': user.name,
+                'email': user.email,
                 'affiliation': user.affiliation,
-                'country':     user.country,
-                'newsletter':  access.wants_newsletter,
-                'has_access':  access.has_access,
-                'applyDate':   applyDate
-            }
+                'country': user.country,
+                'newsletter': access.wants_newsletter,
+                'has_access': access.has_access,
+                'applyDate': apply_date}
         json_response.append(data)
     return json_response
 
@@ -516,8 +512,8 @@ def get(self, dataset):
         dataset = db.get_dataset(dataset)
         users = db.User.select()
         access = (db.DatasetAccessPending
-                   .select()
-                   .where(db.DatasetAccessPending.dataset == dataset))
+                  .select()
+                  .where(db.DatasetAccessPending.dataset == dataset))
         query = peewee.prefetch(users, access)
 
         self.finish({'data': _build_json_response(query, lambda u: u.access_pending)})
@@ -542,22 +538,22 @@ def get(self):
         ret = {"data": []}
 
         for access in user.access_pending:
-            d = {}
-            d['short_name'] = access.dataset.short_name
-            d['wants_newsletter'] = access.wants_newsletter
-            d['is_admin'] = False
-            d['access'] = False
+            accessp_dict = {}
+            accessp_dict['short_name'] = access.dataset.short_name
+            accessp_dict['wants_newsletter'] = access.wants_newsletter
+            accessp_dict['is_admin'] = False
+            accessp_dict['access'] = False
 
-            ret['data'].append(d)
+            ret['data'].append(accessp_dict)
 
         for access in user.access_current:
-            d = {}
-            d['short_name'] = access.dataset.short_name
-            d['wants_newsletter'] = access.wants_newsletter
-            d['is_admin'] = access.is_admin
-            d['access'] = True
+            accessc_dict = {}
+            accessc_dict['short_name'] = access.dataset.short_name
+            accessc_dict['wants_newsletter'] = access.wants_newsletter
+            accessc_dict['is_admin'] = access.is_admin
+            accessc_dict['access'] = True
 
-            ret['data'].append(d)
+            ret['data'].append(accessc_dict)
 
         self.finish(ret)
 
@@ -566,13 +562,10 @@ class ServeLogo(handlers.UnsafeHandler):
     def get(self, dataset):
         dataset, _ = utils.parse_dataset(dataset)
         try:
-            logo_entry = db.DatasetLogo.select(
-                    db.DatasetLogo
-                ).join(
-                    db.Dataset
-                ).where(
-                    db.Dataset.short_name == dataset
-                ).get()
+            logo_entry = (db.DatasetLogo.select(db.DatasetLogo)
+                          .join(db.Dataset)
+                          .where(db.Dataset.short_name == dataset)
+                          .get())
         except db.DatasetLogo.DoesNotExist:
             self.send_error(status_code=404)
             return
@@ -587,7 +580,7 @@ class SFTPAccess(handlers.SafeHandler):
     def get(self):
         """Returns sFTP credentials for the current user."""
         if db.get_admin_datasets(self.current_user).count() <= 0:
-            self.finish({'user':None, 'expires':None, 'password':None})
+            self.finish({'user': None, 'expires': None, 'password': None})
             return
 
         password = None
@@ -602,9 +595,9 @@ def get(self):
             # Otherwise return empty values
             pass
 
-        self.finish({'user':username,
-                     'expires':expires,
-                     'password':password})
+        self.finish({'user': username,
+                     'expires': expires,
+                     'password': password})
 
     def post(self):
         """
@@ -613,7 +606,7 @@ def post(self):
         new password and expiry date.
         """
         if db.get_admin_datasets(self.current_user).count() <= 0:
-            self.finish({'user':None, 'expires':None, 'password':None})
+            self.finish({'user': None, 'expires': None, 'password': None})
             return
 
         # Create a new password
@@ -639,9 +632,9 @@ def post(self):
                                 password_hash=passwd_hash,
                                 account_expires=expires).execute())
 
-        self.finish({'user':username,
-                     'expires':expires.strftime("%Y-%m-%d %H:%M"),
-                     'password':password})
+        self.finish({'user': username,
+                     'expires': expires.strftime("%Y-%m-%d %H:%M"),
+                     'password': password})
 
     def generate_password(self, size: int = 12) -> str:
         """

From 0ea314b263a13e8f57fa519b0a83185883ef320d Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 10:35:46 +0200
Subject: [PATCH 054/126] Add a few disables.

---
 .pylintrc | 6 +++++-
 1 file changed, 5 insertions(+), 1 deletion(-)

diff --git a/.pylintrc b/.pylintrc
index c8f1f04a7..a9175f863 100644
--- a/.pylintrc
+++ b/.pylintrc
@@ -59,7 +59,11 @@ confidence=
 # --enable=similarities". If you want to run only the classes checker, but have
 # no Warning level messages displayed, use"--disable=all --enable=classes
 # --disable=W"
-disable=
+disable=too-few-public-methods,
+	missing-docstring,
+	logging-not-lazy,
+	logging-fstring-interpolation,
+	logging-format-interpolation
 
 # Enable the message, report, category or checker with the given id(s). You can
 # either give multiple identifier separated by comma (,) or put this option

From 661bd8a1d947ecce07c76736a2e57a4f4b1973c5 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 10:37:40 +0200
Subject: [PATCH 055/126] A few additional fixes.

---
 backend/db.py | 10 ++++++----
 1 file changed, 6 insertions(+), 4 deletions(-)

diff --git a/backend/db.py b/backend/db.py
index 7cb1d5442..1c6958cc8 100644
--- a/backend/db.py
+++ b/backend/db.py
@@ -1,7 +1,7 @@
 #!/usr/bin/env python3
 
 import logging
-import settings
+
 from peewee import (BlobField,
                     BooleanField,
                     CharField,
@@ -15,6 +15,8 @@
                     fn)
 from playhouse.postgres_ext import ArrayField, BinaryJSONField, PostgresqlExtDatabase
 
+import settings
+
 database = PostgresqlExtDatabase(settings.psql_name,
                                  user=settings.psql_user,
                                  password=settings.psql_pass,
@@ -609,10 +611,10 @@ def get_dataset_version(dataset: str, version: str = None):
 
 def build_dict_from_row(row) -> dict:
     """Build a dictionary from a row object"""
-    d = {}
+    outdict = {}
 
     for field, value in row.__dict__['__data__'].items():
         if field == "id":
             continue
-        d[field] = value
-    return d
+        outdict[field] = value
+    return outdict

From e17870ecdd0ca0943ab2b3be1a95fd955c707a3d Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 10:47:20 +0200
Subject: [PATCH 056/126] Some pylint and flake8 fixes.

---
 backend/handlers.py | 66 ++++++++++++++++++++++-----------------------
 1 file changed, 33 insertions(+), 33 deletions(-)

diff --git a/backend/handlers.py b/backend/handlers.py
index 5c171eb0f..21809a6fc 100644
--- a/backend/handlers.py
+++ b/backend/handlers.py
@@ -1,13 +1,14 @@
 import logging
-import peewee
-import tornado.auth
-import tornado.web
-import tornado.escape
-import tornado.httpclient
 import os.path
 import datetime
 import urllib.parse
+
+import peewee
+import tornado.auth
+import tornado.escape
 from tornado.escape import json_encode
+import tornado.httpclient
+import tornado.web
 
 import db
 
@@ -19,13 +20,13 @@ class directly but from either SafeHandler or UnsafeHandler
     to make security status explicit.
     """
     def prepare(self):
-        ## Make sure we have the xsrf_token, this will generate the xsrf cookie if it isn't set
-        self.xsrf_token #pylint: disable=pointless-statement
+        # Make sure we have the xsrf_token, this will generate the xsrf cookie if it isn't set
+        self.xsrf_token
         if db.database.is_closed():
             try:
                 db.database.connect()
-            except peewee.DatabaseError as e:
-                logging.error("Failed to connect to database: {}".format(e))
+            except peewee.DatabaseError as err:
+                logging.error(f"Failed to connect to database: {err}")
 
     def on_finish(self):
         if not db.database.is_closed():
@@ -33,7 +34,7 @@ def on_finish(self):
 
     def get_current_user(self):
         email = self.get_secure_cookie('email')
-        name  = self.get_secure_cookie('user')
+        name = self.get_secure_cookie('user')
         identity = self.get_secure_cookie('identity')
 
         # Fix ridiculous bug with quotation marks showing on the web
@@ -42,15 +43,15 @@ def get_current_user(self):
 
         if identity:
             try:
-                return db.User.select().where( db.User.identity == identity ).get()
+                return db.User.select().where(db.User.identity == identity).get()
             except db.User.DoesNotExist:
-                ## Not saved in the database yet
+                # Not saved in the database yet
                 try:
-                    return db.User(email = email.decode('utf-8'),
-                                   name  = name.decode('utf-8'),
-                                   identity = identity.decode('utf-8'))
-                except peewee.OperationalError as e:
-                    logging.error("Can't create new user: {}".format(e))
+                    return db.User(email=email.decode('utf-8'),
+                                   name=name.decode('utf-8'),
+                                   identity=identity.decode('utf-8'))
+                except peewee.OperationalError as err:
+                    logging.error(f"Can't create new user: {err}")
         else:
             return None
 
@@ -62,7 +63,7 @@ def set_user_msg(self, msg, level="info"):
         """
         if level not in ["success", "info", "warning", "error"]:
             level = "info"
-        self.set_cookie("msg", urllib.parse.quote( json_encode({"msg":msg, "level":level}) ) )
+        self.set_cookie("msg", urllib.parse.quote(json_encode({"msg": msg, "level": level})))
 
     def write_error(self, status_code, **kwargs):
         """
@@ -78,6 +79,7 @@ def write(self, chunk):
         new_chunk = _convert_keys_to_hump_back(chunk)
         super().write(new_chunk)
 
+
 def _convert_keys_to_hump_back(chunk):
     """
     Converts keys given in snake_case to humpBack-case, while preserving the
@@ -128,7 +130,7 @@ def prepare(self):
             return
 
         kwargs = self.path_kwargs
-        if not 'dataset' in kwargs:
+        if 'dataset' not in kwargs:
             logging.debug("No dataset: Send error 403")
             self.send_error(status_code=403)
             return
@@ -152,7 +154,7 @@ def prepare(self):
             logging.debug("No dataset: Send error 403")
             self.send_error(status_code=403)
             return
-        if not self.current_user.is_admin( db.get_dataset(kwargs['dataset']) ):
+        if not self.current_user.is_admin(db.get_dataset(kwargs['dataset'])):
             logging.debug("No user admin: Send error 403")
             self.send_error(status_code=403)
             return
@@ -198,7 +200,7 @@ def get(self, dataset, file, ds_version=None, user=None):
             self.send_error(status_code=403)
             return
 
-        db.UserDownloadLog.create(user = user, dataset_file = dbfile)
+        db.UserDownloadLog.create(user=user, dataset_file=dbfile)
 
         abspath = os.path.abspath(os.path.join(self.root, file))
         self.set_header("X-Accel-Redirect", abspath)
@@ -226,21 +228,19 @@ class AuthorizedStaticNginxFileHandler(AuthorizedHandler, BaseStaticNginxFileHan
 class TemporaryStaticNginxFileHandler(BaseStaticNginxFileHandler):
     def get(self, dataset, ds_version, hash_value, file):
         logging.debug("Want to download hash {} ({})".format(hash_value, file))
-        linkhash = (db.Linkhash
-                        .select()
-                        .join(db.DatasetVersion)
-                        .join(db.DatasetFile)
-                        .where(db.Linkhash.hash == hash_value,
-                               db.Linkhash.expires_on > datetime.datetime.now(),
-                               db.DatasetFile.name == file))
+        linkhash = (db.Linkhash.select()
+                    .join(db.DatasetVersion)
+                    .join(db.DatasetFile)
+                    .where(db.Linkhash.hash == hash_value,
+                           db.Linkhash.expires_on > datetime.datetime.now(),
+                           db.DatasetFile.name == file))
         if linkhash.count() > 0:
             logging.debug("Linkhash valid")
             # Get temporary user from hash_value
-            user = (db.User
-                       .select(db.User)
-                       .join(db.Linkhash)
-                       .where(db.Linkhash.hash == hash_value)
-                   ).get()
+            user = (db.User.select(db.User)
+                    .join(db.Linkhash)
+                    .where(db.Linkhash.hash == hash_value)
+                    .get())
             super().get(dataset, file, ds_version, user)
         else:
             logging.debug("Linkhash invalid")

From cc9c7cbc07155e917617d8096023a68d69009506 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 10:58:27 +0200
Subject: [PATCH 057/126] Pylint/flake fixes.

---
 backend/route.py | 104 +++++++++++++++++++++++------------------------
 1 file changed, 52 insertions(+), 52 deletions(-)

diff --git a/backend/route.py b/backend/route.py
index bf75d164f..81f5f9b8b 100644
--- a/backend/route.py
+++ b/backend/route.py
@@ -1,10 +1,11 @@
 import logging
+import sys
+
 import tornado.httpserver
 import tornado.ioloop
-import tornado.web
 from tornado.options import define, options
+import tornado.web
 
-import sys
 import application
 import handlers
 import auth
@@ -17,77 +18,76 @@
 
 # Setup the Tornado Application
 tornado_settings = {"debug": False,
-            "cookie_secret": swefreq_settings.cookie_secret,
-            "login_url": "/login",
-            "elixir_oauth": {
-                "id": swefreq_settings.elixir["id"],
-                "secret": swefreq_settings.elixir["secret"],
-                "redirect_uri": swefreq_settings.elixir["redirectUri"],
-            },
-            "xsrf_cookies": True,
-            "template_path": "templates/",
-        }
+                    "cookie_secret": swefreq_settings.cookie_secret,
+                    "login_url": "/login",
+                    "elixir_oauth": {
+                        "id": swefreq_settings.elixir["id"],
+                        "secret": swefreq_settings.elixir["secret"],
+                        "redirect_uri": swefreq_settings.elixir["redirectUri"],
+                    },
+                    "xsrf_cookies": True,
+                    "template_path": "templates/"}
+
 
 class Application(tornado.web.Application):
     def __init__(self, settings):
         self.declared_handlers = [
-            ## Static handlers
-            (r"/static/(.*)",                                                        tornado.web.StaticFileHandler,
-                                                                                         {"path": "static/"}),
-            (r'/(favicon.ico)',                                                      tornado.web.StaticFileHandler,
-                                                                                         {"path": "static/img/"}),
-            (r"/release/(?P<dataset>[^\/]+)/versions/(?P<ds_version>[^/]+)/(?P<hash_value>[^\/]+)/(?P<file>[^\/]+)", handlers.TemporaryStaticNginxFileHandler,
-                                                                                         {"path": "/release-files/"}),
-            (r"/release/(?P<dataset>[^\/]+)/versions/(?P<ds_version>[^/]+)/(?P<file>[^\/]+)", handlers.AuthorizedStaticNginxFileHandler,
-                                                                                         {"path": "/release-files/"}),
-            ## Authentication
-            (r"/logout",                                                              auth.ElixirLogoutHandler),
-            (r"/elixir/login",                                                        auth.ElixirLoginHandler),
-            (r"/elixir/logout",                                                       auth.ElixirLogoutHandler),
-            ## API Methods
-            (r"/api/countries",                                                       application.CountryList),
-            (r"/api/users/me",                                                        application.GetUser),
-            (r"/api/users/datasets",                                                  application.UserDatasetAccess),
-            (r"/api/users/sftp_access",                                               application.SFTPAccess),
-            (r"/api/schema",                                                          application.GetSchema),
-            ### Dataset Api
-            (r"/api/dataset",                                                        application.ListDatasets),
-            (r"/api/dataset/(?P<dataset>[^\/]+)",                                    application.GetDataset),
+            # Static handlers
+            (r"/static/(.*)", tornado.web.StaticFileHandler, {"path": "static/"}),
+            (r'/(favicon.ico)', tornado.web.StaticFileHandler, {"path": "static/img/"}),
+            (r"/release/(?P<dataset>[^\/]+)/versions/(?P<ds_version>[^/]+)/(?P<hash_value>[^\/]+)/(?P<file>[^\/]+)",
+             handlers.TemporaryStaticNginxFileHandler,
+             {"path": "/release-files/"}),
+            (r"/release/(?P<dataset>[^\/]+)/versions/(?P<ds_version>[^/]+)/(?P<file>[^\/]+)",
+             handlers.AuthorizedStaticNginxFileHandler,
+             {"path": "/release-files/"}),
+            # Authentication
+            (r"/logout", auth.ElixirLogoutHandler),
+            (r"/elixir/login", auth.ElixirLoginHandler),
+            (r"/elixir/logout", auth.ElixirLogoutHandler),
+            # API Methods
+            (r"/api/countries", application.CountryList),
+            (r"/api/users/me", application.GetUser),
+            (r"/api/users/datasets", application.UserDatasetAccess),
+            (r"/api/users/sftp_access", application.SFTPAccess),
+            (r"/api/schema", application.GetSchema),
+            # Dataset Api
+            (r"/api/dataset", application.ListDatasets),
+            (r"/api/dataset/(?P<dataset>[^\/]+)", application.GetDataset),
             (r"/api/dataset/(?P<dataset>[^\/]+)/log/(?P<event>[^\/]+)/(?P<target>[^\/]+)", application.LogEvent),
-            (r"/api/dataset/(?P<dataset>[^\/]+)/logo",                               application.ServeLogo),
+            (r"/api/dataset/(?P<dataset>[^\/]+)/logo", application.ServeLogo),
             (r"/api/dataset/(?P<dataset>[^\/]+)/(?:versions/(?P<ds_version>[^/]+)/)?files", application.DatasetFiles),
             (r"/api/dataset/(?P<dataset>[^\/]+)/(?:versions/(?P<ds_version>[^/]+)/)?collection", application.Collection),
-            (r"/api/dataset/(?P<dataset>[^\/]+)/users_current",                      application.DatasetUsersCurrent),
-            (r"/api/dataset/(?P<dataset>[^\/]+)/users_pending",                      application.DatasetUsersPending),
+            (r"/api/dataset/(?P<dataset>[^\/]+)/users_current", application.DatasetUsersCurrent),
+            (r"/api/dataset/(?P<dataset>[^\/]+)/users_pending", application.DatasetUsersPending),
             (r"/api/dataset/(?P<dataset>[^\/]+)/(?:versions/(?P<ds_version>[^/]+)/)?temporary_link", application.GenerateTemporaryLink),
-            (r"/api/dataset/(?P<dataset>[^\/]+)/users/[^\/]+/request",               application.RequestAccess),
-            (r"/api/dataset/(?P<dataset>[^\/]+)/users/(?P<email>[^\/]+)/approve",    application.ApproveUser),
-            (r"/api/dataset/(?P<dataset>[^\/]+)/users/(?P<email>[^\/]+)/revoke",     application.RevokeUser),
-            (r"/api/dataset/(?P<dataset>[^\/]+)/versions",                           application.ListDatasetVersions),
-            (r"/api/dataset/(?P<dataset>[^\/]+)/versions/(?P<version>[^\/]+)",       application.GetDataset),
+            (r"/api/dataset/(?P<dataset>[^\/]+)/users/[^\/]+/request", application.RequestAccess),
+            (r"/api/dataset/(?P<dataset>[^\/]+)/users/(?P<email>[^\/]+)/approve", application.ApproveUser),
+            (r"/api/dataset/(?P<dataset>[^\/]+)/users/(?P<email>[^\/]+)/revoke", application.RevokeUser),
+            (r"/api/dataset/(?P<dataset>[^\/]+)/versions", application.ListDatasetVersions),
+            (r"/api/dataset/(?P<dataset>[^\/]+)/versions/(?P<version>[^\/]+)", application.GetDataset),
             (r"/api/dataset/(?P<dataset>[^\/]+)/versions/(?P<version>[^\/]+)/files", application.DatasetFiles),
             (r"/api/dataset/(?P<dataset>[^\/]+)/versions/(?P<version>[^\/]+)/temporary_link", application.GenerateTemporaryLink),
         ]
 
-        ## Adding module handlers
+        # Adding module handlers
         self.declared_handlers += browser_routes
 
-        ## Adding Catch all handlers
+        # Adding Catch all handlers
         self.declared_handlers += [
-            (r"/api/.*",                                                              tornado.web.ErrorHandler,
-                                                                                         {"status_code": 404} ),
-            (r'().*',                                                                 tornado.web.StaticFileHandler,
-                                                                                         {"path": "static/templates/",  "default_filename": "index.html"}),
+            (r"/api/.*", tornado.web.ErrorHandler, {"status_code": 404}),
+            (r'().*', tornado.web.StaticFileHandler, {"path": "static/templates/", "default_filename": "index.html"}),
             ]
 
-        ## Adding developer login handler
+        # Adding developer login handler
         if settings.get('develop', False):
             self.declared_handlers.insert(-1, ("/developer/login", auth.DeveloperLoginHandler))
-            self.declared_handlers.insert(-1, ("/developer/quit",  application.QuitHandler))
+            self.declared_handlers.insert(-1, ("/developer/quit", application.QuitHandler))
 
         # Setup the Tornado Application
         tornado.web.Application.__init__(self, self.declared_handlers, **settings)
 
+
 if __name__ == '__main__':
     # Make sure that the extra option to `settings` isn't upsetting tornado
     if '--settings_file' in sys.argv:
@@ -105,8 +105,8 @@ def __init__(self, settings):
         logging.getLogger().setLevel(logging.DEBUG)
 
     # Instantiate Application
-    application = Application(tornado_settings)
-    application.listen(options.port, xheaders=True)
+    tornado_application = Application(tornado_settings)
+    tornado_application.listen(options.port, xheaders=True)
 
     # Get a handle to the instance of IOLoop
     ioloop = tornado.ioloop.IOLoop.instance()

From 90196cb40a8e3a2ce31f2c7d1ad3866b38bc9cfd Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 11:19:21 +0200
Subject: [PATCH 058/126] pylint and flake fixes.

---
 backend/modules/browser/browser_handlers.py | 152 +++++++++++---------
 1 file changed, 83 insertions(+), 69 deletions(-)

diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index e782bb75e..082c7cd2f 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -13,7 +13,7 @@
 class Autocomplete(handlers.UnsafeHandler):
     """Provide autocompletion for protein names based on current query."""
 
-    def get(self, dataset:str, query:str, ds_version:str=None):
+    def get(self, dataset: str, query: str, ds_version: str = None):
         """
         Provide autocompletion for protein names based on current query.
 
@@ -34,7 +34,8 @@ def get(self, dataset:str, query:str, ds_version:str=None):
 class Download(handlers.UnsafeHandler):
     """Download variants in CSV format."""
 
-    def get(self, dataset:str, datatype:str, item:str, ds_version:str=None, filter_type:str=None):
+    def get(self, dataset: str, datatype: str, item: str,
+            ds_version: str = None, filter_type: str = None):
         """
         Download variants in CSV format.
 
@@ -49,22 +50,24 @@ def get(self, dataset:str, datatype:str, item:str, ds_version:str=None, filter_t
         """
         # ctrl.filterVariantsBy~ctrl.filterIncludeNonPass
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
-        filename = "{}_{}_{}.csv".format(dataset, datatype, item)
-        self.set_header('Content-Type','text/csv')
-        self.set_header('content-Disposition','attachement; filename={}'.format(filename))
+        self.set_header('Content-Type', 'text/csv')
+        self.set_header(f'content-Disposition',
+                        'attachement; filename={f"{dataset}_{datatype}_{item}.csv"}')
 
         data = utils.get_variant_list(dataset, datatype, item, ds_version)
         # filter variants based on what is shown
         if filter_type:
             filters = filter_type.split('~')
             if filters[1] == 'false':
-                data['variants'] = [variant for variant in data['variants'] if variant['filter_string'] == 'PASS']
+                data['variants'] = [variant for variant in data['variants']
+                                    if variant['filter_string'] == 'PASS']
             if filters[0] == 'mislof':
                 data['variants'] = [variant for variant in data['variants']
                                     if variant['major_consequence'] == 'missense'
                                     or 'LoF' in variant['flags']]
             elif 'lof' in filters[0]:
-                data['variants'] = [variant for variant in data['variants'] if 'LoF' in variant['flags']]
+                data['variants'] = [variant for variant in data['variants']
+                                    if 'LoF' in variant['flags']]
 
         # Write header
         self.write(','.join([h[1] for h in data['headers']]) + '\n')
@@ -77,7 +80,7 @@ def get(self, dataset:str, datatype:str, item:str, ds_version:str=None, filter_t
 class GetCoverage(handlers.UnsafeHandler):
     """Retrieve coverage."""
 
-    def get(self, dataset:str, datatype:str, item:str, ds_version:str=None):
+    def get(self, dataset: str, datatype: str, item: str, ds_version: str = None):
         """
         Retrieve coverage.
 
@@ -102,7 +105,7 @@ def get(self, dataset:str, datatype:str, item:str, ds_version:str=None):
 class GetCoveragePos(handlers.UnsafeHandler):
     """Retrieve coverage range."""
 
-    def get(self, dataset:str, datatype:str, item:str, ds_version:str=None):
+    def get(self, dataset: str, datatype: str, item: str, ds_version: str = None):
         """
         Retrieve coverage range.
 
@@ -128,7 +131,7 @@ def get(self, dataset:str, datatype:str, item:str, ds_version:str=None):
 class GetGene(handlers.UnsafeHandler):
     """Request information about a gene."""
 
-    def get(self, dataset:str, gene:str, ds_version:str=None):
+    def get(self, dataset: str, gene: str, ds_version: str = None):
         """
         Request information about a gene.
 
@@ -140,7 +143,7 @@ def get(self, dataset:str, gene:str, ds_version:str=None):
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
         gene_id = gene
 
-        ret = {'gene':{'gene_id': gene_id}}
+        ret = {'gene': {'gene_id': gene_id}}
 
         # Gene
         try:
@@ -161,14 +164,16 @@ def get(self, dataset:str, gene:str, ds_version:str=None):
         transcript = lookups.get_transcript(dataset, gene['canonical_transcript'], ds_version)
         ret['exons'] = []
         for exon in sorted(transcript['exons'], key=lambda k: k['start']):
-            ret['exons'] += [{'start':exon['start'], 'stop':exon['stop'], 'type':exon['feature_type']}]
+            ret['exons'] += [{'start': exon['start'],
+                              'stop': exon['stop'],
+                              'type': exon['feature_type']}]
 
         # Transcripts
         transcripts_in_gene = lookups.get_transcripts_in_gene(dataset, gene_id, ds_version)
         if transcripts_in_gene:
             ret['transcripts'] = []
             for transcript in transcripts_in_gene:
-                ret['transcripts'] += [{'transcript_id':transcript['transcript_id']}]
+                ret['transcripts'] += [{'transcript_id': transcript['transcript_id']}]
 
         # temporary fix for names
         gene['gene_name'] = gene['name']
@@ -180,7 +185,7 @@ def get(self, dataset:str, gene:str, ds_version:str=None):
 class GetRegion(handlers.UnsafeHandler):
     """Request information about genes in a region."""
 
-    def get(self, dataset:str, region:str, ds_version:str=None):
+    def get(self, dataset: str, region: str, ds_version: str = None):
         """
         Request information about genes in a region.
 
@@ -198,11 +203,9 @@ def get(self, dataset:str, region:str, ds_version:str=None):
             logging.warning('GetRegion: unable to parse region ({})'.format(region))
             return
 
-        ret = {'region':{'chrom': chrom,
-                         'start': start,
-                         'stop':  stop,
-                        },
-              }
+        ret = {'region': {'chrom': chrom,
+                          'start': start,
+                          'stop':  stop}}
 
         if utils.is_region_too_large(start, stop):
             self.send_error(status_code=400, reason='Region too large')
@@ -212,17 +215,16 @@ def get(self, dataset:str, region:str, ds_version:str=None):
         if genes_in_region:
             ret['region']['genes'] = []
             for gene in genes_in_region:
-                ret['region']['genes'] += [{'gene_id':gene['gene_id'],
-                                            'gene_name':gene['name'],
-                                            'full_gene_name':gene['full_name'],
-                                           }]
+                ret['region']['genes'] += [{'gene_id': gene['gene_id'],
+                                            'gene_name': gene['name'],
+                                            'full_gene_name': gene['full_name']}]
         self.finish(ret)
 
 
 class GetTranscript(handlers.UnsafeHandler):
     """Request information about a transcript."""
 
-    def get(self, dataset:str, transcript:str, ds_version:str=None):
+    def get(self, dataset: str, transcript: str, ds_version: str = None):
         """
         Request information about a transcript.
 
@@ -236,9 +238,8 @@ def get(self, dataset:str, transcript:str, ds_version:str=None):
         """
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
         transcript_id = transcript
-        ret = {'transcript':{},
-               'gene':{},
-              }
+        ret = {'transcript': {},
+               'gene': {}}
 
         # Add transcript information
         try:
@@ -248,22 +249,25 @@ def get(self, dataset:str, transcript:str, ds_version:str=None):
             return
 
         ret['transcript']['id'] = transcript['transcript_id']
-        ret['transcript']['number_of_CDS'] = len([t for t in transcript['exons'] if t['feature_type'] == 'CDS'])
+        ret['transcript']['number_of_CDS'] = len([t for t in transcript['exons']
+                                                  if t['feature_type'] == 'CDS'])
 
         # Add exon information
         ret['exons'] = []
         for exon in sorted(transcript['exons'], key=lambda k: k['start']):
-            ret['exons'] += [{'start':exon['start'], 'stop':exon['stop'], 'type':exon['feature_type']}]
+            ret['exons'] += [{'start': exon['start'],
+                              'stop': exon['stop'],
+                              'type': exon['feature_type']}]
 
         # Add gene information
-        gene                                = lookups.get_gene_by_dbid(transcript['gene'])
-        ret['gene']['id']                   = gene['gene_id']
-        ret['gene']['name']                 = gene['name']
-        ret['gene']['full_name']            = gene['full_name']
+        gene = lookups.get_gene_by_dbid(transcript['gene'])
+        ret['gene']['id'] = gene['gene_id']
+        ret['gene']['name'] = gene['name']
+        ret['gene']['full_name'] = gene['full_name']
         ret['gene']['canonical_transcript'] = gene['canonical_transcript']
 
-        gene_transcripts            = lookups.get_transcripts_in_gene_by_dbid(transcript['gene'])
-        ret['gene']['transcripts']  = [g['transcript_id'] for g in gene_transcripts]
+        gene_transcripts = lookups.get_transcripts_in_gene_by_dbid(transcript['gene'])
+        ret['gene']['transcripts'] = [g['transcript_id'] for g in gene_transcripts]
 
         self.finish(ret)
 
@@ -271,7 +275,7 @@ def get(self, dataset:str, transcript:str, ds_version:str=None):
 class GetVariant(handlers.UnsafeHandler):
     """Request information about a gene."""
 
-    def get(self, dataset:str, variant:str, ds_version:str=None):
+    def get(self, dataset: str, variant: str, ds_version: str = None):
         """
         Request information about a gene.
 
@@ -281,21 +285,23 @@ def get(self, dataset:str, variant:str, ds_version:str=None):
         """
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
 
-        ret = {'variant':{}}
+        ret = {'variant': {}}
         # Variant
-        v = variant.split('-')
-        if len(v) != 4:
+        split_var = variant.split('-')
+        if len(split_var) != 4:
             logging.error('GetVariant: unable to parse variant ({})'.format(variant))
             self.send_error(status_code=400, reason=f'Unable to parse variant {variant}')
         try:
-            v[1] = int(v[1])
+            split_var[1] = int(split_var[1])
         except ValueError:
             logging.error('GetVariant: position not an integer ({})'.format(variant))
-            self.send_error(status_code=400, reason=f'Position is not an integer in variant {variant}')
+            self.send_error(status_code=400,
+                            reason=f'Position is not an integer in variant {variant}')
             return
         orig_variant = variant
         try:
-            variant = lookups.get_variant(dataset, v[1], v[0], v[2], v[3], ds_version)
+            variant = lookups.get_variant(dataset, split_var[1], split_var[0],
+                                          split_var[2], split_var[3], ds_version)
         except error.NotFoundError as err:
             logging.error('Variant not found ({})'.format(orig_variant))
             self.send_error(status_code=404, reason=str(err))
@@ -303,8 +309,8 @@ def get(self, dataset:str, variant:str, ds_version:str=None):
 
         # Just get the information we need
         for item in ["variant_id", "chrom", "pos", "ref", "alt", "rsid", "allele_num",
-                     "allele_freq", "allele_count", "orig_alt_alleles", "site_quality", "quality_metrics",
-                     "transcripts", "genes"]:
+                     "allele_freq", "allele_count", "orig_alt_alleles", "site_quality",
+                     "quality_metrics", "transcripts", "genes"]:
             ret['variant'][item] = variant[item]
         ret['variant']['filter'] = variant['filter_string']
 
@@ -313,7 +319,8 @@ def get(self, dataset:str, variant:str, ds_version:str=None):
         ret['variant']['consequences'] = []
         if 'vep_annotations' in variant:
             utils.add_consequence_to_variant(variant)
-            variant['vep_annotations'] = utils.remove_extraneous_vep_annotations(variant['vep_annotations'])
+            variant['vep_annotations'] = \
+                utils.remove_extraneous_vep_annotations(variant['vep_annotations'])
             # Adds major_consequence
             variant['vep_annotations'] = utils.order_vep_by_csq(variant['vep_annotations'])
             ret['variant']['annotations'] = {}
@@ -321,20 +328,21 @@ def get(self, dataset:str, variant:str, ds_version:str=None):
                 annotation['HGVS'] = utils.get_proper_hgvs(annotation)
 
                 # Add consequence type to the annotations if it doesn't exist
-                consequence_type = annotation['Consequence'].split('&')[0]  \
-                                   .replace("_variant", "")                 \
-                                   .replace('_prime_', '\'')                \
-                                   .replace('_', ' ')
+                consequence_type = (annotation['Consequence'].split('&')[0]
+                                    .replace("_variant", "")
+                                    .replace('_prime_', '\'')
+                                    .replace('_', ' '))
                 if consequence_type not in ret['variant']['annotations']:
-                    ret['variant']['annotations'][consequence_type] = {'gene': {'name':annotation['SYMBOL'],
-                                                                                'id':annotation['Gene']},
-                                                                       'transcripts':[]}
+                    ret['variant']['annotations'][consequence_type] = \
+                        {'gene': {'name': annotation['SYMBOL'],
+                                  'id': annotation['Gene']},
+                         'transcripts': []}
 
                 ret['variant']['annotations'][consequence_type]['transcripts'] += \
-                    [{'id':           annotation['Feature'],
-                      'sift':         annotation['SIFT'].rstrip("()0123456789"),
-                      'polyphen':     annotation['PolyPhen'].rstrip("()0123456789"),
-                      'canonical':    annotation['CANONICAL'],
+                    [{'id': annotation['Feature'],
+                      'sift': annotation['SIFT'].rstrip("()0123456789"),
+                      'polyphen': annotation['PolyPhen'].rstrip("()0123456789"),
+                      'canonical': annotation['CANONICAL'],
                       'modification': annotation['HGVSp'].split(":")[1] if ':' in annotation['HGVSp'] else None}]
 
         # Dataset frequencies.
@@ -344,24 +352,29 @@ def get(self, dataset:str, variant:str, ds_version:str=None):
 
         # get the variant for other datasets with the same reference_set
         curr_dsv = db.get_dataset_version(dataset, ds_version)
-        dsvs = [db.get_dataset_version(dset.short_name) for dset in db.Dataset.select() if dset.short_name != dataset]
+        dsvs = [db.get_dataset_version(dset.short_name) for dset in db.Dataset.select()
+                if dset.short_name != dataset]
         dsvs = [dsv for dsv in dsvs if dsv.reference_set == curr_dsv.reference_set]
         dsv_groups = [(curr_dsv, variant)]
         for dsv in dsvs:
             try:
-                hit = lookups.get_variant(dsv.dataset.short_name, v[1], v[0], v[2], v[3], dsv.version)
+                hit = lookups.get_variant(dsv.dataset.short_name, split_var[1], split_var[0],
+                                          split_var[2], split_var[3], dsv.version)
             except error.NotFoundError:
                 continue
             dsv_groups.append((dsv, hit))
 
-        frequencies = {'headers':[['Dataset','pop'],
-                               ['Allele Count','acs'],
-                               ['Allele Number', 'ans'],
-                               ['Number of Homozygotes', 'homs'],
-                               ['Allele Frequency', 'freq']],
-                    'datasets':{},
-                    'total':{}}
-        term_map = {'allele_num':'ans', 'allele_count':'acs', 'allele_freq':'freq', 'hom_count':'homs'}
+        frequencies = {'headers': [['Dataset', 'pop'],
+                                   ['Allele Count', 'acs'],
+                                   ['Allele Number', 'ans'],
+                                   ['Number of Homozygotes', 'homs'],
+                                   ['Allele Frequency', 'freq']],
+                       'datasets': {},
+                       'total': {}}
+        term_map = {'allele_num': 'ans',
+                    'allele_count': 'acs',
+                    'allele_freq': 'freq',
+                    'hom_count': 'homs'}
 
         for dsv_group in dsv_groups:
             ds_name = dsv_group[0].dataset.short_name
@@ -378,7 +391,8 @@ def get(self, dataset:str, variant:str, ds_version:str=None):
                     frequencies['total'][term_map[item]] += dsv_group[1][item]
 
             if 'freq' in frequencies['total']:
-                frequencies['total']['freq'] = frequencies['total']['acs']/frequencies['total']['ans']
+                frequencies['total']['freq'] = \
+                    frequencies['total']['acs']/frequencies['total']['ans']
         ret['variant']['pop_freq'] = frequencies
 
         self.finish(ret)
@@ -387,7 +401,7 @@ def get(self, dataset:str, variant:str, ds_version:str=None):
 class GetVariants(handlers.UnsafeHandler):
     """Retrieve variants."""
 
-    def get(self, dataset:str, datatype:str, item:str, ds_version:str=None):
+    def get(self, dataset: str, datatype: str, item: str, ds_version: str = None):
         """
         Retrieve variants.
 
@@ -418,7 +432,7 @@ def get(self, dataset:str, datatype:str, item:str, ds_version:str=None):
 class Search(handlers.UnsafeHandler):
     """Perform a search for the wanted object."""
 
-    def get(self, dataset:str, query:str, ds_version:str=None):
+    def get(self, dataset: str, query: str, ds_version: str = None):
         """
         Perform a search for the wanted object.
 

From e8248d6ecd5af80e25ed5b3c6b5725c4bc889686 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 12:39:17 +0200
Subject: [PATCH 059/126] Pylint and flake fixes.

---
 backend/modules/browser/lookups.py | 110 ++++++++++++++++-------------
 1 file changed, 62 insertions(+), 48 deletions(-)

diff --git a/backend/modules/browser/lookups.py b/backend/modules/browser/lookups.py
index 00de401ca..ac7344c8c 100644
--- a/backend/modules/browser/lookups.py
+++ b/backend/modules/browser/lookups.py
@@ -12,7 +12,7 @@
 REGION_REGEX = re.compile(r'^\s*(\d+|X|Y|M|MT)\s*([-:]?)\s*(\d*)-?([\dACTG]*)-?([ACTG]*)')
 
 
-def autocomplete(dataset: str, query: str, ds_version: str=None) -> list:
+def autocomplete(dataset: str, query: str, ds_version: str = None) -> list:
     """
     Provide autocomplete suggestions based on the query.
 
@@ -31,12 +31,12 @@ def autocomplete(dataset: str, query: str, ds_version: str=None) -> list:
         raise error.NotFoundError(f'Reference set not found for dataset {dataset}.') from err
     query = (db.Gene.select(db.Gene.name)
              .where(((db.Gene.name.startswith(query)) &
-                      (db.Gene.reference_set == ref_set))))
+                     (db.Gene.reference_set == ref_set))))
     gene_names = [str(gene.name) for gene in query]
     return gene_names
 
 
-def get_awesomebar_result(dataset: str, query: str, ds_version: str=None) -> tuple:
+def get_awesomebar_result(dataset: str, query: str, ds_version: str = None) -> tuple:
     """
     Parse the search input.
 
@@ -122,12 +122,13 @@ def get_awesomebar_result(dataset: str, query: str, ds_version: str=None) -> tup
         target = match.group(0)
         target_type = 'region'
         if match.group(2) == ":":
-            target = target.replace(":","-")
+            target = target.replace(":", "-")
 
         if match.group(5) and set(match.group(4)).issubset(set("ACGT")):
             target_type = 'variant'
             try:
-                get_raw_variant(dataset, int(match.group(3)), match.group(1), match.group(4), match.group(5), ds_version)
+                get_raw_variant(dataset, int(match.group(3)), match.group(1),
+                                match.group(4), match.group(5), ds_version)
             except error.NotFoundError:
                 target_type = 'not_found'
 
@@ -136,7 +137,8 @@ def get_awesomebar_result(dataset: str, query: str, ds_version: str=None) -> tup
     return 'not_found', query
 
 
-def get_coverage_for_bases(dataset: str, chrom: str, start_pos: int, end_pos: int=None, ds_version: str=None) -> list:
+def get_coverage_for_bases(dataset: str, chrom: str, start_pos: int,
+                           end_pos: int = None, ds_version: str = None) -> list:
     """
     Get the coverage for the list of bases given by start_pos->end_pos, inclusive.
 
@@ -168,7 +170,8 @@ def get_coverage_for_bases(dataset: str, chrom: str, start_pos: int, end_pos: in
     return coverage
 
 
-def get_coverage_for_transcript(dataset: str, chrom: str, start_pos: int, end_pos: int=None, ds_version: str=None) -> list:
+def get_coverage_for_transcript(dataset: str, chrom: str, start_pos: int,
+                                end_pos: int = None, ds_version: str = None) -> list:
     """
     Get the coverage for the list of bases given by start_pos->end_pos, inclusive.
 
@@ -194,7 +197,7 @@ def get_coverage_for_transcript(dataset: str, chrom: str, start_pos: int, end_po
     return covered
 
 
-def get_exons_in_transcript(dataset: str, transcript_id: str, ds_version: str=None) -> list:
+def get_exons_in_transcript(dataset: str, transcript_id: str, ds_version: str = None) -> list:
     """
     Retrieve exons associated with the given transcript id.
 
@@ -210,7 +213,8 @@ def get_exons_in_transcript(dataset: str, transcript_id: str, ds_version: str=No
     try:
         ref_set = db.get_dataset_version(dataset, ds_version).reference_set
     except AttributeError:
-        logging.info('get_exons_in_transcript({}, {}): unable to find dataset dbid'.format(dataset, transcript_id))
+        logging.info(f'get_exons_in_transcript({dataset}, ' +
+                     f'{transcript_id}): unable to find dataset dbid')
         raise error.NotFoundError(f'Reference set not found for dataset {dataset}.')
 
     try:
@@ -221,18 +225,21 @@ def get_exons_in_transcript(dataset: str, transcript_id: str, ds_version: str=No
                              (db.Gene.reference_set == ref_set))
                       .get())
     except db.Transcript.DoesNotExist as err:
-        logging.info('get_exons_in_transcript({}, {}): unable to retrieve transcript'.format(dataset, transcript_id))
-        raise error.NotFoundError(f'Transcript {transcript_id} not found in reference data.') from err
+        logging.info('get_exons_in_transcript({dataset}, {transcript_id}): ' +
+                     'unable to retrieve transcript')
+        raise error.NotFoundError(f'Transcript {transcript_id} not found in reference.') from err
     wanted_types = ('CDS', 'UTR', 'exon')
-    features = sorted(list(db.Feature.select().where((db.Feature.transcript == transcript) &
-                                                     (db.Feature.feature_type in wanted_types)).dicts()),
+    features = sorted(list(db.Feature.select()
+                           .where((db.Feature.transcript == transcript) &
+                                  (db.Feature.feature_type in wanted_types))
+                           .dicts()),
                       key=lambda k: k['start'])
     if not features:
-        raise error.NotFoundError(f'No features found for transcript {transcript_id} in reference data.')
+        raise error.NotFoundError(f'No features found for transcript {transcript_id} in reference.')
     return features
 
 
-def get_gene(dataset:str, gene_id: str, ds_version: str=None) -> dict:
+def get_gene(dataset: str, gene_id: str, ds_version: str = None) -> dict:
     """
     Retrieve gene by gene id.
 
@@ -276,7 +283,7 @@ def get_gene_by_dbid(gene_dbid: str) -> dict:
         return {}
 
 
-def get_gene_by_name(dataset: str, gene_name: str, ds_version: str=None) -> dict:
+def get_gene_by_name(dataset: str, gene_name: str, ds_version: str = None) -> dict:
     """
     Retrieve gene by gene_name.
 
@@ -297,7 +304,7 @@ def get_gene_by_name(dataset: str, gene_name: str, ds_version: str=None) -> dict
     try:
         return (db.Gene.select()
                 .where((db.Gene.reference_set == ref_set) &
-                       (db.Gene.name==gene_name))
+                       (db.Gene.name == gene_name))
                 .dicts()
                 .get())
     except db.Gene.DoesNotExist:
@@ -309,11 +316,12 @@ def get_gene_by_name(dataset: str, gene_name: str, ds_version: str=None) -> dict
                     .dicts()
                     .get())
         except db.GeneOtherNames.DoesNotExist as err:
-            logging.info('get_gene_by_name({}, {}): unable to retrieve gene'.format(dataset, gene_name))
+            logging.info(f'get_gene_by_name({dataset}, {gene_name}): unable to retrieve gene')
             raise error.NotFoundError(f'Gene {gene_name} not found in reference data') from err
 
 
-def get_genes_in_region(dataset: str, chrom: str, start_pos: int, stop_pos: int, ds_version: str=None) -> dict:
+def get_genes_in_region(dataset: str, chrom: str, start_pos: int,
+                        stop_pos: int, ds_version: str = None) -> dict:
     """
     Retrieve genes located within a region.
 
@@ -340,7 +348,8 @@ def get_genes_in_region(dataset: str, chrom: str, start_pos: int, stop_pos: int,
     return genes
 
 
-def get_raw_variant(dataset: str, pos: int, chrom: str, ref: str, alt: str, ds_version: str=None) -> dict:
+def get_raw_variant(dataset: str, pos: int, chrom: str, ref: str,
+                    alt: str, ds_version: str = None) -> dict:
     """
     Retrieve variant by position and change.
 
@@ -387,7 +396,7 @@ def get_raw_variant(dataset: str, pos: int, chrom: str, ref: str, alt: str, ds_v
         raise error.NotFoundError(f'Variant {chrom}-{pos}-{ref}-{alt} not found') from err
 
 
-def get_transcript(dataset: str, transcript_id: str, ds_version: str=None) -> dict:
+def get_transcript(dataset: str, transcript_id: str, ds_version: str = None) -> dict:
     """
     Retrieve transcript by transcript id.
 
@@ -417,11 +426,11 @@ def get_transcript(dataset: str, transcript_id: str, ds_version: str=None) -> di
         transcript['exons'] = get_exons_in_transcript(dataset, transcript_id)
         return transcript
     except db.Transcript.DoesNotExist as err:
-        logging.info('get_transcript({}, {}): unable to retrieve transcript'.format(dataset, transcript_id))
-        raise error.NotFoundError(f'Transcript {transcript_id} not found in reference data') from err
+        logging.info(f'get_transcript({dataset}, {transcript_id}): unable to retrieve transcript')
+        raise error.NotFoundError(f'Transcript {transcript_id} not found in reference') from err
 
 
-def get_transcripts_in_gene(dataset: str, gene_id: str, ds_version: str=None) -> list:
+def get_transcripts_in_gene(dataset: str, gene_id: str, ds_version: str = None) -> list:
     """
     Get the transcripts associated with a gene.
 
@@ -437,17 +446,22 @@ def get_transcripts_in_gene(dataset: str, gene_id: str, ds_version: str=None) ->
     try:
         ref_set = db.get_dataset_version(dataset, ds_version).reference_set
     except AttributeError as err:
-        logging.warning('get_transcripts_in_gene({}, {}): unable to get referenceset dbid'.format(dataset, gene_id))
+        logging.warning(f'get_transcripts_in_gene({dataset}, {gene_id}): unable to get ref dbid')
         raise error.NotFoundError(f'Reference set not found for dataset {dataset}.') from err
 
     try:
-        gene = db.Gene.select().where((db.Gene.reference_set == ref_set) &
-                                      (db.Gene.gene_id == gene_id)).dicts().get()
+        gene = (db.Gene.select()
+                .where((db.Gene.reference_set == ref_set) &
+                       (db.Gene.gene_id == gene_id))
+                .dicts()
+                .get())
     except db.Gene.DoesNotExist as err:
-        logging.info('get_transcripts_in_gene({}, {}): unable to retrieve gene'.format(dataset, gene_id))
+        logging.info('get_transcripts_in_gene({dataset}, {gene_id}): unable to retrieve gene')
         raise error.NotFoundError(f'Gene {gene_id} not found in reference data') from err
 
-    return [transcript for transcript in db.Transcript.select().where(db.Transcript.gene == gene['id']).dicts()]
+    return [transcript for transcript in (db.Transcript.select()
+                                          .where(db.Transcript.gene == gene['id'])
+                                          .dicts())]
 
 
 def get_transcripts_in_gene_by_dbid(gene_dbid: int) -> list:
@@ -461,10 +475,13 @@ def get_transcripts_in_gene_by_dbid(gene_dbid: int) -> list:
         list: transcripts (dict) associated with the gene; empty if no hits
 
     """
-    return [transcript for transcript in db.Transcript.select().where(db.Transcript.gene == gene_dbid).dicts()]
+    return [transcript for transcript in (db.Transcript.select()
+                                          .where(db.Transcript.gene == gene_dbid)
+                                          .dicts())]
 
 
-def get_variant(dataset: str, pos: int, chrom: str, ref: str, alt: str, ds_version: str=None) -> dict:
+def get_variant(dataset: str, pos: int, chrom: str, ref: str,
+                alt: str, ds_version: str = None) -> dict:
     """
     Retrieve variant by position and change.
 
@@ -482,12 +499,12 @@ def get_variant(dataset: str, pos: int, chrom: str, ref: str, alt: str, ds_versi
     """
     variant = get_raw_variant(dataset, pos, chrom, ref, alt, ds_version)
     variant = get_raw_variant(dataset, pos, chrom, ref, alt, ds_version)
-    if variant and 'rsid' in variant and variant['rsid'] and not str(variant['rsid']).startswith('rs'):
+    if variant and variant.get('rsid') and not str(variant['rsid']).startswith('rs'):
         variant['rsid'] = 'rs{}'.format(variant['rsid'])
     return variant
 
 
-def get_variants_by_rsid(dataset: str, rsid: str, ds_version: str=None) -> list:
+def get_variants_by_rsid(dataset: str, rsid: str, ds_version: str = None) -> list:
     """
     Retrieve variants by their associated rsid.
 
@@ -505,7 +522,7 @@ def get_variants_by_rsid(dataset: str, rsid: str, ds_version: str=None) -> list:
         raise error.NotFoundError(f'Unable to find the dataset version in the database')
 
     if not rsid.startswith('rs'):
-        logging.error('get_variants_by_rsid({}, {}): rsid not starting with rs'.format(dataset, rsid))
+        logging.error('get_variants_by_rsid({dataset}, {rsid}): rsid not starting with rs')
         raise error.ParsingError('rsid not starting with rs')
 
     try:
@@ -525,7 +542,7 @@ def get_variants_by_rsid(dataset: str, rsid: str, ds_version: str=None) -> list:
     return variants
 
 
-def get_variants_in_gene(dataset: str, gene_id: str, ds_version: str=None) -> list:
+def get_variants_in_gene(dataset: str, gene_id: str, ds_version: str = None) -> list:
     """
     Retrieve variants present inside a gene.
 
@@ -545,16 +562,15 @@ def get_variants_in_gene(dataset: str, gene_id: str, ds_version: str=None) -> li
     if not gene:
         raise error.NotFoundError(f'Gene {gene_id} not found in reference data')
 
-    variants = [variant for variant in db.Variant.select()
-                                                 .join(db.VariantGenes)
-                                                 .where((db.VariantGenes.gene == gene['id']) &
-                                                        (db.Variant.dataset_version == dataset_version)).dicts()]
-    ##### remove when db is fixed
+    variants = [variant for variant in (db.Variant.select()
+                                        .join(db.VariantGenes)
+                                        .where((db.VariantGenes.gene == gene['id']) &
+                                               (db.Variant.dataset_version == dataset_version))
+                                        .dicts())]
     for variant in variants:
         if not variant['hom_count']:
             variant['hom_count'] = 0
         variant['filter'] = variant['filter_string']
-    #####
 
     for variant in variants:
         if variant['rsid']:
@@ -562,7 +578,8 @@ def get_variants_in_gene(dataset: str, gene_id: str, ds_version: str=None) -> li
     return variants
 
 
-def get_variants_in_region(dataset: str, chrom: str, start_pos: int, end_pos: int, ds_version: str=None) -> list:
+def get_variants_in_region(dataset: str, chrom: str, start_pos: int,
+                           end_pos: int, ds_version: str = None) -> list:
     """
     Variants that overlap a region.
 
@@ -590,12 +607,10 @@ def get_variants_in_region(dataset: str, chrom: str, start_pos: int, end_pos: in
 
     variants = [variant for variant in query]
 
-    ##### remove when db is fixed
     for variant in variants:
         if not variant['hom_count']:
             variant['hom_count'] = 0
         variant['filter'] = variant['filter_string']
-    #####
 
     for variant in variants:
         if variant['rsid']:
@@ -603,7 +618,7 @@ def get_variants_in_region(dataset: str, chrom: str, start_pos: int, end_pos: in
     return variants
 
 
-def get_variants_in_transcript(dataset: str, transcript_id: str, ds_version: str=None) -> list:
+def get_variants_in_transcript(dataset: str, transcript_id: str, ds_version: str = None) -> list:
     """
     Retrieve variants inside a transcript.
 
@@ -630,15 +645,14 @@ def get_variants_in_transcript(dataset: str, transcript_id: str, ds_version: str
                        (db.Variant.dataset_version == dataset_version))
                 .dicts()]
 
-    ##### remove when db is fixed
     for variant in variants:
         if not variant['hom_count']:
             variant['hom_count'] = 0
         variant['filter'] = variant['filter_string']
-    #####
 
     for variant in variants:
-        variant['vep_annotations'] = [anno for anno in variant['vep_annotations'] if anno['Feature'] == transcript_id]
+        variant['vep_annotations'] = [anno for anno in variant['vep_annotations']
+                                      if anno['Feature'] == transcript_id]
         if variant['rsid']:
             variant['rsid'] = 'rs{}'.format(variant['rsid'])
     return variants

From a962ad4bc4085beb319db0ed7e68e432ca86f9d3 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 12:46:58 +0200
Subject: [PATCH 060/126] Pylint and flake fixes.

---
 backend/modules/browser/utils.py | 159 ++++++++++++++++---------------
 1 file changed, 83 insertions(+), 76 deletions(-)

diff --git a/backend/modules/browser/utils.py b/backend/modules/browser/utils.py
index cc551b554..fab28332d 100644
--- a/backend/modules/browser/utils.py
+++ b/backend/modules/browser/utils.py
@@ -11,65 +11,63 @@
 
 CHROMOSOMES = ['chr%s' % x for x in range(1, 23)]
 CHROMOSOMES.extend(['chrX', 'chrY', 'chrM'])
-CHROMOSOME_TO_CODE = { item: i+1 for i, item in enumerate(CHROMOSOMES) }
+CHROMOSOME_TO_CODE = {item: i+1 for i, item in enumerate(CHROMOSOMES)}
 
 # Note that this is the current as of v81 with some included for backwards compatibility (VEP <= 75)
 
 CSQ_ORDER = ["transcript_ablation",
-"splice_acceptor_variant",
-"splice_donor_variant",
-"stop_gained",
-"frameshift_variant",
-"stop_lost",
-"start_lost",  # new in v81
-"initiator_codon_variant",  # deprecated
-"transcript_amplification",
-"inframe_insertion",
-"inframe_deletion",
-"missense_variant",
-"protein_altering_variant",  # new in v79
-"splice_region_variant",
-"incomplete_terminal_codon_variant",
-"stop_retained_variant",
-"synonymous_variant",
-"coding_sequence_variant",
-"mature_miRNA_variant",
-"5_prime_UTR_variant",
-"3_prime_UTR_variant",
-"non_coding_transcript_exon_variant",
-"non_coding_exon_variant",  # deprecated
-"intron_variant",
-"NMD_transcript_variant",
-"non_coding_transcript_variant",
-"nc_transcript_variant",  # deprecated
-"upstream_gene_variant",
-"downstream_gene_variant",
-"TFBS_ablation",
-"TFBS_amplification",
-"TF_binding_site_variant",
-"regulatory_region_ablation",
-"regulatory_region_amplification",
-"feature_elongation",
-"regulatory_region_variant",
-"feature_truncation",
-"intergenic_variant",
-""]
-
-CSQ_ORDER_DICT = {csq:i for i,csq in enumerate(CSQ_ORDER)}
+             "splice_acceptor_variant",
+             "splice_donor_variant",
+             "stop_gained",
+             "frameshift_variant",
+             "stop_lost",
+             "start_lost",  # new in v81
+             "initiator_codon_variant",  # deprecated
+             "transcript_amplification",
+             "inframe_insertion",
+             "inframe_deletion",
+             "missense_variant",
+             "protein_altering_variant",  # new in v79
+             "splice_region_variant",
+             "incomplete_terminal_codon_variant",
+             "stop_retained_variant",
+             "synonymous_variant",
+             "coding_sequence_variant",
+             "mature_miRNA_variant",
+             "5_prime_UTR_variant",
+             "3_prime_UTR_variant",
+             "non_coding_transcript_exon_variant",
+             "non_coding_exon_variant",  # deprecated
+             "intron_variant",
+             "NMD_transcript_variant",
+             "non_coding_transcript_variant",
+             "nc_transcript_variant",  # deprecated
+             "upstream_gene_variant",
+             "downstream_gene_variant",
+             "TFBS_ablation",
+             "TFBS_amplification",
+             "TF_binding_site_variant",
+             "regulatory_region_ablation",
+             "regulatory_region_amplification",
+             "feature_elongation",
+             "regulatory_region_variant",
+             "feature_truncation",
+             "intergenic_variant",
+             ""]
+
+CSQ_ORDER_DICT = {csq: i for i, csq in enumerate(CSQ_ORDER)}
 REV_CSQ_ORDER_DICT = dict(enumerate(CSQ_ORDER))
 
-METRICS = [
-    'BaseQRankSum',
-    'ClippingRankSum',
-    'DP',
-    'FS',
-    'InbreedingCoeff',
-    'MQ',
-    'MQRankSum',
-    'QD',
-    'ReadPosRankSum',
-    'VQSLOD'
-]
+METRICS = ['BaseQRankSum',
+           'ClippingRankSum',
+           'DP',
+           'FS',
+           'InbreedingCoeff',
+           'MQ',
+           'MQRankSum',
+           'QD',
+           'ReadPosRankSum',
+           'VQSLOD']
 
 PROTEIN_LETTERS_1TO3 = {
     'A': 'Ala', 'C': 'Cys', 'D': 'Asp', 'E': 'Glu',
@@ -147,13 +145,13 @@ def annotation_severity(annotation: dict) -> float:
         float: severity score
 
     """
-    rv = float(-CSQ_ORDER_DICT[worst_csq_from_csq(annotation['Consequence'])])
+    score = float(-CSQ_ORDER_DICT[worst_csq_from_csq(annotation['Consequence'])])
     if annotation['CANONICAL'] == 'YES':
-        rv += 0.1
-    return rv
+        score += 0.1
+    return score
 
 
-def get_coverage(dataset: str, datatype: str, item: str, ds_version: str=None) -> dict:
+def get_coverage(dataset: str, datatype: str, item: str, ds_version: str = None) -> dict:
     """
     Retrieve coverage for a gene/region/transcript.
 
@@ -167,7 +165,7 @@ def get_coverage(dataset: str, datatype: str, item: str, ds_version: str=None) -
         dict: start, stop, coverage list
 
     """
-    ret: dict = {'coverage':[]}
+    ret: dict = {'coverage': []}
 
     if datatype == 'gene':
         gene = lookups.get_gene(dataset, item)
@@ -175,8 +173,9 @@ def get_coverage(dataset: str, datatype: str, item: str, ds_version: str=None) -
             transcript = lookups.get_transcript(dataset, gene['canonical_transcript'])
             if transcript:
                 start = transcript['start'] - EXON_PADDING
-                stop  = transcript['stop'] + EXON_PADDING
-                ret['coverage'] = lookups.get_coverage_for_transcript(dataset, transcript['chrom'], start, stop, ds_version)
+                stop = transcript['stop'] + EXON_PADDING
+                ret['coverage'] = lookups.get_coverage_for_transcript(dataset, transcript['chrom'],
+                                                                      start, stop, ds_version)
 
     elif datatype == 'region':
         chrom, start, stop = parse_region(item)
@@ -189,13 +188,14 @@ def get_coverage(dataset: str, datatype: str, item: str, ds_version: str=None) -
         transcript = lookups.get_transcript(dataset, item)
         if transcript:
             start = transcript['start'] - EXON_PADDING
-            stop  = transcript['stop'] + EXON_PADDING
-            ret['coverage'] = lookups.get_coverage_for_transcript(dataset, transcript['chrom'], start, stop, ds_version)
+            stop = transcript['stop'] + EXON_PADDING
+            ret['coverage'] = lookups.get_coverage_for_transcript(dataset, transcript['chrom'],
+                                                                  start, stop, ds_version)
 
     return ret
 
 
-def get_coverage_pos(dataset: str, datatype: str, item: str, ds_version: str=None) -> dict:
+def get_coverage_pos(dataset: str, datatype: str, item: str, ds_version: str = None) -> dict:
     """
     Retrieve coverage range.
 
@@ -208,7 +208,7 @@ def get_coverage_pos(dataset: str, datatype: str, item: str, ds_version: str=Non
         dict: start, stop, chrom
 
     """
-    ret = {'start':None, 'stop':None, 'chrom':None}
+    ret = {'start': None, 'stop': None, 'chrom': None}
 
     if datatype == 'region':
         chrom, start, stop = parse_region(item)
@@ -225,7 +225,7 @@ def get_coverage_pos(dataset: str, datatype: str, item: str, ds_version: str=Non
             transcript = lookups.get_transcript(dataset, item, ds_version)
         if transcript:
             ret['start'] = transcript['start'] - EXON_PADDING
-            ret['stop']  = transcript['stop'] + EXON_PADDING
+            ret['stop'] = transcript['stop'] + EXON_PADDING
             ret['chrom'] = transcript['chrom']
 
     return ret
@@ -295,7 +295,7 @@ def get_protein_hgvs(annotation: dict) -> str:
 
     """
     try:
-        if '%3D' in annotation['HGVSp']: # "%3D" is "="
+        if '%3D' in annotation['HGVSp']:  # "%3D" is "="
             amino_acids = ''.join([PROTEIN_LETTERS_1TO3[aa] for aa in annotation['Amino_acids']])
             return "p." + amino_acids + annotation['Protein_position'] + amino_acids
         return annotation['HGVSp'].split(':')[-1]
@@ -321,7 +321,7 @@ def get_transcript_hgvs(annotation: dict) -> str:
         return ''
 
 
-def get_variant_list(dataset: str, datatype: str, item: str, ds_version: str=None) -> dict:
+def get_variant_list(dataset: str, datatype: str, item: str, ds_version: str = None) -> dict:
     """
     Retrieve variants for a datatype.
 
@@ -335,10 +335,17 @@ def get_variant_list(dataset: str, datatype: str, item: str, ds_version: str=Non
         dict: {variants:list, headers:list}
 
     """
-    headers = [['variant_id','Variant'], ['chrom','Chrom'], ['pos','Position'],
-               ['HGVS','Consequence'], ['filter','Filter'], ['major_consequence','Annotation'],
-               ['flags','Flags'], ['allele_count','Allele Count'], ['allele_num','Allele Number'],
-               ['hom_count','Number of Homozygous Alleles'], ['allele_freq','Allele Frequency']]
+    headers = [['variant_id', 'Variant'],
+               ['chrom', 'Chrom'],
+               ['pos', 'Position'],
+               ['HGVS', 'Consequence'],
+               ['filter', 'Filter'],
+               ['major_consequence', 'Annotation'],
+               ['flags', 'Flags'],
+               ['allele_count', 'Allele Count'],
+               ['allele_num', 'Allele Number'],
+               ['hom_count', 'Number of Homozygous Alleles'],
+               ['allele_freq', 'Allele Frequency']]
 
     if datatype == 'gene':
         variants = lookups.get_variants_in_gene(dataset, item, ds_version)
@@ -379,12 +386,12 @@ def get_variant_list(dataset: str, datatype: str, item: str, ds_version: str=Non
 
         # Format output
         def format_variant(variant):
-            variant['major_consequence'] = (variant['major_consequence'].replace('_variant','')
+            variant['major_consequence'] = (variant['major_consequence'].replace('_variant', '')
                                             .replace('_prime_', '\'')
                                             .replace('_', ' '))
 
             # This is so an array values turns into a comma separated string instead
-            return {k: ", ".join(v) if isinstance(v,list) else v for k, v in variant.items()}
+            return {k: ", ".join(v) if isinstance(v, list) else v for k, v in variant.items()}
 
         variants = list(map(format_variant, variants))
 
@@ -407,7 +414,7 @@ def order_vep_by_csq(annotation_list: list) -> list:
             ann['major_consequence'] = worst_csq_from_csq(ann['Consequence'])
         except KeyError:
             ann['major_consequence'] = ''
-    return sorted(annotation_list, key=(lambda ann:CSQ_ORDER_DICT[ann['major_consequence']]))
+    return sorted(annotation_list, key=(lambda ann: CSQ_ORDER_DICT[ann['major_consequence']]))
 
 
 def is_region_too_large(start: int, stop: int) -> bool:
@@ -426,7 +433,7 @@ def is_region_too_large(start: int, stop: int) -> bool:
     return int(stop)-int(start) > region_limit
 
 
-def parse_dataset(dataset: str, ds_version: str=None) -> tuple:
+def parse_dataset(dataset: str, ds_version: str = None) -> tuple:
     """
     Check/parse if the dataset name is in the beacon form (``reference:dataset:version``).
 
@@ -468,7 +475,7 @@ def parse_region(region: str) -> tuple:
         start = int(str_start)
         stop = int(str_stop)
     except ValueError as err:
-        raise error.ParsingError(f'Unable to parse region {region} (positions not integers).') from err
+        raise error.ParsingError(f'Unable to parse region {region} (pos not integers).') from err
 
     return chrom, start, stop
 

From a3a84f5ce05378e37c5be4047f1b4e5c7c7dcc7b Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 12:55:26 +0200
Subject: [PATCH 061/126] pylint/flake fixes in tests.

---
 backend/modules/browser/tests/test_lookups.py |  4 ++--
 backend/modules/browser/tests/test_utils.py   | 22 +++++++++----------
 2 files changed, 13 insertions(+), 13 deletions(-)

diff --git a/backend/modules/browser/tests/test_lookups.py b/backend/modules/browser/tests/test_lookups.py
index fd339211c..245f71e01 100644
--- a/backend/modules/browser/tests/test_lookups.py
+++ b/backend/modules/browser/tests/test_lookups.py
@@ -14,7 +14,7 @@ def test_autocomplete():
     """
     res = lookups.autocomplete('SweGen', 'PA')
     expected = set(["PABPC1P9", "PACSIN2", "PANX2", "PARP4P3",
-                "PARVB", "PARVG", "PATZ1", "PAXBP1", "PAXBP1-AS1"])
+                    "PARVB", "PARVG", "PATZ1", "PAXBP1", "PAXBP1-AS1"])
     assert set(res) == expected
     with pytest.raises(error.NotFoundError):
         res = lookups.autocomplete('Bad_dataset', 'PA')
@@ -54,7 +54,7 @@ def test_get_coverage_for_bases():
     coverage = lookups.get_coverage_for_bases('SweGen', '22', 46546423, 46549652)
     assert len(coverage) == 323
     expected = {'chrom': '22', 'coverage': [1.0, 1.0, 0.993, 0.91, 0.697, 0.426, 0.2, 0.009, 0.0],
-                           'dataset_version': 4, 'mean': 24.94, 'median': 24.0, 'pos': 46546430}
+                'dataset_version': 4, 'mean': 24.94, 'median': 24.0, 'pos': 46546430}
     for val in expected:
         assert coverage[0][val] == expected[val]
 
diff --git a/backend/modules/browser/tests/test_utils.py b/backend/modules/browser/tests/test_utils.py
index aaeb21beb..3c7a79787 100644
--- a/backend/modules/browser/tests/test_utils.py
+++ b/backend/modules/browser/tests/test_utils.py
@@ -127,31 +127,31 @@ def test_get_coverage_pos():
         utils.get_coverage_pos('SweGen', 'region', '1-1-10000000')
 
 
-
 def test_data_structures():
     """
     Test the constants
     """
-    assert len(utils.CSQ_ORDER) == len(set(utils.CSQ_ORDER)) # No duplicates
-    assert all(csq == utils.REV_CSQ_ORDER_DICT[utils.CSQ_ORDER_DICT[csq]] for csq in utils.CSQ_ORDER)
+    assert len(utils.CSQ_ORDER) == len(set(utils.CSQ_ORDER))  # No duplicates
+    assert all(csq == utils.REV_CSQ_ORDER_DICT[utils.CSQ_ORDER_DICT[csq]]
+               for csq in utils.CSQ_ORDER)
 
 
 def test_get_flags_from_variant():
     """
     Test get_flags_from_variant()
     """
-    fake_variant = {'vep_annotations':[{'LoF': 'LC', 'LoF_flags': 'something'},
-                                       {'LoF': '', 'LoF_flags': ''},
-                                       {'LoF': 'LC', 'LoF_flags': 'something'}]}
+    fake_variant = {'vep_annotations': [{'LoF': 'LC', 'LoF_flags': 'something'},
+                                        {'LoF': '', 'LoF_flags': ''},
+                                        {'LoF': 'LC', 'LoF_flags': 'something'}]}
     flags = utils.get_flags_from_variant(fake_variant)
     assert flags == ['LC LoF', 'LoF flag']
 
-    fake_variant = {'vep_annotations':[{'LoF': 'LC', 'LoF_flags': 'something'},
-                                       {'LoF': 'HC', 'LoF_flags': 'something'}]}
+    fake_variant = {'vep_annotations': [{'LoF': 'LC', 'LoF_flags': 'something'},
+                                        {'LoF': 'HC', 'LoF_flags': 'something'}]}
     flags = utils.get_flags_from_variant(fake_variant)
     assert flags == ['LoF', 'LoF flag']
 
-    fake_variant = {'mnps': 'no idea', 'vep_annotations':[]}
+    fake_variant = {'mnps': 'no idea', 'vep_annotations': []}
     flags = utils.get_flags_from_variant(fake_variant)
     assert flags == ['MNP']
 
@@ -212,7 +212,6 @@ def test_get_variant_list():
     res = utils.get_variant_list('SweGen', 'region', '22-16272587')
     assert len(res['variants']) == 4
 
-
     # bad requests
     with pytest.raises(error.NotFoundError):
         utils.get_variant_list('SweGen', 'transcript', 'ENSTWEIRD')
@@ -276,7 +275,8 @@ def test_remove_extraneous_vep_annotations():
     """
     annotation = [{'Consequence': 'frameshift_variant'},
                   {'Consequence': 'feature_elongation&TF_binding_site_variant'}]
-    assert utils.remove_extraneous_vep_annotations(annotation) == [{'Consequence': 'frameshift_variant'}]
+    assert utils.remove_extraneous_vep_annotations(annotation) == \
+        [{'Consequence': 'frameshift_variant'}]
 
 
 def test_worst_csq_from_csq():

From 0a14e7b24a243fb875873a8ad808f353c5b2fb3e Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 13:05:09 +0200
Subject: [PATCH 062/126] Redisable multiple tests.

---
 .pylintrc | 11 ++++++++++-
 1 file changed, 10 insertions(+), 1 deletion(-)

diff --git a/.pylintrc b/.pylintrc
index a9175f863..70dec83dc 100644
--- a/.pylintrc
+++ b/.pylintrc
@@ -63,7 +63,16 @@ disable=too-few-public-methods,
 	missing-docstring,
 	logging-not-lazy,
 	logging-fstring-interpolation,
-	logging-format-interpolation
+	logging-format-interpolation,
+	import-error,
+        missing-docstring,
+        abstract-method,
+        bad-continuation,
+        invalid-name,
+        wrong-import-order,
+        too-few-public-methods,
+        keyword-arg-before-vararg,
+        arguments-differ,
 
 # Enable the message, report, category or checker with the given id(s). You can
 # either give multiple identifier separated by comma (,) or put this option

From 5775d6678ff4f9d7e00bd718bc17abbc6b28fab7 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 13:19:15 +0200
Subject: [PATCH 063/126] Disable one more test.

---
 .pylintrc | 1 +
 1 file changed, 1 insertion(+)

diff --git a/.pylintrc b/.pylintrc
index 70dec83dc..d6608faea 100644
--- a/.pylintrc
+++ b/.pylintrc
@@ -73,6 +73,7 @@ disable=too-few-public-methods,
         too-few-public-methods,
         keyword-arg-before-vararg,
         arguments-differ,
+	attribute-defined-outside-init,
 
 # Enable the message, report, category or checker with the given id(s). You can
 # either give multiple identifier separated by comma (,) or put this option

From 4a82a20aa2a045db4eaf9f5ed98ac965e89f4111 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 13:21:51 +0200
Subject: [PATCH 064/126] pylint/flake fixing.

---
 backend/test.py | 115 ++++++++++++++++++++----------------------------
 1 file changed, 48 insertions(+), 67 deletions(-)

diff --git a/backend/test.py b/backend/test.py
index 243ebd318..64b0b41f8 100644
--- a/backend/test.py
+++ b/backend/test.py
@@ -43,8 +43,8 @@ def assertHTTPCode(self, path, code=200, method='get', *args, **kwargs):
         r = m(path, *args, **kwargs)
         self.assertEqual(r.status_code, code)
 
-    def login_user(self,user):
-        self.assertHTTPCode('/developer/login?user={}&email={}'.format(user,user), 200)
+    def login_user(self, user):
+        self.assertHTTPCode(f'/developer/login?user={user}&email={user}', 200)
 
 
 class TestEndpoints(RequestTests):
@@ -89,7 +89,7 @@ def test_user_datasets(self):
 
 
 class TestRequestAccess(RequestTests):
-    USER='e1'
+    USER = 'e1'
 
     def setUp(self):
         self.newSession()
@@ -99,7 +99,7 @@ def setUp(self):
     def tearDown(self):
         self.destroySession()
         try:
-            u = db.User.select(db.User).where(db.User.email==self.USER).get()
+            u = db.User.select(db.User).where(db.User.email == self.USER).get()
             try:
                 u.dataset_access.get().delete_instance()
             except peewee.PeeweeException:
@@ -119,11 +119,10 @@ def tearDown(self):
         if not db.database.is_closed():
             db.database.close()
 
-
     def test_login(self):
         self.login_user(self.USER)
 
-        count = db.User.select().where(db.User.email==self.USER).count()
+        count = db.User.select().where(db.User.email == self.USER).count()
         self.assertEqual(count, 0)
 
         self.assertIn('email', self.cookies)
@@ -136,12 +135,9 @@ def test_request_access_with_get(self):
     def test_request_access_without_xsrf(self):
         self.login_user(self.USER)
         r = self.post('/api/dataset/Dataset 1/users/{}/request'.format(self.USER),
-                data = {
-                        "affiliation": 'none',
-                        "country": "Sweden",
-                        "newsletter": 0,
-                    }
-                )
+                      data={"affiliation": 'none',
+                            "country": "Sweden",
+                            "newsletter": 0})
         self.assertEqual(r.status_code, 403)
 
     def test_get_xsrf_token(self):
@@ -151,13 +147,10 @@ def test_get_xsrf_token(self):
     def test_request_access_with_wrong_xsrf_1(self):
         self.login_user(self.USER)
         r = self.post('/api/dataset/Dataset 1/users/{}/request'.format(self.USER),
-                data = {
-                        "affiliation": 'none',
-                        "country": "Sweden",
-                        "newsletter": 0,
-                        "_xsrf": 'Fnurken',
-                    }
-                )
+                      data={"affiliation": 'none',
+                            "country": "Sweden",
+                            "newsletter": 0,
+                            "_xsrf": 'Fnurken'})
         self.assertEqual(r.status_code, 403)
 
     def test_request_access_with_wrong_xsrf_2(self):
@@ -168,32 +161,26 @@ def test_request_access_with_wrong_xsrf_2(self):
         self.assertIn('email', self.cookies)
 
         r = self.post('/api/dataset/Dataset 1/users/{}/request'.format(self.USER),
-                data = {
-                        "affiliation": 'none',
-                        "country": "Sweden",
-                        "newsletter": 0,
-                        "_xsrf": 'Fnurken',
-                    }
-                )
+                      data={"affiliation": 'none',
+                            "country": "Sweden",
+                            "newsletter": 0,
+                            "_xsrf": 'Fnurken'})
         self.assertEqual(r.status_code, 403)
 
     def test_request_access_correctly(self):
         self.login_user(self.USER)
 
-        count = db.User.select().where(db.User.email==self.USER).count()
+        count = db.User.select().where(db.User.email == self.USER).count()
         self.assertEqual(count, 0)
 
         r = self.post('/api/dataset/Dataset 1/users/{}/request'.format(self.USER),
-                data = {
-                        "affiliation": 'none',
-                        "country": "Sweden",
-                        "newsletter": 0,
-                        "_xsrf": self.cookies['_xsrf'],
-                    }
-                )
+                      data={"affiliation": 'none',
+                            "country": "Sweden",
+                            "newsletter": 0,
+                            "_xsrf": self.cookies['_xsrf']})
         self.assertEqual(r.status_code, 200)
 
-        count = db.User.select().where(db.User.email==self.USER).count()
+        count = db.User.select().where(db.User.email == self.USER).count()
         self.assertEqual(count, 1)
 
         r = self.get('/api/users/datasets')
@@ -289,12 +276,10 @@ def tearDown(self):
 
         if hasattr(self, '_email'):
             al = (db.UserAccessLog.select()
-                    .join(db.User)
-                    .where(
-                        (   (db.UserAccessLog.action == 'access_granted')
+                  .join(db.User)
+                  .where(((db.UserAccessLog.action == 'access_granted')
                           | (db.UserAccessLog.action == 'access_revoked'))
-                        & (db.User.email == self._email)
-                ))
+                         & (db.User.email == self._email)))
             for a in al:
                 a.delete_instance()
 
@@ -308,16 +293,15 @@ def test_admin_approve_user(self):
         self.assertHTTPCode('/api/dataset/Dataset%201/users/{}/approve'.format(email), 405)
         self.assertHTTPCode('/api/dataset/Dataset%201/users/{}/approve'.format(email), 403, 'POST')
         self.assertHTTPCode('/api/dataset/Dataset%201/users/{}/approve'.format(email), 403, 'POST',
-                data = {'_xsrf': "The wrong thing"} )
+                            data={'_xsrf': "The wrong thing"})
 
         self.assertHTTPCode('/api/dataset/Dataset%201/users/{}/approve'.format(email), 200, 'POST',
-                data = {'_xsrf': self.cookies['_xsrf']} )
-
+                            data={'_xsrf': self.cookies['_xsrf']})
 
         r = self.get('/api/dataset/Dataset%201/users_current')
-        l = [u for u in r.json()['data'] if u['email'] == email]
+        data_list = [val for val in r.json()['data'] if val['email'] == email]
 
-        self.assertEqual(len(l), 1)
+        self.assertEqual(len(data_list), 1)
 
     def test_recently_approved_user_can_list_files(self):
         self.login_user('admin1')
@@ -331,8 +315,8 @@ def test_recently_approved_user_can_list_files(self):
 
         self.newSession()
         self.login_user('admin1')
-        self.assertHTTPCode('/api/dataset/Dataset%201/users/{}/approve'.format(u['email']), 200, 'POST',
-                data = {'_xsrf': self.cookies['_xsrf']} )
+        self.assertHTTPCode(f'/api/dataset/Dataset%201/users/{u["email"]}/approve', 200, 'POST',
+                            data={'_xsrf': self.cookies['_xsrf']})
 
         self.newSession()
         self.login_user(u['email'])
@@ -361,8 +345,8 @@ def test_recently_revoked_user_cant_list_files(self):
 
         self.newSession()
         self.login_user('admin1')
-        self.assertHTTPCode('/api/dataset/Dataset%201/users/{}/revoke'.format(u['email']), 200, 'POST',
-                data = {'_xsrf': self.cookies['_xsrf']} )
+        self.assertHTTPCode(f'/api/dataset/Dataset%201/users/{u["email"]}/revoke', 200, 'POST',
+                            data={'_xsrf': self.cookies['_xsrf']})
 
         self.newSession()
         self.login_user(u['email'])
@@ -372,35 +356,32 @@ def test_full_user_roundabout(self):
         email = 'unlisted'
         self._email = email
 
-        ## Request access
+        # Request access
         self.assertHTTPCode('/api/dataset/Dataset%201/files', 403)
         self.login_user(email)
         self.assertHTTPCode('/api/dataset/Dataset%201/files', 403)
-        self.assertHTTPCode('/api/dataset/Dataset 1/users/{}/request'.format(email), 200, 'POST',
-                data = {
-                        "affiliation": 'none',
-                        "country": "Sweden",
-                        "newsletter": 0,
-                        "_xsrf": self.cookies['_xsrf'],
-                    }
-                )
+        self.assertHTTPCode(f'/api/dataset/Dataset 1/users/{email}/request', 200, 'POST',
+                            data={"affiliation": 'none',
+                                  "country": "Sweden",
+                                  "newsletter": 0,
+                                  "_xsrf": self.cookies['_xsrf']})
         self.assertHTTPCode('/api/dataset/Dataset%201/files', 403)
 
-        ## Approve user
+        # Approve user
         self.newSession()
         self.login_user('admin1')
 
         # User is in pending queue
         users = self.get('/api/dataset/Dataset%201/users_pending').json()['data']
-        u = [ x for x in users if x['email'] == email ]
+        u = [x for x in users if x['email'] == email]
         self.assertEqual(len(u), 1)
 
-        self.assertHTTPCode('/api/dataset/Dataset%201/users/{}/approve'.format(email), 200, 'POST',
-                data = {'_xsrf': self.cookies['_xsrf']} )
+        self.assertHTTPCode(f'/api/dataset/Dataset%201/users/{email}/approve', 200, 'POST',
+                            data={'_xsrf': self.cookies['_xsrf']})
 
         # User is in approved queue
         users = self.get('/api/dataset/Dataset%201/users_current').json()['data']
-        u = [ x for x in users if x['email'] == email ]
+        u = [x for x in users if x['email'] == email]
         self.assertEqual(len(u), 1)
 
         # User can log in and do stuff
@@ -412,11 +393,11 @@ def test_full_user_roundabout(self):
         self.newSession()
         self.login_user('admin1')
         self.assertHTTPCode('/api/dataset/Dataset%201/users/{}/revoke'.format(email), 200, 'POST',
-                data = {'_xsrf': self.cookies['_xsrf']} )
+                            data={'_xsrf': self.cookies['_xsrf']})
 
         # User is not in approved queue
         users = self.get('/api/dataset/Dataset%201/users_current').json()['data']
-        u = [ x for x in users if x['email'] == email ]
+        u = [x for x in users if x['email'] == email]
         self.assertEqual(len(u), 0)
 
         # User can log in but cant do stuff
@@ -450,11 +431,11 @@ def testLoggedInTempLinkPost(self):
 
     def testLoggedInTempLinkPostXSRF1(self):
         self.assertHTTPCode('/api/dataset/Dataset 1/temporary_link', 403, 'POST',
-                data = { '_xsrf': "INCORRECT"})
+                            data={'_xsrf': "INCORRECT"})
 
     def testLoggedInTempLinkPostXSRF2(self):
         self.assertHTTPCode('/api/dataset/Dataset 1/temporary_link', 200, 'POST',
-                data = {'_xsrf': self.cookies['_xsrf']} )
+                            data={'_xsrf': self.cookies['_xsrf']})
 
 
 if __name__ == '__main__':

From 822d4e2d0e4543a4ec59e36793c0415940598d58 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 14 Aug 2019 13:53:21 +0200
Subject: [PATCH 065/126] Disable no-self-use.

---
 .pylintrc | 1 +
 1 file changed, 1 insertion(+)

diff --git a/.pylintrc b/.pylintrc
index d6608faea..eb0218b05 100644
--- a/.pylintrc
+++ b/.pylintrc
@@ -74,6 +74,7 @@ disable=too-few-public-methods,
         keyword-arg-before-vararg,
         arguments-differ,
 	attribute-defined-outside-init,
+	no-self-use
 
 # Enable the message, report, category or checker with the given id(s). You can
 # either give multiple identifier separated by comma (,) or put this option

From 56a4022d9a2f82fdba39791cc27d63348244e7a9 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Thu, 15 Aug 2019 11:05:03 +0200
Subject: [PATCH 066/126] Clearify AN/AC parsing for manta

---
 scripts/importer/data_importer/raw_data_importer.py | 8 ++++++--
 1 file changed, 6 insertions(+), 2 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index e0a345047..2b3c5623e 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -240,8 +240,12 @@ def _parse_manta(self):
                                                               data['pos'],
                                                               data['ref'],
                                                               alt)
-                    data['allele_count'] = data.get('allele_count', 0)
-                    data['allele_num'] = data.get('allele_num', 0)
+                    # Note: these two fields are not present in our data, will always default to 0.
+                    # Set to 0 rather than None, as the type should be int (according to the Beacon
+                    # API specificition).
+                    data['allele_count'] = info.get('AC', 0)
+                    data['allele_num'] = info.get('AN',0)
+
                     batch += [data]
                     if self.settings.add_reversed_mates:
                         # If the vcf only contains one line per breakend,

From 2753fb1330b4e422e63fcd99d3ab7ca42a4c5286 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 06:42:13 +0200
Subject: [PATCH 067/126] Bad newline.

---
 backend/auth.py | 3 +--
 1 file changed, 1 insertion(+), 2 deletions(-)

diff --git a/backend/auth.py b/backend/auth.py
index b8637cfbe..e01911ee3 100644
--- a/backend/auth.py
+++ b/backend/auth.py
@@ -115,8 +115,7 @@ async def get_user_token(self, code):
         client_id = self.settings['elixir_oauth']['id']
         secret = self.settings['elixir_oauth']['secret']
 
-        authorization = base64.b64encode(bytes(f"{client_id}:{secret}",
-                                               'ascii')).decode('ascii')
+        authorization = base64.b64encode(bytes(f"{client_id}: {secret}", 'ascii')).decode('ascii')
 
         response = await http.fetch(self._OAUTH_ACCESS_TOKEN_URL,
                                     method="POST",

From df64521bbe08fd5a1686eb7e9d291c6fe7aa3e73 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 06:58:45 +0200
Subject: [PATCH 068/126] Minor whitespace fix.

---
 backend/modules/browser/tests/test_browser_handlers.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/backend/modules/browser/tests/test_browser_handlers.py b/backend/modules/browser/tests/test_browser_handlers.py
index b69797afb..9d251d3e3 100644
--- a/backend/modules/browser/tests/test_browser_handlers.py
+++ b/backend/modules/browser/tests/test_browser_handlers.py
@@ -4,7 +4,7 @@
 import requests
 import json
 
-BASE_URL="http://localhost:4000"
+BASE_URL = "http://localhost:4000"
 
 def test_get_autocomplete():
     """

From 195722836db91ead84a1b3fc7ea4c37f8ef5850f Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 07:24:01 +0200
Subject: [PATCH 069/126] Comment fix.

---
 backend/settings.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/backend/settings.py b/backend/settings.py
index c2e255ca0..d9482b8b2 100644
--- a/backend/settings.py
+++ b/backend/settings.py
@@ -24,7 +24,7 @@
 
 elixir = json_settings["elixir"]
 
-## Generated with base64.b64encode(uuid.uuid4().bytes + uuid.uuid4().bytes)
+# Generated with base64.b64encode(uuid.uuid4().bytes + uuid.uuid4().bytes)
 cookie_secret = json_settings["cookieSecret"]
 
 # PostgreSQL settings

From 5932f62c59e8e106422fc14816f0724b16422c4d Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 07:38:35 +0200
Subject: [PATCH 070/126] Newline fixes, comment space.

---
 backend/application.py                                 | 1 -
 backend/auth.py                                        | 1 -
 backend/modules/browser/tests/test_browser_handlers.py | 3 ++-
 3 files changed, 2 insertions(+), 3 deletions(-)

diff --git a/backend/application.py b/backend/application.py
index bf566c5bd..110db1ba2 100644
--- a/backend/application.py
+++ b/backend/application.py
@@ -21,7 +21,6 @@
 import settings
 from modules.browser import utils
 
-
 def build_dataset_structure(dataset_version, user=None, dataset=None):
     if dataset is None:
         dataset = dataset_version.dataset
diff --git a/backend/auth.py b/backend/auth.py
index e01911ee3..64aa5f622 100644
--- a/backend/auth.py
+++ b/backend/auth.py
@@ -10,7 +10,6 @@
 from handlers import BaseHandler
 
 
-
 class DeveloperLoginHandler(BaseHandler):
     def get(self):
         if not self.get_argument("user", False):
diff --git a/backend/modules/browser/tests/test_browser_handlers.py b/backend/modules/browser/tests/test_browser_handlers.py
index 9d251d3e3..5f9b485f9 100644
--- a/backend/modules/browser/tests/test_browser_handlers.py
+++ b/backend/modules/browser/tests/test_browser_handlers.py
@@ -6,6 +6,7 @@
 
 BASE_URL = "http://localhost:4000"
 
+
 def test_get_autocomplete():
     """
     Test GetAutocomplete.get()
@@ -28,7 +29,7 @@ def test_download():
     data_type = 'transcript'
     data_item = 'ENST00000438441'
     response = requests.get('{}/api/dataset/{}/browser/download/{}/{}'.format(BASE_URL, dataset, data_type, data_item))
-    assert len(response.text.split('\n')) == 180 # header + 178 + \n
+    assert len(response.text.split('\n')) == 180  # header + 178 + \n
     response = requests.get('{}/api/dataset/{}/browser/download/{}/{}/filter/all~false'.format(BASE_URL, dataset, data_type, data_item))
     import logging
     logging.error(response.text.split('\n'))

From 8d60f0f8c67928cf3848b31705b50ed5bace4bf4 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 08:13:35 +0200
Subject: [PATCH 071/126] Add row-specific disables of pylint tests.

---
 backend/application.py                        | 26 +++++++++----------
 backend/auth.py                               | 16 ++++++------
 backend/db.py                                 |  3 ++-
 backend/handlers.py                           |  2 +-
 backend/modules/browser/browser_handlers.py   |  2 +-
 backend/modules/browser/route.py              |  2 ++
 .../browser/tests/test_browser_handlers.py    |  1 +
 backend/route.py                              |  3 +++
 8 files changed, 31 insertions(+), 24 deletions(-)

diff --git a/backend/application.py b/backend/application.py
index 110db1ba2..99bd49672 100644
--- a/backend/application.py
+++ b/backend/application.py
@@ -44,7 +44,7 @@ def build_dataset_structure(dataset_version, user=None, dataset=None):
 
 
 class QuitHandler(handlers.UnsafeHandler):
-    def get(self):
+    def get(self):  # pylint: disable=no-self-use
         ioloop = tornado.ioloop.IOLoop.instance()
         ioloop.stop()
 
@@ -65,7 +65,7 @@ def get(self):
         version = None
         beacon = None
         try:
-            url = self.get_argument('url')
+            url = self.get_argument('url')  # pylint: disable=no-value-for-parameter
             match = re.match(".*/dataset/([^/]+)(/version/([^/]+))?", url)
             if match:
                 dataset = match.group(1)
@@ -255,7 +255,7 @@ def post(self, dataset, ds_version=None):
             logging.error(f"Could not clean old linkhashes: {err}")
 
         self.finish({'hash': link_hash.hash,
-                     'expires_on': link_hash.expires_on.strftime("%Y-%m-%d %H:%M")})
+                     'expires_on': link_hash.expires_on.strftime("%Y-%m-%d %H:%M")})  # pylint: disable=no-member
 
 
 class DatasetFiles(handlers.AuthorizedHandler):
@@ -299,7 +299,7 @@ def get(self, dataset, ds_version=None):
 
         ret = {
             'collections': collections,
-            'study':       db.build_dict_from_row(dataset.study)
+            'study': db.build_dict_from_row(dataset.study)
         }
         ret['study']['publication_date'] = ret['study']['publication_date'].strftime('%Y-%m-%d')
 
@@ -388,9 +388,9 @@ def post(self, dataset):
         user = self.current_user
         dataset = db.get_dataset(dataset)
 
-        affiliation = self.get_argument("affiliation", strip=False)
-        country = self.get_argument("country", strip=False)
-        newsletter = self.get_argument("newsletter", strip=False)
+        affiliation = self.get_argument("affiliation", strip=False)  # pylint: disable=no-value-for-parameter
+        country = self.get_argument("country", strip=False)  # pylint: disable=no-value-for-parameter
+        newsletter = self.get_argument("newsletter", strip=False)  # pylint: disable=no-value-for-parameter
 
         user.affiliation = affiliation
         user.country = country
@@ -452,16 +452,16 @@ def post(self, dataset, email):
         try:
             msg = MIMEMultipart()
             msg['to'] = email
-            msg['from'] = settings.from_address
+            msg['from'] = settings.from_address  # pylint: disable=no-member
             msg['subject'] = 'Swefreq access granted to {}'.format(dataset.short_name)
-            msg.add_header('reply-to', settings.reply_to_address)
+            msg.add_header('reply-to', settings.reply_to_address)  # pylint: disable=no-member
             body = """You now have access to the {} dataset
 
     Please visit https://swefreq.nbis.se/dataset/{}/download to download files.
             """.format(dataset.full_name, dataset.short_name)
             msg.attach(MIMEText(body, 'plain'))
 
-            server = smtplib.SMTP(settings.mail_server)
+            server = smtplib.SMTP(settings.mail_server)  # pylint: disable=no-member
             server.sendmail(msg['from'], [msg['to']], msg.as_string())
         except smtplib.SMTPException as err:
             logging.error(f"Email error: {err}")
@@ -472,7 +472,7 @@ def post(self, dataset, email):
 
 
 class RevokeUser(handlers.AdminHandler):
-    def post(self, dataset, email):
+    def post(self, dataset, email):  # pylint: disable=no-self-use
         dataset, _ = utils.parse_dataset(dataset)
         with db.database.atomic():
             dataset = db.get_dataset(dataset)
@@ -625,7 +625,7 @@ def post(self):
              .execute())
         except db.SFTPUser.DoesNotExist:
             # if there is no user, insert the user in the database
-            (db.SFTPUser.insert(user=self.current_user,
+            (db.SFTPUser.insert(user=self.current_user,    # pylint: disable=no-value-for-parameter
                                 user_uid=db.get_next_free_uid(),
                                 user_name=username,
                                 password_hash=passwd_hash,
@@ -635,7 +635,7 @@ def post(self):
                      'expires': expires.strftime("%Y-%m-%d %H:%M"),
                      'password': password})
 
-    def generate_password(self, size: int = 12) -> str:
+    def generate_password(self, size: int = 12) -> str:  # pylint: disable=no-self-use
         """
         Generates a password of length 'size', comprised of random lowercase and
         uppercase letters, and numbers.
diff --git a/backend/auth.py b/backend/auth.py
index 64aa5f622..eaefa63fa 100644
--- a/backend/auth.py
+++ b/backend/auth.py
@@ -17,9 +17,9 @@ def get(self):
         elif not self.get_argument("email", False):
             self.send_error(status_code=403)
 
-        self.set_secure_cookie('user', self.get_argument("user"))
-        self.set_secure_cookie('email', self.get_argument("email"))
-        self.set_secure_cookie('identity', self.get_argument("email"))
+        self.set_secure_cookie('user', self.get_argument("user"))  # pylint: disable=no-value-for-parameter
+        self.set_secure_cookie('email', self.get_argument("email"))  # pylint: disable=no-value-for-parameter
+        self.set_secure_cookie('identity', self.get_argument("email"))  # pylint: disable=no-value-for-parameter
         self.finish()
 
 
@@ -54,7 +54,7 @@ async def get(self):
                 self.redirect("/security_warning")
                 return
 
-            user_token = await self.get_user_token(self.get_argument('code'))
+            user_token = await self.get_user_token(self.get_argument('code'))  # pylint: disable=no-value-for-parameter
             user = await self.get_user(user_token["access_token"])
 
             try:
@@ -75,11 +75,11 @@ async def get(self):
             self.redirect(redirect)
 
         elif self.get_argument("error", False):
-            logging.error("Elixir error: {}".format(self.get_argument("error")))
-            logging.error(" Description: {}".format(self.get_argument("error_description")))
+            logging.error("Elixir error: {}".format(self.get_argument("error")))  # pylint: disable=no-value-for-parameter
+            logging.error(" Description: {}".format(self.get_argument("error_description")))  # pylint: disable=no-value-for-parameter
 
-            self.set_user_msg(f"Elixir Error: ,{self.get_argument('error')} " +
-                              f"{self.get_argument('error_description')}")
+            self.set_user_msg(f"Elixir Error: ,{self.get_argument('error')} " +   # pylint: disable=no-value-for-parameter
+                              f"{self.get_argument('error_description')}")  # pylint: disable=no-value-for-parameter
             self.redirect("/error")
 
         else:
diff --git a/backend/db.py b/backend/db.py
index 1c6958cc8..679bdc2cf 100644
--- a/backend/db.py
+++ b/backend/db.py
@@ -17,13 +17,14 @@
 
 import settings
 
+# pylint: disable=no-member
 database = PostgresqlExtDatabase(settings.psql_name,
                                  user=settings.psql_user,
                                  password=settings.psql_pass,
                                  host=settings.psql_host,
                                  port=settings.psql_port,
                                  register_hstore=False)
-
+# pylint: enable=no-member
 
 class BaseModel(Model):
     class Meta:
diff --git a/backend/handlers.py b/backend/handlers.py
index 21809a6fc..fcb5710b0 100644
--- a/backend/handlers.py
+++ b/backend/handlers.py
@@ -21,7 +21,7 @@ class directly but from either SafeHandler or UnsafeHandler
     """
     def prepare(self):
         # Make sure we have the xsrf_token, this will generate the xsrf cookie if it isn't set
-        self.xsrf_token
+        self.xsrf_token  # pylint: disable=pointless-statement
         if db.database.is_closed():
             try:
                 db.database.connect()
diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index 082c7cd2f..bf7d9c412 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -343,7 +343,7 @@ def get(self, dataset: str, variant: str, ds_version: str = None):
                       'sift': annotation['SIFT'].rstrip("()0123456789"),
                       'polyphen': annotation['PolyPhen'].rstrip("()0123456789"),
                       'canonical': annotation['CANONICAL'],
-                      'modification': annotation['HGVSp'].split(":")[1] if ':' in annotation['HGVSp'] else None}]
+                      'modification': annotation['HGVSp'].split(":")[1] if ':' in annotation['HGVSp'] else None}]  # pylint: disable=line-too-long
 
         # Dataset frequencies.
         # This is reported per variable in the database data, with dataset
diff --git a/backend/modules/browser/route.py b/backend/modules/browser/route.py
index 222309535..d49f2dc62 100755
--- a/backend/modules/browser/route.py
+++ b/backend/modules/browser/route.py
@@ -1,5 +1,7 @@
 from . import browser_handlers as handlers
 
+# pylint: disable=line-too-long
+
 # Browser links
 routes = [(r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/gene/(?P<gene>[^/]+)" ,                              handlers.GetGene),
           (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/region/(?P<region>[^\/]+)",                          handlers.GetRegion),
diff --git a/backend/modules/browser/tests/test_browser_handlers.py b/backend/modules/browser/tests/test_browser_handlers.py
index 5f9b485f9..34979f91b 100644
--- a/backend/modules/browser/tests/test_browser_handlers.py
+++ b/backend/modules/browser/tests/test_browser_handlers.py
@@ -6,6 +6,7 @@
 
 BASE_URL = "http://localhost:4000"
 
+# pylint: disable=line-too-long
 
 def test_get_autocomplete():
     """
diff --git a/backend/route.py b/backend/route.py
index 81f5f9b8b..f21e3e31d 100644
--- a/backend/route.py
+++ b/backend/route.py
@@ -17,6 +17,7 @@
 define("develop", default=False, help="Run in develop environment", type=bool)
 
 # Setup the Tornado Application
+# pylint: disable=no-member
 tornado_settings = {"debug": False,
                     "cookie_secret": swefreq_settings.cookie_secret,
                     "login_url": "/login",
@@ -27,7 +28,9 @@
                     },
                     "xsrf_cookies": True,
                     "template_path": "templates/"}
+# pylint: enable=no-member
 
+# pylint: disable=line-too-long
 
 class Application(tornado.web.Application):
     def __init__(self, settings):

From c5d7db296f1dc0db26cec2e7b7cb4e608e8c2f44 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 08:42:01 +0200
Subject: [PATCH 072/126] Swap import order.

---
 backend/modules/browser/tests/test_browser_handlers.py | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/backend/modules/browser/tests/test_browser_handlers.py b/backend/modules/browser/tests/test_browser_handlers.py
index 34979f91b..e0c2c025e 100644
--- a/backend/modules/browser/tests/test_browser_handlers.py
+++ b/backend/modules/browser/tests/test_browser_handlers.py
@@ -1,9 +1,10 @@
 """
 Test the browser handlers
 """
-import requests
 import json
 
+import requests
+
 BASE_URL = "http://localhost:4000"
 
 # pylint: disable=line-too-long

From 573a1c7b3380d7348d46bf500aab8d2a22ef131a Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 08:48:13 +0200
Subject: [PATCH 073/126] Fix whitespace.

---
 backend/modules/browser/route.py | 21 ++++++++++-----------
 1 file changed, 10 insertions(+), 11 deletions(-)

diff --git a/backend/modules/browser/route.py b/backend/modules/browser/route.py
index d49f2dc62..6e011009b 100755
--- a/backend/modules/browser/route.py
+++ b/backend/modules/browser/route.py
@@ -3,14 +3,13 @@
 # pylint: disable=line-too-long
 
 # Browser links
-routes = [(r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/gene/(?P<gene>[^/]+)" ,                              handlers.GetGene),
-          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/region/(?P<region>[^\/]+)",                          handlers.GetRegion),
-          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/transcript/(?P<transcript>[^/]+)",                   handlers.GetTranscript),
-          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/variant/(?P<variant>[^/]+)",                         handlers.GetVariant),
-          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/variants/(?P<datatype>[^/]+)/(?P<item>[^/]+)",       handlers.GetVariants),
-          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/coverage/(?P<datatype>[^/]+)/(?P<item>[^/]+)",       handlers.GetCoverage),
-          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/coverage_pos/(?P<datatype>[^/]+)/(?P<item>[^/]+)",   handlers.GetCoveragePos),
-          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/autocomplete/(?P<query>[^/]+)",                      handlers.Autocomplete),
-          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/search/(?P<query>[^/]+)",                            handlers.Search),
-          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/download/(?P<datatype>[^/]+)/(?P<item>[^/]+)(?:/filter/(?P<filter_type>[^/]+))?",       handlers.Download),
-        ]
+routes = [(r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/gene/(?P<gene>[^/]+)", handlers.GetGene),
+          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/region/(?P<region>[^\/]+)", handlers.GetRegion),
+          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/transcript/(?P<transcript>[^/]+)", handlers.GetTranscript),
+          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/variant/(?P<variant>[^/]+)", handlers.GetVariant),
+          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/variants/(?P<datatype>[^/]+)/(?P<item>[^/]+)", handlers.GetVariants),
+          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/coverage/(?P<datatype>[^/]+)/(?P<item>[^/]+)", handlers.GetCoverage),
+          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/coverage_pos/(?P<datatype>[^/]+)/(?P<item>[^/]+)", handlers.GetCoveragePos),
+          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/autocomplete/(?P<query>[^/]+)", handlers.Autocomplete),
+          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/search/(?P<query>[^/]+)", handlers.Search),
+          (r"/api/dataset/(?P<dataset>[^/]+)/(?:version/(?P<ds_version>[^/]+)/)?browser/download/(?P<datatype>[^/]+)/(?P<item>[^/]+)(?:/filter/(?P<filter_type>[^/]+))?", handlers.Download)]

From 3cbe7b418a44c08f937c7f56c8ae554d73ec92b4 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 08:51:40 +0200
Subject: [PATCH 074/126] Reenable wrong-import-order and no-self-use.

---
 .pylintrc | 4 +---
 1 file changed, 1 insertion(+), 3 deletions(-)

diff --git a/.pylintrc b/.pylintrc
index eb0218b05..7b493e82f 100644
--- a/.pylintrc
+++ b/.pylintrc
@@ -69,12 +69,10 @@ disable=too-few-public-methods,
         abstract-method,
         bad-continuation,
         invalid-name,
-        wrong-import-order,
         too-few-public-methods,
         keyword-arg-before-vararg,
         arguments-differ,
-	attribute-defined-outside-init,
-	no-self-use
+        attribute-defined-outside-init
 
 # Enable the message, report, category or checker with the given id(s). You can
 # either give multiple identifier separated by comma (,) or put this option

From 165aab0b9d5d1e3f1b485a599a77856ca000ac0a Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 09:59:18 +0200
Subject: [PATCH 075/126] Remove unneeded if.

---
 backend/modules/browser/utils.py | 2 --
 1 file changed, 2 deletions(-)

diff --git a/backend/modules/browser/utils.py b/backend/modules/browser/utils.py
index fab28332d..32612474b 100644
--- a/backend/modules/browser/utils.py
+++ b/backend/modules/browser/utils.py
@@ -359,8 +359,6 @@ def get_variant_list(dataset: str, datatype: str, item: str, ds_version: str = N
 
     elif datatype == 'transcript':
         variants = lookups.get_variants_in_transcript(dataset, item, ds_version)
-
-    if datatype == 'transcript':
         transcript = lookups.get_transcript(dataset, item, ds_version)
         if not transcript:
             return {}

From e0180a0859f7b5d38057eb4819f482f9c880e27b Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 10:18:53 +0200
Subject: [PATCH 076/126] Remove check as the situation will never occur.

If get_transcripts can't find the transcript, it will raise an exception and not return anything.
---
 backend/modules/browser/utils.py | 2 --
 1 file changed, 2 deletions(-)

diff --git a/backend/modules/browser/utils.py b/backend/modules/browser/utils.py
index 32612474b..67055efd5 100644
--- a/backend/modules/browser/utils.py
+++ b/backend/modules/browser/utils.py
@@ -360,8 +360,6 @@ def get_variant_list(dataset: str, datatype: str, item: str, ds_version: str = N
     elif datatype == 'transcript':
         variants = lookups.get_variants_in_transcript(dataset, item, ds_version)
         transcript = lookups.get_transcript(dataset, item, ds_version)
-        if not transcript:
-            return {}
         refgene = transcript['gene_id']
 
     if variants:

From 9d2e8552094f998a5facae7f5dcb9467cff03710 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 10:28:04 +0200
Subject: [PATCH 077/126] Add row/block specific disables of pylint tests.

---
 backend/modules/browser/browser_handlers.py |  3 ++-
 backend/modules/browser/lookups.py          | 18 ++++++++----------
 2 files changed, 10 insertions(+), 11 deletions(-)

diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index bf7d9c412..568064cd9 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -34,7 +34,7 @@ def get(self, dataset: str, query: str, ds_version: str = None):
 class Download(handlers.UnsafeHandler):
     """Download variants in CSV format."""
 
-    def get(self, dataset: str, datatype: str, item: str,
+    def get(self, dataset: str, datatype: str, item: str,  # pylint: disable=too-many-arguments
             ds_version: str = None, filter_type: str = None):
         """
         Download variants in CSV format.
@@ -283,6 +283,7 @@ def get(self, dataset: str, variant: str, ds_version: str = None):
             dataset (str): short name of the dataset
             variant (str): variant in the format chrom-pos-ref-alt
         """
+        # pylint: disable=too-many-locals,too-many-branches,too-many-statements
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
 
         ret = {'variant': {}}
diff --git a/backend/modules/browser/lookups.py b/backend/modules/browser/lookups.py
index ac7344c8c..d538fab57 100644
--- a/backend/modules/browser/lookups.py
+++ b/backend/modules/browser/lookups.py
@@ -69,6 +69,7 @@ def get_awesomebar_result(dataset: str, query: str, ds_version: str = None) -> t
         tuple: (datatype, identifier)
 
     """
+    # pylint: disable=too-many-return-statements,too-many-branches
     query = query.strip()
 
     # Parse Variant types
@@ -84,35 +85,32 @@ def get_awesomebar_result(dataset: str, query: str, ds_version: str = None) -> t
     # Gene
     try:
         gene = get_gene_by_name(dataset, query)
+        return 'gene', gene['gene_id']
     except error.NotFoundError:
         pass
-    else:
-        return 'gene', gene['gene_id']
+
     # Capital letters for all other queries
     query = query.upper()
     try:
         gene = get_gene_by_name(dataset, query)
+        return 'gene', gene['gene_id']
     except error.NotFoundError:
         pass
-    else:
-        return 'gene', gene['gene_id']
 
     # Ensembl formatted queries
     if query.startswith('ENS'):
         # Gene
         try:
             gene = get_gene(dataset, query)
+            return 'gene', gene['gene_id']
         except error.NotFoundError:
             pass
-        else:
-            return 'gene', gene['gene_id']
         # Transcript
         try:
             transcript = get_transcript(dataset, query)
+            return 'transcript', transcript['transcript_id']
         except error.NotFoundError:
             pass
-        else:
-            return 'transcript', transcript['transcript_id']
 
     # Region and variant queries
     query = query[3:] if query.startswith('CHR') else query
@@ -348,7 +346,7 @@ def get_genes_in_region(dataset: str, chrom: str, start_pos: int,
     return genes
 
 
-def get_raw_variant(dataset: str, pos: int, chrom: str, ref: str,
+def get_raw_variant(dataset: str, pos: int, chrom: str, ref: str,  # pylint: disable=too-many-arguments
                     alt: str, ds_version: str = None) -> dict:
     """
     Retrieve variant by position and change.
@@ -480,7 +478,7 @@ def get_transcripts_in_gene_by_dbid(gene_dbid: int) -> list:
                                           .dicts())]
 
 
-def get_variant(dataset: str, pos: int, chrom: str, ref: str,
+def get_variant(dataset: str, pos: int, chrom: str, ref: str,  # pylint: disable=too-many-arguments
                 alt: str, ds_version: str = None) -> dict:
     """
     Retrieve variant by position and change.

From c77fd612fc81769c6a1581caa11bc35a0bef0647 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 10:32:58 +0200
Subject: [PATCH 078/126] Add pylint checking to backend.

---
 test/travis_script.sh | 4 +++-
 1 file changed, 3 insertions(+), 1 deletion(-)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index bcb67dcd9..225b03d05 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -152,7 +152,6 @@ sort "$BASE/tests/data/reference.psql" > ref.psql
 
 # compare dump to reference
 diff sdump.psql ref.psql
-
 RETURN_VALUE=$((RETURN_VALUE + $?))
 
 echo '>>> Test 6. Reading manta file'
@@ -169,6 +168,9 @@ psql -U postgres -h 127.0.0.1 -p 5433 "$DBNAME" -c "select chrom_id, pos, ref, a
 diff mates_res.txt "$BASE/tests/data/mates_reference.txt"
 RETURN_VALUE=$((RETURN_VALUE + $?))
 
+echo '>>> Code evaluation'
+pylint backend
+RETURN_VALUE=$((RETURN_VALUE + $?))
 
 echo '>>> Finalising: Combine coverage'
 

From d1c5e96aec715bfbad4bb1b0966ffd324262f3e6 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 10:39:39 +0200
Subject: [PATCH 079/126] Install pylint in travis.

---
 .travis.yml | 1 +
 1 file changed, 1 insertion(+)

diff --git a/.travis.yml b/.travis.yml
index 678dd835a..4595cbe93 100644
--- a/.travis.yml
+++ b/.travis.yml
@@ -14,6 +14,7 @@ install:
     - pip install -r test/requirements.txt
     - pip install -r scripts/importer/requirements.txt
     - pip install coverage coveralls
+    - pip install pylint
 script:
     - test/travis_script.sh
 addons:

From 742de70775051f5f21b375236737539666716858 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 10:59:18 +0200
Subject: [PATCH 080/126] Pylint fixes in watch_frontend.

---
 scripts/watch_frontend.py | 9 ++++-----
 1 file changed, 4 insertions(+), 5 deletions(-)

diff --git a/scripts/watch_frontend.py b/scripts/watch_frontend.py
index 25bfff8c4..760dcaafb 100644
--- a/scripts/watch_frontend.py
+++ b/scripts/watch_frontend.py
@@ -1,9 +1,8 @@
-import inotify.adapters
 import re
 import subprocess
 import os
 import logging
-
+import inotify.adapters
 
 def files_to_watch():
     r = re.compile("^/code/frontend/(templates|src)")
@@ -18,7 +17,7 @@ def comb(*args):
 
 def install_node_deps():
     os.chdir('frontend')
-    subprocess.call(['npm','install'])
+    subprocess.call(['npm', 'install'])
     os.chdir('..')
 
 def main():
@@ -31,12 +30,12 @@ def main():
     grepper = comb(files_to_watch(), events_to_watch())
 
     while True:
-        changes = list( filter(grepper, i.event_gen(timeout_s=0.5, yield_nones=False)) )
+        changes = list(filter(grepper, i.event_gen(timeout_s=0.5, yield_nones=False)))
         if changes:
             logging.info("Files updated rerunning")
             for c in changes:
                 (_, type_names, path, filename) = c
-                logging.info("    PATH=[{}] FILENAME=[{}] EVENT_TYPES={}".format(path, filename, type_names))
+                logging.info(f"    PATH=[{path}] FILENAME=[{filename}] EVENT_TYPES={type_names}")
             subprocess.call(['make'])
 
 

From e8e0c68b7f123a406d54d5306bfe756800995310 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 11:07:29 +0200
Subject: [PATCH 081/126] Pylint fixes in add_picture_to_db.

---
 scripts/add_picture_to_db.py | 10 ++++------
 1 file changed, 4 insertions(+), 6 deletions(-)

diff --git a/scripts/add_picture_to_db.py b/scripts/add_picture_to_db.py
index 819c11732..3b6f6eb4b 100755
--- a/scripts/add_picture_to_db.py
+++ b/scripts/add_picture_to_db.py
@@ -30,18 +30,16 @@ def add_image(dataset_pk, image):
         data = f.read()
 
     try:
-        mimetype = infer_mimetype( image )
+        mimetype = infer_mimetype(image)
     except NoMimetypeException:
         print("Can't find mime type for <{}>".format(image))
         sys.exit(2)
 
     print(len(data))
     with db.database.atomic():
-        db.DatasetLogo.create(
-            dataset  = dataset,
-            mimetype = mimetype,
-            data     = data
-        )
+        db.DatasetLogo.create(dataset=dataset,
+                              mimetype=mimetype,
+                              data=data)
 
 if __name__ == '__main__':
     parser = argparse.ArgumentParser(description='Insert a picture into the database')

From fae1400f40597429d677c9c3572a8a65e6cbd0cd Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 11:07:41 +0200
Subject: [PATCH 082/126] Pylint fixes in checkRequests.

---
 scripts/checkRequests.py | 21 +++++++++++----------
 1 file changed, 11 insertions(+), 10 deletions(-)

diff --git a/scripts/checkRequests.py b/scripts/checkRequests.py
index 40a66ad0b..bbb570fa3 100644
--- a/scripts/checkRequests.py
+++ b/scripts/checkRequests.py
@@ -1,28 +1,29 @@
 from email.mime.multipart import MIMEMultipart
 from email.mime.text import MIMEText
 import logging
-import peewee
+import secrets
 import smtplib
 
+import peewee
+
 import db
-import secrets
 
 def send_email():
-    msg             = MIMEMultipart()
-    msg['to']       = secrets.admin_address
-    msg['from']     = secrets.from_address
-    msg['subject']  = 'Pending SweFreq requests'
-    msg['reply-to'] = secrets.reply_to_address
-    body            = "There are pending requests for SweFreq accounts, please visit http://swefreq.nbis.se"
+    msg = MIMEMultipart()
+    msg['to'] = secrets.admin_address  # pylint: disable=no-member
+    msg['from'] = secrets.from_address  # pylint: disable=no-member
+    msg['subject'] = 'Pending SweFreq requests'
+    msg['reply-to'] = secrets.reply_to_address  # pylint: disable=no-member
+    body = "There are pending requests for SweFreq accounts, please visit http://swefreq.nbis.se"
     msg.attach(MIMEText(body, 'plain'))
 
-    server = smtplib.SMTP(secrets.mail_server)
+    server = smtplib.SMTP(secrets.mail_server)  # pylint: disable=no-member
     server.sendmail(msg['from'], [msg['to']], msg.as_string())
 
 if __name__ == '__main__':
     requests = db.get_outstanding_requests(1)
     try:
-        requests.get() # There's at least one request
+        requests.get()  # There's at least one request
         send_email()
     except peewee.DoesNotExist:
         # No new users so we don't send any emails.

From be1a3871dc0ee3b8e50d470d422998335f28e3a3 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 11:14:58 +0200
Subject: [PATCH 083/126] Pylint fixes in importer.py.

---
 scripts/importer/importer.py | 11 ++++++-----
 1 file changed, 6 insertions(+), 5 deletions(-)

diff --git a/scripts/importer/importer.py b/scripts/importer/importer.py
index 28717925b..435a3103d 100755
--- a/scripts/importer/importer.py
+++ b/scripts/importer/importer.py
@@ -97,7 +97,8 @@
     PARSER.add_argument("--add_mates", action="store_true",
                         help=("Parse MANTA file and add the breakends to the db"))
     PARSER.add_argument("--add_reversed_mates", action="store_true",
-                        help=("Assume input data only contain one line per BND, covering both directions"))
+                        help=("Assume input data only contain one line per BND, " +
+                              "covering both directions"))
 
     ARGS = PARSER.parse_args()
 
@@ -107,9 +108,9 @@
 
     if ARGS.add_reference:
         logging.info("Adding a new reference set using these sources:")
-        logging.info("  - Gencode: %s", ARGS.gencode_version)
-        logging.info("  - Ensembl: %s", ARGS.ensembl_version)
-        logging.info("  - dbNSFP:  %s", ARGS.dbnsfp_version)
+        logging.info(f"  - Gencode: {ARGS.gencode_version}")
+        logging.info(f"  - Ensembl: {ARGS.ensembl_version}")
+        logging.info(f"  - dbNSFP:  {ARGS.dbnsfp_version}")
 
         IMPORTER = ReferenceSetImporter(ARGS)
         IMPORTER.prepare_data()
@@ -118,7 +119,7 @@
         IMPORTER.start_import()
 
     if ARGS.add_raw_data:
-        logging.info("Adding raw data %s", "(dry run)" if ARGS.dry_run else '')
+        logging.info(f"Adding raw data {'(dry run)' if ARGS.dry_run else ''}")
         IMPORTER = RawDataImporter(ARGS)
         IMPORTER.prepare_data()
         if not ARGS.disable_progress:

From c0919b6ab4d3f417a25a6532e1f5deb5ae371fdf Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 11:18:55 +0200
Subject: [PATCH 084/126] Pylint fixes in compile_template.

---
 scripts/compile_template.py | 36 ++++++++++++++++++------------------
 1 file changed, 18 insertions(+), 18 deletions(-)

diff --git a/scripts/compile_template.py b/scripts/compile_template.py
index 1955ac6da..49049c93e 100644
--- a/scripts/compile_template.py
+++ b/scripts/compile_template.py
@@ -1,37 +1,37 @@
-import jinja2
 import argparse
 import datetime
 from pathlib import Path
 
-class Jinja2Renderer(object):
+import jinja2
+
+class Jinja2Renderer:
     def __init__(self, directory):
-        self.env = jinja2.Environment(
-                autoescape            = True,
-                block_start_string    = '[%',
-                block_end_string      = '%]',
-                variable_start_string = '[[',
-                variable_end_string   = ']]',
-                comment_start_string  = '[#',
-                comment_end_string    = '#]',
-
-                loader=jinja2.FileSystemLoader( str(directory) )
-            )
+        self.env = jinja2.Environment(autoescape=True,
+                                      block_start_string='[%',
+                                      block_end_string='%]',
+                                      variable_start_string='[[',
+                                      variable_end_string=']]',
+                                      comment_start_string='[#',
+                                      comment_end_string='#]',
+                                      loader=jinja2.FileSystemLoader(str(directory)))
 
     def render(self, file, **kwargs):
-        template = self.env.get_template( str(file) )
-        return template.render( **kwargs )
+        template = self.env.get_template(str(file))
+        return template.render(**kwargs)
 
 def main():
     parser = argparse.ArgumentParser()
     parser.add_argument("-b", "--basedir", dest='basedir', required=True)
-    parser.add_argument("-s", "--source",  dest='src',     required=True)
+    parser.add_argument("-s", "--source", dest='src', required=True)
     parser.add_argument("-d", "--develop", dest='develop', required=False, action='store_true')
     args = parser.parse_args()
 
-    src = Path(args.src).relative_to( args.basedir )
+    src = Path(args.src).relative_to(args.basedir)
 
     renderer = Jinja2Renderer(args.basedir)
-    res = renderer.render( src, develop = args.develop, version=datetime.datetime.now().strftime("%Y%m%d%H%M%S.%f") )
+    res = renderer.render(src,
+                          develop=args.develop,
+                          version=datetime.datetime.now().strftime("%Y%m%d%H%M%S.%f"))
     print(res)
 
 

From 2813cd803873a7efa571979c8222fe51a9faf4cd Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 12:18:04 +0200
Subject: [PATCH 085/126] Disable relative-beyond-top-level.

---
 .pylintrc | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/.pylintrc b/.pylintrc
index 7b493e82f..11f764326 100644
--- a/.pylintrc
+++ b/.pylintrc
@@ -72,7 +72,8 @@ disable=too-few-public-methods,
         too-few-public-methods,
         keyword-arg-before-vararg,
         arguments-differ,
-        attribute-defined-outside-init
+        attribute-defined-outside-init,
+	relative-beyond-top-level
 
 # Enable the message, report, category or checker with the given id(s). You can
 # either give multiple identifier separated by comma (,) or put this option

From 1dafcf68c5c0cbf95c0f4b237edbb59751233077 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 12:36:29 +0200
Subject: [PATCH 086/126] pylint fixes and disables in raw_data_importer.

---
 .../data_importer/raw_data_importer.py        | 41 ++++++++++---------
 1 file changed, 22 insertions(+), 19 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 2b3c5623e..351ddaff3 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -61,12 +61,12 @@ def _select_dataset_version(self):
         try:
             chosen_ds = db.Dataset.get(short_name=self.settings.dataset)
         except db.Dataset.DoesNotExist:
-            logging.error("Unknown dataset '%s'", self.settings.dataset)
+            logging.error(f"Unknown dataset {self.settings.dataset}")
             logging.info("Available datasets are:")
             for dataset in db.Dataset.select():
-                logging.info(" * %s", dataset.short_name)
+                logging.info(f" * {dataset.short_name}")
             sys.exit(1)
-        logging.info("Using dataset {}".format(chosen_ds.short_name))
+        logging.info(f"Using dataset {chosen_ds.short_name}")
         self.dataset = chosen_ds
 
         versions = [v for v in (db.DatasetVersion.select().
@@ -77,11 +77,11 @@ def _select_dataset_version(self):
             raise db.DatasetVersion.DoesNotExist("No versions exist for this dataset")
 
         if self.settings.version not in [v.version for v in versions]:
-            logging.error("Unknown version '%s' for dataset '%s'.",
-                          self.settings.version, self.dataset.short_name)
+            logging.error("Unknown version '{self.settings.version}' " +
+                          f"for dataset '{self.dataset.short_name}'.")
             logging.info("Available versions are:")
             for version in versions:
-                logging.info(" * %s", version.version)
+                logging.info(f" * {version.version}")
             sys.exit(1)
         self.dataset_version = [v for v in versions if v.version == self.settings.version][0]
 
@@ -116,8 +116,8 @@ def _create_beacon_counts(self):
         datarow = {'datasetid': datasetid,
                    'callcount': self.counter['calls'],
                    'variantcount': self.counter['beaconvariants']}
-        logging.info('Dataset counts: callcount: %s, variantcount: %s',
-                     datarow['callcount'], datarow['variantcount'])
+        logging.info(f"Dataset counts: callcount: {datarow['callcount']}, " +
+                     f"variantcount: {datarow['variantcount']}")
         if not self.settings.dry_run:
             db.BeaconCounts.insert(datarow).execute()
 
@@ -186,7 +186,7 @@ def _insert_coverage(self):
                                                       finished=True)
         self.log_insertion(counter, "coverage", start)
 
-    def _parse_manta(self):
+    def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too-many-statements
         """Parse a manta file."""
         header = [("chrom", str), ("pos", int), ("chrom_id", str), ("ref", str), ("alt", str)]
 
@@ -211,7 +211,7 @@ def _parse_manta(self):
                         base[header[i][0]] = header[i][1](item)
                     elif i == 7:
                         # only parse column 7 (maybe also for non-beacon-import?)
-                        info = dict([(x.split('=', 1)) if '=' in x else (x, x)
+                        info = dict([(x.split('=', 1)) if '=' in x else (x, x)  # pylint: disable=consider-using-dict-comprehension
                                      for x in re.split(r';(?=\w)', item)])
 
                 if info.get('SVTYPE') != 'BND':
@@ -230,7 +230,8 @@ def _parse_manta(self):
                 for i, alt in enumerate(alt_alleles):
                     data = dict(base)
                     data['allele_freq'] = float(info.get('FRQ'))
-                    data['alt'], data['mate_chrom'], data['mate_start'] = re.search(r'(.+)[[\]](.*?):(\d+)[[\]]', alt).groups()
+                    data['alt'], data['mate_chrom'], data['mate_start'] = \
+                        re.search(r'(.+)[[\]](.*?):(\d+)[[\]]', alt).groups()
                     if data['mate_chrom'].startswith('GL') or data['mate_chrom'].startswith('MT'):
                         # A BND from a chromosome to GL or MT.
                         # TODO ask a bioinformatician if these cases should be included or not
@@ -244,7 +245,7 @@ def _parse_manta(self):
                     # Set to 0 rather than None, as the type should be int (according to the Beacon
                     # API specificition).
                     data['allele_count'] = info.get('AC', 0)
-                    data['allele_num'] = info.get('AN',0)
+                    data['allele_num'] = info.get('AN', 0)
 
                     batch += [data]
                     if self.settings.add_reversed_mates:
@@ -297,9 +298,9 @@ def _parse_manta(self):
                                                       finished=True)
         self.log_insertion(counter, "breakend", start)
 
-    def _insert_variants(self):
+    def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches,too-many-statements
         """Import variants from a VCF file."""
-        logging.info("Inserting variants%s", " (dry run)" if self.settings.dry_run else "")
+        logging.info(f"Inserting variants{' (dry run)' if self.settings.dry_run else ''}")
         header = [("chrom", str), ("pos", int), ("rsid", str), ("ref", str),
                   ("alt", str), ("site_quality", float), ("filter_string", str)]
         start = time.time()
@@ -312,7 +313,7 @@ def _insert_variants(self):
         samples = 0
         vep_field_names = None
         with db.database.atomic():
-            for filename in self.settings.variant_file:
+            for filename in self.settings.variant_file:  # pylint: disable=too-many-nested-blocks
                 # Get reference set for the variant
                 ref_set = self.dataset_version.reference_set
 
@@ -338,7 +339,8 @@ def _insert_variants(self):
 
                     if not self.settings.beacon_only:
                         if vep_field_names is None:
-                            logging.error("VEP_field_names is empty. Make sure VCF header is present.")
+                            logging.error("VEP_field_names is empty. " +
+                                          "Make sure VCF header is present.")
                             sys.exit(1)
 
                     base = {}
@@ -349,7 +351,7 @@ def _insert_variants(self):
                             base[header[i][0]] = header[i][1](item)
                         elif i == 7 or not self.settings.beacon_only:
                             # only parse column 7 (maybe also for non-beacon-import?)
-                            info = dict([(x.split('=', 1)) if '=' in x else (x, x)
+                            info = dict([(x.split('=', 1)) if '=' in x else (x, x)  # pylint: disable=consider-using-dict-comprehension
                                          for x in re.split(r';(?=\w)', item)])
 
                     if base["chrom"].startswith('GL') or base["chrom"].startswith('MT'):
@@ -424,7 +426,7 @@ def _insert_variants(self):
                                                                   data['pos'],
                                                                   data['ref'],
                                                                   data['alt'])
-                        data['quality_metrics'] = dict([(x, info[x]) for x in METRICS if x in info])
+                        data['quality_metrics'] = {x: info[x] for x in METRICS if x in info}
                         batch += [data]
                         if self.settings.count_calls:
                             self.get_callcount(data)  # count calls (one per reference)
@@ -456,7 +458,8 @@ def _insert_variants(self):
                                     indexes = []
                                     for entry in batch:
                                         indexes.append(db.Variant.select(db.Variant.id)
-                                                       .where(db.Variant.variant_id == entry['variant_id'])
+                                                       .where(db.Variant.variant_id == \
+                                                              entry['variant_id'])
                                                        .get().id)
                                 self.add_variant_genes(indexes, genes, ref_genes)
                                 self.add_variant_transcripts(indexes,

From 9fd2fcae6ff56dee9fff4be840f60cfc8c4fde26 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 12:56:31 +0200
Subject: [PATCH 087/126] pylint fixes and disables in reference_set_importer.

---
 .../data_importer/reference_set_importer.py   | 51 ++++++++++++-------
 1 file changed, 33 insertions(+), 18 deletions(-)

diff --git a/scripts/importer/data_importer/reference_set_importer.py b/scripts/importer/data_importer/reference_set_importer.py
index ca3ba34aa..675b6c353 100644
--- a/scripts/importer/data_importer/reference_set_importer.py
+++ b/scripts/importer/data_importer/reference_set_importer.py
@@ -12,7 +12,7 @@
 import db
 from .data_importer import DataImporter
 
-class ReferenceSetImporter(DataImporter):
+class ReferenceSetImporter(DataImporter):  # pylint: disable=too-many-instance-attributes
     """Import a reference set into db."""
 
     GENCODE = ("ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_human/" +
@@ -58,8 +58,10 @@ def _insert_features(self):
         start = time.time()
         last_progress = -1
         batch = []
+        i = 0
         with db.database.atomic():
-            for i, feature in enumerate(self.features):
+            i = 0
+            for feature in self.features:
                 batch += [{'gene':self.gene_db_ids[feature['gene_id']],
                            'transcript':self.transcript_db_ids[feature['transcript_id']],
                            'chrom':feature['chrom'],
@@ -74,9 +76,12 @@ def _insert_features(self):
                     batch = []
 
                 last_progress = self._update_progress_bar(i, len(self.features), last_progress)
+                i += 1
+
             if batch:
                 if not self.settings.dry_run:
                     db.Feature.insert_many(batch).execute()
+
         last_progress = self._update_progress_bar(i, len(self.features),
                                                   last_progress, finished=True)
 
@@ -87,7 +92,8 @@ def _insert_genes(self):
         logging.info("Inserting genes into database")
         start = time.time()
         last_progress = -1
-        for i, gene in enumerate(self.genes):
+        i = 0
+        for gene in self.genes:
             # As far as I know I can't batch insert these and still get the id's back
             db_gene = db.Gene(reference_set=self.db_reference,
                               gene_id=gene['gene_id'],
@@ -113,6 +119,8 @@ def _insert_genes(self):
                 pass
 
             last_progress = self._update_progress_bar(i, len(self.genes), last_progress)
+            i += 1
+
         last_progress = self._update_progress_bar(i, len(self.genes), last_progress, finished=True)
 
         logging.info(f"Genes inserted in {self._time_since(start)}")
@@ -129,7 +137,7 @@ def _insert_reference(self):
                 self.db_reference.id = max_id.id + 1
         else:
             self.db_reference.save()
-        logging.info("Reference %s created", self.db_reference.id)
+        logging.info(f"Reference {self.db_reference.id} created")
 
     def _insert_transcripts(self):
         """Insert trabscripts into db."""
@@ -137,23 +145,26 @@ def _insert_transcripts(self):
         start = time.time()
 
         last_progress = -1
-        for i, transcript in enumerate(self.transcripts):
-            db_transcript = db.Transcript(transcript_id=transcript['transcript_id'],
-                                          gene=self.gene_db_ids[transcript['gene_id']],
-                                          mim_annotation=transcript.get('mim_annotation', None),
-                                          mim_gene_accession=transcript.get('mim_gene_accession', None),
-                                          chrom=transcript['chrom'],
-                                          start=transcript['start'],
-                                          stop=transcript['stop'],
-                                          strand=transcript['strand'])
+        i = 0
+        for transcript in self.transcripts:
+            db_trans = db.Transcript(transcript_id=transcript['transcript_id'],
+                                     gene=self.gene_db_ids[transcript['gene_id']],
+                                     mim_annotation=transcript.get('mim_annotation', None),
+                                     mim_gene_accession=transcript.get('mim_gene_accession', None),
+                                     chrom=transcript['chrom'],
+                                     start=transcript['start'],
+                                     stop=transcript['stop'],
+                                     strand=transcript['strand'])
 
             if self.settings.dry_run:
                 self.transcript_db_ids[transcript['transcript_id']] = 0
             else:
-                db_transcript.save()
-                self.transcript_db_ids[transcript['transcript_id']] = db_transcript.id
+                db_trans.save()
+                self.transcript_db_ids[transcript['transcript_id']] = db_trans.id
 
             last_progress = self._update_progress_bar(i, len(self.transcripts), last_progress)
+            i += 1
+
         last_progress = self._update_progress_bar(i, len(self.transcripts),
                                                   last_progress, finished=True)
 
@@ -202,7 +213,8 @@ def _open_dbnsfp(self):
     def _open_ensembl(self):
         """Connect to the given ensembl database."""
         logging.info("----- Opening ensembl database connection -----")
-        self.ensembl = self._connect(*(ReferenceSetImporter.ENSEMBL + (self.settings.ensembl_version,)))
+        self.ensembl = self._connect(*(ReferenceSetImporter.ENSEMBL +
+                                       (self.settings.ensembl_version,)))
 
     def _open_gencode(self):
         """Download (if needed) and opens the given gencode file."""
@@ -264,13 +276,16 @@ def _read_ensembl(self):
             canonical_dict[transcript[0]] = transcript[1]
 
         last_progress = -1.0
-        for i, gene in enumerate(self.genes):
+        i = 0
+        for gene in self.genes:
             if gene['gene_id'] in canonical_dict:
                 self.genes[i]['canonical_transcript'] = canonical_dict[gene['gene_id']]
 
             self.counters['genes'] += 1
             if self.numbers['genes'] is not None:
                 last_progress = self._update_progress_bar(i, self.numbers['genes'], last_progress)
+            i += 1
+
         if self.numbers['genes'] is not None:
             last_progress = self._update_progress_bar(i, self.numbers['genes'],
                                                       last_progress, finished=True)
@@ -364,7 +379,7 @@ def start_import(self):
                     self.counters['features'] += 1
                     continue
 
-            except Exception as error:
+            except Exception as error:  # pylint: disable=broad-except
                 logging.error("{}".format(error))
                 break
         if self.numbers['genes'] is not None:

From 990bc698cdba431e90dd38fe1b2735adedb63e0b Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 13:10:14 +0200
Subject: [PATCH 088/126] pylint fixes and disables in data_importer.

---
 scripts/importer/data_importer/data_importer.py | 14 ++++++++------
 1 file changed, 8 insertions(+), 6 deletions(-)

diff --git a/scripts/importer/data_importer/data_importer.py b/scripts/importer/data_importer/data_importer.py
index 4d61dfbaf..85fb8ea48 100644
--- a/scripts/importer/data_importer/data_importer.py
+++ b/scripts/importer/data_importer/data_importer.py
@@ -26,7 +26,7 @@ def __init__(self, settings):
         self.progress_bar = not settings.disable_progress
         self.in_file = None
 
-    def _connect(self, host, user, passwd, database):
+    def _connect(self, host, user, passwd, database):  # pylint: disable=no-self-use
         try:
             logging.info("Connecting to database {}".format(database))
             database = MySQLdb.connect(host=host,
@@ -34,7 +34,7 @@ def _connect(self, host, user, passwd, database):
                                        passwd=passwd,
                                        db=database)
             return database.cursor()
-        except MySQLdb.Error as error:
+        except MySQLdb.Error as error:  # pylint: disable=no-member
             logging.error("Error connecting: {}".format(error))
 
     def _download(self, base_url, version=None):
@@ -87,16 +87,18 @@ def _download_and_open(self, base_url, version=None):
         filename = self._download(base_url, version)
         return self._open(filename)
 
-    def _open(self, filename, binary=True):
+    def _open(self, filename, binary=True):  # pylint: disable=no-self-use
         mode = 'rb' if binary else 'rt'
         encoding = None if binary else 'utf8'
         try:
             logging.debug("Opening file {}".format(filename))
-            return gzip.open(filename, mode, encoding=encoding) if filename.endswith(".gz") else open(filename)
+            return gzip.open(filename, mode, encoding=encoding) \
+                if filename.endswith(".gz") \
+                   else open(filename)
         except IOError as error:
             logging.error("IOERROR: {}".format(error))
 
-    def _time_format(self, seconds):
+    def _time_format(self, seconds):  # pylint: disable=no-self-use
         hour, rem = divmod(seconds, 3600)
         mins, secs = divmod(rem, 60)
         retval = ""
@@ -113,7 +115,7 @@ def _time_since(self, start):
     def _time_to(self, start, progress=0.01):
         return self._time_format((time.time() - start)/progress)
 
-    def _update_progress_bar(self, current_count, total, last_progress, finished=False):
+    def _update_progress_bar(self, current_count, total, last_progress, finished=False):  # pylint: disable=no-self-use
         if not finished:
             progress = current_count/total
         else:

From 09bdb43b6a7143939037ab57f290aa20fa6888c7 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 13:11:57 +0200
Subject: [PATCH 089/126] Disable fixme warning in raw_data_importer.

---
 scripts/importer/data_importer/raw_data_importer.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 351ddaff3..1451f8096 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -234,7 +234,7 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
                         re.search(r'(.+)[[\]](.*?):(\d+)[[\]]', alt).groups()
                     if data['mate_chrom'].startswith('GL') or data['mate_chrom'].startswith('MT'):
                         # A BND from a chromosome to GL or MT.
-                        # TODO ask a bioinformatician if these cases should be included or not
+                        # TODO ask a bioinformatician if these cases should be included or not # pylint: disable=fixme
                         continue
                     data['mate_id'] = info.get('MATEID', '')
                     data['variant_id'] = '{}-{}-{}-{}'.format(data['chrom'],

From f98eaab8d8da58a14279d88c94a8c0a4ff8935fd Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 13:24:21 +0200
Subject: [PATCH 090/126] Run pylint on scripts/ as well.

---
 test/travis_script.sh | 2 ++
 1 file changed, 2 insertions(+)

diff --git a/test/travis_script.sh b/test/travis_script.sh
index 225b03d05..017a8f7ea 100755
--- a/test/travis_script.sh
+++ b/test/travis_script.sh
@@ -171,6 +171,8 @@ RETURN_VALUE=$((RETURN_VALUE + $?))
 echo '>>> Code evaluation'
 pylint backend
 RETURN_VALUE=$((RETURN_VALUE + $?))
+pylint scripts
+RETURN_VALUE=$((RETURN_VALUE + $?))
 
 echo '>>> Finalising: Combine coverage'
 

From b78f78672bb90d13cf991c581501c6a3d7820b19 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 15 Aug 2019 13:42:24 +0200
Subject: [PATCH 091/126] Should be f-string.

---
 scripts/importer/data_importer/raw_data_importer.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 1451f8096..dccb06b4d 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -77,7 +77,7 @@ def _select_dataset_version(self):
             raise db.DatasetVersion.DoesNotExist("No versions exist for this dataset")
 
         if self.settings.version not in [v.version for v in versions]:
-            logging.error("Unknown version '{self.settings.version}' " +
+            logging.error(f"Unknown version '{self.settings.version}' " +
                           f"for dataset '{self.dataset.short_name}'.")
             logging.info("Available versions are:")
             for version in versions:

From 2d07b539001357feb0c5dbaf0995243cecf5d87f Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Fri, 16 Aug 2019 08:35:28 +0200
Subject: [PATCH 092/126] i=0 not needed here.

---
 scripts/importer/data_importer/reference_set_importer.py | 1 -
 1 file changed, 1 deletion(-)

diff --git a/scripts/importer/data_importer/reference_set_importer.py b/scripts/importer/data_importer/reference_set_importer.py
index 675b6c353..1f7e6f342 100644
--- a/scripts/importer/data_importer/reference_set_importer.py
+++ b/scripts/importer/data_importer/reference_set_importer.py
@@ -60,7 +60,6 @@ def _insert_features(self):
         batch = []
         i = 0
         with db.database.atomic():
-            i = 0
             for feature in self.features:
                 batch += [{'gene':self.gene_db_ids[feature['gene_id']],
                            'transcript':self.transcript_db_ids[feature['transcript_id']],

From ce3fb86e69ef1684c436ec4e08e50857dc7d88cb Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Fri, 16 Aug 2019 10:52:44 +0200
Subject: [PATCH 093/126] Adding variants to db put in separate function.

---
 .../data_importer/raw_data_importer.py        | 167 ++++++++++--------
 1 file changed, 89 insertions(+), 78 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index dccb06b4d..fc9223a2a 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -298,6 +298,60 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
                                                       finished=True)
         self.log_insertion(counter, "breakend", start)
 
+    def _add_variants_to_db(self, batch: list, genes: list, transcripts: list,  # pylint: disable=too-many-arguments
+                            ref_genes: dict, ref_transcripts: dict):
+        """Add variants to db."""
+        if not self.settings.beacon_only:
+            # estimate variant dbid start
+            try:
+                curr_id = (db.Variant.select(db.Variant.id)
+                           .order_by(db.Variant.id.desc())
+                           .limit(1)
+                           .get().id)
+            except db.Variant.DoesNotExist:
+                # assumes next id will be 1 if table is empty
+                curr_id = 0
+
+        db.Variant.insert_many(batch).execute()
+
+        # check if the variant dbid estimate is correct, otherwise must check manually
+        if not self.settings.beacon_only:
+            last_id = (db.Variant.select(db.Variant.id)
+                       .order_by(db.Variant.id.desc())
+                       .limit(1)
+                       .get().id)
+            if last_id-curr_id == len(batch):
+                indexes = list(range(curr_id+1, last_id+1))
+            else:
+                logging.warning("Bad match between ids - slow check")
+                indexes = []
+                for entry in batch:
+                    indexes.append(db.Variant.select(db.Variant.id)
+                                   .where(db.Variant.variant_id == entry['variant_id'])
+                                   .get().id)
+            self._add_variant_genes(indexes, genes, ref_genes)
+            self._add_variant_transcripts(indexes, transcripts, ref_transcripts)
+
+    def _get_genes_transcripts(self):
+        """
+        Retrieve the genes and transcripts for the current dataset version in the form
+        `{entity: dbid}`.
+
+        Returns:
+            tuple: (genes, transcripts)
+
+        """
+        ref_set = self.dataset_version.reference_set
+        genes = {gene.gene_id: gene.id
+                     for gene in (db.Gene.select(db.Gene.id, db.Gene.gene_id)
+                                  .where(db.Gene.reference_set == ref_set))}
+        transcripts = {tran.transcript_id: tran.id
+                           for tran in (db.Transcript.select(db.Transcript.id,
+                                                             db.Transcript.transcript_id)
+                                        .join(db.Gene)
+                                        .where(db.Gene.reference_set == ref_set))}
+        return genes, transcripts
+
     def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches,too-many-statements
         """Import variants from a VCF file."""
         logging.info(f"Inserting variants{' (dry run)' if self.settings.dry_run else ''}")
@@ -314,18 +368,7 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
         vep_field_names = None
         with db.database.atomic():
             for filename in self.settings.variant_file:  # pylint: disable=too-many-nested-blocks
-                # Get reference set for the variant
-                ref_set = self.dataset_version.reference_set
-
-                # Get all genes and transcripts for foreign keys
-                ref_genes = {gene.gene_id: gene.id
-                             for gene in (db.Gene.select(db.Gene.id, db.Gene.gene_id)
-                                          .where(db.Gene.reference_set == ref_set))}
-                ref_transcripts = {tran.transcript_id: tran.id
-                                   for tran in (db.Transcript.select(db.Transcript.id,
-                                                                     db.Transcript.transcript_id)
-                                                .join(db.Gene)
-                                                .where(db.Gene.reference_set == ref_set))}
+                ref_genes, ref_transcripts = self._get_genes_transcripts()
                 for line in self._open(filename, binary=False):
                     line = line.strip()
 
@@ -343,10 +386,8 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
                                           "Make sure VCF header is present.")
                             sys.exit(1)
 
-                    base = {}
+                    base = {'dataset_version': self.dataset_version}
                     for i, item in enumerate(line.strip().split("\t")):
-                        if i == 0:
-                            base['dataset_version'] = self.dataset_version
                         if i < 7:
                             base[header[i][0]] = header[i][1](item)
                         elif i == 7 or not self.settings.beacon_only:
@@ -375,6 +416,7 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
                     except KeyError:
                         hom_counts = None  # null is better than 0, as 0 has a meaning
                     except ValueError:
+                        # multiple variants on same row
                         hom_counts = [int(count) for count in info['AC_Hom'].split(',')]
 
                     fmt_alleles = [f'{base["chrom"]}-{base["pos"]}-{base["ref"]}-{x}'
@@ -435,37 +477,11 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
 
                     if len(batch) >= self.settings.batch_size:
                         if not self.settings.dry_run:
-                            if not self.settings.beacon_only:
-                                try:
-                                    curr_id = (db.Variant.select(db.Variant.id)
-                                               .order_by(db.Variant.id.desc())
-                                               .limit(1)
-                                               .get().id)
-                                except db.Variant.DoesNotExist:
-                                    # assumes next id will be 1 if table is empty
-                                    curr_id = 0
-
-                            db.Variant.insert_many(batch).execute()
-
-                            if not self.settings.beacon_only:
-                                last_id = (db.Variant.select(db.Variant.id)
-                                           .order_by(db.Variant.id.desc())
-                                           .limit(1)
-                                           .get().id)
-                                if last_id-curr_id == len(batch):
-                                    indexes = list(range(curr_id+1, last_id+1))
-                                else:
-                                    indexes = []
-                                    for entry in batch:
-                                        indexes.append(db.Variant.select(db.Variant.id)
-                                                       .where(db.Variant.variant_id == \
-                                                              entry['variant_id'])
-                                                       .get().id)
-                                self.add_variant_genes(indexes, genes, ref_genes)
-                                self.add_variant_transcripts(indexes,
-                                                             transcripts,
-                                                             ref_transcripts)
-
+                            self._add_variants_to_db(batch,
+                                                     genes,
+                                                     transcripts,
+                                                     ref_genes,
+                                                     ref_transcripts)
                         genes = []
                         transcripts = []
                         batch = []
@@ -476,33 +492,11 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
                                                                       last_progress)
 
             if batch and not self.settings.dry_run:
-                if not self.settings.beacon_only:
-                    try:
-                        curr_id = (db.Variant.select(db.Variant.id)
-                                   .order_by(db.Variant.id.desc())
-                                   .limit(1)
-                                   .get().id)
-                    except db.Variant.DoesNotExist:
-                        # assumes next id will be 1 if table is empty
-                        curr_id = 0
-
-                db.Variant.insert_many(batch).execute()
-
-                if not self.settings.beacon_only:
-                    last_id = (db.Variant.select(db.Variant.id)
-                               .order_by(db.Variant.id.desc())
-                               .limit(1)
-                               .get().id)
-                    if last_id-curr_id == len(batch):
-                        indexes = list(range(curr_id+1, last_id+1))
-                    else:
-                        indexes = []
-                        for entry in batch:
-                            indexes.append(db.Variant.select(db.Variant.id)
-                                           .where(db.Variant.variant_id == entry['variant_id'])
-                                           .get().id)
-                    self.add_variant_genes(indexes, genes, ref_genes)
-                    self.add_variant_transcripts(indexes, transcripts, ref_transcripts)
+                self._add_variants_to_db(batch,
+                                         genes,
+                                         transcripts,
+                                         ref_genes,
+                                         ref_transcripts)
 
         if self.settings.set_vcf_sampleset_size and samples:
             self.sampleset.sample_size = samples
@@ -584,8 +578,17 @@ def start_import(self):
         if not self.settings.beacon_only and self.settings.coverage_file:
             self._insert_coverage()
 
-    def add_variant_genes(self, variant_indexes: list, genes_to_add: list, ref_genes: dict):
-        """Add genes associated with the provided variants."""
+    def _add_variant_genes(self, variant_indexes: list,
+                           genes_to_add: list,
+                           ref_genes: dict):
+        """
+        Add genes associated with the provided variants.
+
+        Args:
+            variant_indexes (list): dbids of the variants
+            genes_to_add (list): the genes for each variant (str)
+            ref_genes (dict): genename: dbid
+        """
         batch = []
         for i in range(len(variant_indexes)):
             connected_genes = [{'variant': variant_indexes[i], 'gene': ref_genes[gene]}
@@ -595,9 +598,17 @@ def add_variant_genes(self, variant_indexes: list, genes_to_add: list, ref_genes
         if not self.settings.dry_run:
             db.VariantGenes.insert_many(batch).execute()
 
-    def add_variant_transcripts(self, variant_indexes: list,
-                                transcripts_to_add: list, ref_transcripts: dict):
-        """Add genes associated with the provided variants."""
+    def _add_variant_transcripts(self, variant_indexes: list,
+                                 transcripts_to_add: list,
+                                 ref_transcripts: dict):
+        """
+        Add transcripts associated with the provided variants.
+
+        Args:
+            variant_indexes (list): dbids of the variants
+            transcripts_to_add (list): the transcripts for each variant (str)
+            ref_transcripts (dict): genename: dbid
+        """
         batch = []
         for i in range(len(variant_indexes)):
             connected_transcripts = [{'variant': variant_indexes[i],

From d489cd00b0d7d2cc40bc676c7581497c6c6cf109 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 19 Aug 2019 12:46:42 +0200
Subject: [PATCH 094/126] Reenable bad-continuation check in pylint.

---
 .pylintrc | 1 -
 1 file changed, 1 deletion(-)

diff --git a/.pylintrc b/.pylintrc
index 11f764326..73b83b4f4 100644
--- a/.pylintrc
+++ b/.pylintrc
@@ -67,7 +67,6 @@ disable=too-few-public-methods,
 	import-error,
         missing-docstring,
         abstract-method,
-        bad-continuation,
         invalid-name,
         too-few-public-methods,
         keyword-arg-before-vararg,

From 17bd3c6c4d58df46ad36caa050c6caffca890089 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 19 Aug 2019 13:42:31 +0200
Subject: [PATCH 095/126] Fix indentation.

---
 scripts/importer/data_importer/raw_data_importer.py | 12 ++++++------
 1 file changed, 6 insertions(+), 6 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index fc9223a2a..54becd36b 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -343,13 +343,13 @@ def _get_genes_transcripts(self):
         """
         ref_set = self.dataset_version.reference_set
         genes = {gene.gene_id: gene.id
-                     for gene in (db.Gene.select(db.Gene.id, db.Gene.gene_id)
-                                  .where(db.Gene.reference_set == ref_set))}
+                 for gene in (db.Gene.select(db.Gene.id, db.Gene.gene_id)
+                              .where(db.Gene.reference_set == ref_set))}
         transcripts = {tran.transcript_id: tran.id
-                           for tran in (db.Transcript.select(db.Transcript.id,
-                                                             db.Transcript.transcript_id)
-                                        .join(db.Gene)
-                                        .where(db.Gene.reference_set == ref_set))}
+                       for tran in (db.Transcript.select(db.Transcript.id,
+                                                         db.Transcript.transcript_id)
+                                    .join(db.Gene)
+                                    .where(db.Gene.reference_set == ref_set))}
         return genes, transcripts
 
     def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches,too-many-statements

From 0d256998535bc6d5faa2b73c465f0bea72b50109 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 19 Aug 2019 14:13:19 +0200
Subject: [PATCH 096/126] Refactoring of _add_variants_to_db.

---
 .../data_importer/raw_data_importer.py        | 60 +++++++++++--------
 1 file changed, 36 insertions(+), 24 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 54becd36b..ec754f597 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -298,29 +298,43 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
                                                       finished=True)
         self.log_insertion(counter, "breakend", start)
 
-    def _add_variants_to_db(self, batch: list, genes: list, transcripts: list,  # pylint: disable=too-many-arguments
-                            ref_genes: dict, ref_transcripts: dict):
-        """Add variants to db."""
+    def _estimate_variant_lastid(self):  # pylint: disable=no-self-use
+        """
+        Return the id of the variant with the highest id.
+
+        Returns 0 if table is empty.
+
+        Returns:
+            int: id of the variant with highest id or 0
+
+        """
+        try:
+            return (db.Variant.select(db.Variant.id)
+                    .order_by(db.Variant.id.desc())
+                    .limit(1)
+                    .get().id)
+        except db.Variant.DoesNotExist:
+            return 0
+
+    def _add_variants_to_db(self, batch: list, genes: list, transcripts: list, references: dict):
+        """
+        Add variants to db.
+
+        Args:
+            batch (list): variant data (dict)
+            genes (list): genes for the variants
+            transcripts(list): transcripts for the variants
+            references (dict): reference genes and transcripts
+        """
         if not self.settings.beacon_only:
-            # estimate variant dbid start
-            try:
-                curr_id = (db.Variant.select(db.Variant.id)
-                           .order_by(db.Variant.id.desc())
-                           .limit(1)
-                           .get().id)
-            except db.Variant.DoesNotExist:
-                # assumes next id will be 1 if table is empty
-                curr_id = 0
+            curr_id = self._estimate_variant_lastid()
 
         db.Variant.insert_many(batch).execute()
 
         # check if the variant dbid estimate is correct, otherwise must check manually
         if not self.settings.beacon_only:
-            last_id = (db.Variant.select(db.Variant.id)
-                       .order_by(db.Variant.id.desc())
-                       .limit(1)
-                       .get().id)
-            if last_id-curr_id == len(batch):
+            last_id = self._estimate_variant_lastid()
+            if last_id and last_id-curr_id == len(batch):
                 indexes = list(range(curr_id+1, last_id+1))
             else:
                 logging.warning("Bad match between ids - slow check")
@@ -329,8 +343,8 @@ def _add_variants_to_db(self, batch: list, genes: list, transcripts: list,  # py
                     indexes.append(db.Variant.select(db.Variant.id)
                                    .where(db.Variant.variant_id == entry['variant_id'])
                                    .get().id)
-            self._add_variant_genes(indexes, genes, ref_genes)
-            self._add_variant_transcripts(indexes, transcripts, ref_transcripts)
+            self._add_variant_genes(indexes, genes, references['genes'])
+            self._add_variant_transcripts(indexes, transcripts, references['transcripts'])
 
     def _get_genes_transcripts(self):
         """
@@ -368,7 +382,7 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
         vep_field_names = None
         with db.database.atomic():
             for filename in self.settings.variant_file:  # pylint: disable=too-many-nested-blocks
-                ref_genes, ref_transcripts = self._get_genes_transcripts()
+                references = dict(zip(('genes', 'transcripts'), self._get_genes_transcripts()))
                 for line in self._open(filename, binary=False):
                     line = line.strip()
 
@@ -480,8 +494,7 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
                             self._add_variants_to_db(batch,
                                                      genes,
                                                      transcripts,
-                                                     ref_genes,
-                                                     ref_transcripts)
+                                                     references)
                         genes = []
                         transcripts = []
                         batch = []
@@ -495,8 +508,7 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
                 self._add_variants_to_db(batch,
                                          genes,
                                          transcripts,
-                                         ref_genes,
-                                         ref_transcripts)
+                                         references)
 
         if self.settings.set_vcf_sampleset_size and samples:
             self.sampleset.sample_size = samples

From f47830ce08639bf95cdf141730f702bebd6945be Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Thu, 15 Aug 2019 16:32:01 +0200
Subject: [PATCH 097/126] BND import: Remove dataset counts

Imports of mates are not meant to end up in new datasets, hence we
should not change the dataset counts (sample- and callcount).
---
 scripts/importer/data_importer/raw_data_importer.py | 13 -------------
 1 file changed, 13 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index ec754f597..66001ca6c 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -191,7 +191,6 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
         header = [("chrom", str), ("pos", int), ("chrom_id", str), ("ref", str), ("alt", str)]
 
         batch = []
-        samples = 0
         counter = 0
         last_progress = 0
         start = time.time()
@@ -199,8 +198,6 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
             for line in self._open(filename):
                 line = line.strip()
                 if line.startswith("#"):
-                    if line.startswith('#CHROM'):
-                        samples = len(line.split('\t')[9:])
                     continue
 
                 base = {}
@@ -221,10 +218,6 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
                     # A BND from GL or MT. GL is an unplaced scaffold, MT is mitochondria.
                     continue
 
-                if 'NSAMPLES' in info:
-                    # save this unless we already know the sample size
-                    samples = int(info['NSAMPLES'])
-
                 alt_alleles = base['alt'].split(",")
 
                 for i, alt in enumerate(alt_alleles):
@@ -285,12 +278,6 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
         if batch and not self.settings.dry_run:
             db.VariantMate.insert_many(batch).execute()
 
-        if self.settings.set_vcf_sampleset_size and samples:
-            self.sampleset.sample_size = samples
-            self.sampleset.save()
-
-        self.dataset_version.num_variants = counter
-        self.dataset_version.save()
         if not self.counter['variants']:
             last_progress = self._update_progress_bar(counter,
                                                       self.counter['variants'],

From 64f3d0555c0465e688addcb557f50125595d82ff Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Thu, 15 Aug 2019 16:32:28 +0200
Subject: [PATCH 098/126] BND progress bar: fix broken logic

Update progress bar if we know the total count (counter['variants']), not
if we don't.
---
 scripts/importer/data_importer/raw_data_importer.py | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 66001ca6c..d150497de 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -270,7 +270,7 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
 
                     batch = []
                     # Update progress
-                    if not self.counter['variants']:
+                    if self.counter['variants']:
                         last_progress = self._update_progress_bar(counter,
                                                                   self.counter['variants'],
                                                                   last_progress)
@@ -278,7 +278,7 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
         if batch and not self.settings.dry_run:
             db.VariantMate.insert_many(batch).execute()
 
-        if not self.counter['variants']:
+        if self.counter['variants']:
             last_progress = self._update_progress_bar(counter,
                                                       self.counter['variants'],
                                                       last_progress,

From fb330bb9816d54f9de3ff843c36fa8da19781cb8 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Thu, 15 Aug 2019 16:21:25 +0200
Subject: [PATCH 099/126] Comments, syntax, readability

---
 scripts/importer/data_importer/raw_data_importer.py | 11 ++++++-----
 1 file changed, 6 insertions(+), 5 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index d150497de..3e2de6a74 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -203,11 +203,11 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
                 base = {}
                 for i, item in enumerate(line.split("\t")):
                     if i == 0:
-                        base['dataset_version'] = self.dataset_version
+                        base = {'dataset_version': self.dataset_version}
                     if i < 5:
                         base[header[i][0]] = header[i][1](item)
                     elif i == 7:
-                        # only parse column 7 (maybe also for non-beacon-import?)
+                        # Skip column 5 and 6 (QUAL and FILTER), will not be used
                         info = dict([(x.split('=', 1)) if '=' in x else (x, x)  # pylint: disable=consider-using-dict-comprehension
                                      for x in re.split(r';(?=\w)', item)])
 
@@ -219,14 +219,13 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
                     continue
 
                 alt_alleles = base['alt'].split(",")
-
-                for i, alt in enumerate(alt_alleles):
+                for alt in alt_alleles:
                     data = dict(base)
                     data['allele_freq'] = float(info.get('FRQ'))
                     data['alt'], data['mate_chrom'], data['mate_start'] = \
                         re.search(r'(.+)[[\]](.*?):(\d+)[[\]]', alt).groups()
                     if data['mate_chrom'].startswith('GL') or data['mate_chrom'].startswith('MT'):
-                        # A BND from a chromosome to GL or MT.
+                        # A BND from a chromosome to GL (unplaced scaffold) or MT (mitochondria).
                         # TODO ask a bioinformatician if these cases should be included or not # pylint: disable=fixme
                         continue
                     data['mate_id'] = info.get('MATEID', '')
@@ -269,12 +268,14 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
                         db.VariantMate.insert_many(batch).execute()
 
                     batch = []
+
                     # Update progress
                     if self.counter['variants']:
                         last_progress = self._update_progress_bar(counter,
                                                                   self.counter['variants'],
                                                                   last_progress)
 
+        # Store all variants and counter values
         if batch and not self.settings.dry_run:
             db.VariantMate.insert_many(batch).execute()
 

From b080aaff9c270f0b8ed9c0be4f44a0ed2fcdc8c9 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Thu, 15 Aug 2019 16:22:45 +0200
Subject: [PATCH 100/126] BND: Fix counter

Counter should not be increased for reversed alternate alleles, to match
with the total which is given by `count_entries`.
---
 scripts/importer/data_importer/raw_data_importer.py | 6 ++----
 1 file changed, 2 insertions(+), 4 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 3e2de6a74..32c027db5 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -257,16 +257,14 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
                                                                             reversed_mates['pos'],
                                                                             reversed_mates['ref'],
                                                                             alt)
-                        # increase the counter; reversed BNDs are usually kept at their own vcf row
-                        counter += 1
                         batch += [reversed_mates]
 
-                counter += 1  # count variants (one per vcf row)
+                # count variants (one per vcf row)
+                counter += 1
 
                 if len(batch) >= self.settings.batch_size:
                     if not self.settings.dry_run:
                         db.VariantMate.insert_many(batch).execute()
-
                     batch = []
 
                     # Update progress

From 36574c292f6a8ce8830834cd3dd6b86f0a8d0f96 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Thu, 15 Aug 2019 16:26:39 +0200
Subject: [PATCH 101/126] BND: Break out function

Make it possible to get an overview of pares_manta by breaking out the
allele parsing to it's own function
---
 .../data_importer/raw_data_importer.py        | 88 ++++++++++---------
 1 file changed, 47 insertions(+), 41 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 32c027db5..999625fd2 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -186,7 +186,7 @@ def _insert_coverage(self):
                                                       finished=True)
         self.log_insertion(counter, "coverage", start)
 
-    def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too-many-statements
+    def _parse_manta(self):  # pylint: disable=too-many-branches
         """Parse a manta file."""
         header = [("chrom", str), ("pos", int), ("chrom_id", str), ("ref", str), ("alt", str)]
 
@@ -218,46 +218,7 @@ def _parse_manta(self):  # pylint: disable=too-many-locals,too-many-branches,too
                     # A BND from GL or MT. GL is an unplaced scaffold, MT is mitochondria.
                     continue
 
-                alt_alleles = base['alt'].split(",")
-                for alt in alt_alleles:
-                    data = dict(base)
-                    data['allele_freq'] = float(info.get('FRQ'))
-                    data['alt'], data['mate_chrom'], data['mate_start'] = \
-                        re.search(r'(.+)[[\]](.*?):(\d+)[[\]]', alt).groups()
-                    if data['mate_chrom'].startswith('GL') or data['mate_chrom'].startswith('MT'):
-                        # A BND from a chromosome to GL (unplaced scaffold) or MT (mitochondria).
-                        # TODO ask a bioinformatician if these cases should be included or not # pylint: disable=fixme
-                        continue
-                    data['mate_id'] = info.get('MATEID', '')
-                    data['variant_id'] = '{}-{}-{}-{}'.format(data['chrom'],
-                                                              data['pos'],
-                                                              data['ref'],
-                                                              alt)
-                    # Note: these two fields are not present in our data, will always default to 0.
-                    # Set to 0 rather than None, as the type should be int (according to the Beacon
-                    # API specificition).
-                    data['allele_count'] = info.get('AC', 0)
-                    data['allele_num'] = info.get('AN', 0)
-
-                    batch += [data]
-                    if self.settings.add_reversed_mates:
-                        # If the vcf only contains one line per breakend,
-                        # add the reversed version to the database here.
-                        reversed_mates = dict(data)
-                        # Note: in general, ref and alt cannot be assumed to be the same in the
-                        # reversed direction, but our data (so far) only contains N, so we just
-                        # keep them as is for now.
-                        reversed_mates.update({'mate_chrom': data['chrom'],
-                                               'chrom': data['mate_chrom'],
-                                               'mate_start': data['pos'],
-                                               'pos': data['mate_start'],
-                                               'chrom_id': data['mate_id'],
-                                               'mate_id': data['chrom_id']})
-                        reversed_mates['variant_id'] = '{}-{}-{}-{}'.format(reversed_mates['chrom'],
-                                                                            reversed_mates['pos'],
-                                                                            reversed_mates['ref'],
-                                                                            alt)
-                        batch += [reversed_mates]
+                batch += self.parse_bnd_alleles(base, info)
 
                 # count variants (one per vcf row)
                 counter += 1
@@ -623,3 +584,48 @@ def log_insertion(self, counter, insertion_type, start):
                                                      counter,
                                                      insertion_type,
                                                      self._time_since(start)))
+
+    def parse_bnd_alleles(self, base, info):
+        """Parse alleles of a structural variant (BND) in a manta file."""
+        batch = []
+        for alt in base['alt'].split(","):
+            data = dict(base)
+            data['allele_freq'] = float(info.get('FRQ'))
+            data['alt'], data['mate_chrom'], data['mate_start'] = \
+                    re.search(r'(.+)[[\]](.*?):(\d+)[[\]]', alt).groups()
+            if data['mate_chrom'].startswith('GL') or data['mate_chrom'].startswith('MT'):
+                # A BND from a chromosome to GL (unplaced scaffold) or MT (mitochondria).
+                # TODO ask a bioinformatician if these cases should be included or not   # pylint: disable=fixme
+                continue
+            data['mate_id'] = info.get('MATEID', '')
+            data['variant_id'] = '{}-{}-{}-{}'.format(data['chrom'],
+                                                      data['pos'],
+                                                      data['ref'],
+                                                      alt)
+            # Note: these two fields are not present in our data, will always default to 0.
+            # Set to 0 rather than None, as the type should be int (according to the Beacon
+            # API specificition).
+            data['allele_count'] = info.get('AC', 0)
+            data['allele_num'] = info.get('AN', 0)
+
+            batch += [data]
+            if self.settings.add_reversed_mates:
+                # If the vcf only contains one line per breakend,
+                # add the reversed version to the database here.
+                reversed_mates = dict(data)
+                # Note: in general, ref and alt cannot be assumed to be the same in the
+                # reversed direction, but our data (so far) only contains N, so we just
+                # keep them as is for now.
+                reversed_mates.update({'mate_chrom': data['chrom'],
+                                       'chrom': data['mate_chrom'],
+                                       'mate_start': data['pos'],
+                                       'pos': data['mate_start'],
+                                       'chrom_id': data['mate_id'],
+                                       'mate_id': data['chrom_id']})
+                reversed_mates['variant_id'] = '{}-{}-{}-{}'.format(reversed_mates['chrom'],
+                                                                    reversed_mates['pos'],
+                                                                    reversed_mates['ref'],
+                                                                    alt)
+                batch += [reversed_mates]
+
+        return batch

From da17971178a31cd89eb1483c428d4cd49893c3bb Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Mon, 19 Aug 2019 14:58:13 +0200
Subject: [PATCH 102/126] Functions for basic parsing of vcf data lines

---
 .../data_importer/raw_data_importer.py        | 54 ++++++++++---------
 1 file changed, 30 insertions(+), 24 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 999625fd2..d2571a8b0 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -144,11 +144,7 @@ def _insert_coverage(self):
                     if line.startswith("#"):
                         continue
 
-                    data = {}
-                    for i, item in enumerate(line.strip().split("\t")):
-                        if i == 0:
-                            data['dataset_version'] = self.dataset_version
-                        data[header[i][0]] = header[i][1](item)
+                    data = self.parse_baseinfo(header, line)
 
                     # re-format coverage for batch
                     data['coverage'] = [data['cov1'], data['cov5'], data['cov10'],
@@ -186,8 +182,9 @@ def _insert_coverage(self):
                                                       finished=True)
         self.log_insertion(counter, "coverage", start)
 
-    def _parse_manta(self):  # pylint: disable=too-many-branches
+    def _parse_manta(self):
         """Parse a manta file."""
+        # Skip column 5 and 6 (QUAL and FILTER), will not be used
         header = [("chrom", str), ("pos", int), ("chrom_id", str), ("ref", str), ("alt", str)]
 
         batch = []
@@ -200,16 +197,8 @@ def _parse_manta(self):  # pylint: disable=too-many-branches
                 if line.startswith("#"):
                     continue
 
-                base = {}
-                for i, item in enumerate(line.split("\t")):
-                    if i == 0:
-                        base = {'dataset_version': self.dataset_version}
-                    if i < 5:
-                        base[header[i][0]] = header[i][1](item)
-                    elif i == 7:
-                        # Skip column 5 and 6 (QUAL and FILTER), will not be used
-                        info = dict([(x.split('=', 1)) if '=' in x else (x, x)  # pylint: disable=consider-using-dict-comprehension
-                                     for x in re.split(r';(?=\w)', item)])
+                base = self.parse_baseinfo(header, line)
+                info = parse_info(line)
 
                 if info.get('SVTYPE') != 'BND':
                     continue
@@ -347,14 +336,8 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
                                           "Make sure VCF header is present.")
                             sys.exit(1)
 
-                    base = {'dataset_version': self.dataset_version}
-                    for i, item in enumerate(line.strip().split("\t")):
-                        if i < 7:
-                            base[header[i][0]] = header[i][1](item)
-                        elif i == 7 or not self.settings.beacon_only:
-                            # only parse column 7 (maybe also for non-beacon-import?)
-                            info = dict([(x.split('=', 1)) if '=' in x else (x, x)  # pylint: disable=consider-using-dict-comprehension
-                                         for x in re.split(r';(?=\w)', item)])
+                    base = self.parse_baseinfo(header, line)
+                    info = parse_info(line)
 
                     if base["chrom"].startswith('GL') or base["chrom"].startswith('MT'):
                         continue
@@ -629,3 +612,26 @@ def parse_bnd_alleles(self, base, info):
                 batch += [reversed_mates]
 
         return batch
+
+    def parse_baseinfo(self, header, line):
+        """
+        Parse the fixed columns of a vcf data line.
+
+        Args:
+              header (list): tuples of titles and converter functions for the colums of interest.
+                  Ex ["chrom", str), ("pos", int)].
+              line (str): a vcf line
+
+        Returns a dictionary giving all info specified by the header, plus the dataset_version.
+        """
+        base = {'dataset_version': self.dataset_version}
+        line_info = line.split("\t")
+        for i, (title, conv) in enumerate(header):
+            base[title] = conv(line_info[i])
+        return base
+
+
+def parse_info(line):
+    """Parse the INFO field of a vcf line."""
+    parts = re.split(r';(?=\w)', line.split('\t')[7])
+    return {x[0]: x[1] for x in map(lambda s: s.split('=', 1) if '=' in s else (s, s), parts)}

From 8332d6525fdca56c8ef660e5c5c7e9f0f15791d0 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Mon, 19 Aug 2019 14:58:34 +0200
Subject: [PATCH 103/126] Function for matching non-chromsomes (ML or GT)

---
 .../data_importer/raw_data_importer.py         | 18 +++++++++++++-----
 1 file changed, 13 insertions(+), 5 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index d2571a8b0..9155d1ca6 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -203,8 +203,8 @@ def _parse_manta(self):
                 if info.get('SVTYPE') != 'BND':
                     continue
 
-                if base["chrom"].startswith('GL') or base["chrom"].startswith('MT'):
-                    # A BND from GL or MT. GL is an unplaced scaffold, MT is mitochondria.
+                if is_non_chromosome(base["chrom"]):
+                    # A BND *from* a non-chromosome.
                     continue
 
                 batch += self.parse_bnd_alleles(base, info)
@@ -339,7 +339,7 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
                     base = self.parse_baseinfo(header, line)
                     info = parse_info(line)
 
-                    if base["chrom"].startswith('GL') or base["chrom"].startswith('MT'):
+                    if is_non_chromosome(base["chrom"]):
                         continue
 
                     consequence_array = info['CSQ'].split(',') if 'CSQ' in info else []
@@ -576,8 +576,8 @@ def parse_bnd_alleles(self, base, info):
             data['allele_freq'] = float(info.get('FRQ'))
             data['alt'], data['mate_chrom'], data['mate_start'] = \
                     re.search(r'(.+)[[\]](.*?):(\d+)[[\]]', alt).groups()
-            if data['mate_chrom'].startswith('GL') or data['mate_chrom'].startswith('MT'):
-                # A BND from a chromosome to GL (unplaced scaffold) or MT (mitochondria).
+            if is_non_chromosome(data['mate_chrom']):
+                # A BND from a chromosome to a non-chromosome.
                 # TODO ask a bioinformatician if these cases should be included or not   # pylint: disable=fixme
                 continue
             data['mate_id'] = info.get('MATEID', '')
@@ -635,3 +635,11 @@ def parse_info(line):
     """Parse the INFO field of a vcf line."""
     parts = re.split(r';(?=\w)', line.split('\t')[7])
     return {x[0]: x[1] for x in map(lambda s: s.split('=', 1) if '=' in s else (s, s), parts)}
+
+
+def is_non_chromosome(chrom):
+    """
+    Checks if this is a GL or MT.
+    GL is an unplaced scaffold, MT is mitochondria.
+    """
+    return chrom.startswith('GL') or chrom.startswith('MT')

From 8a28e7ceb44231f300c2cc981506f5c516e057ea Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 19 Aug 2019 15:18:00 +0200
Subject: [PATCH 104/126] Move VCF row parsing to separate function.

---
 .../data_importer/raw_data_importer.py        | 212 +++++++++---------
 1 file changed, 111 insertions(+), 101 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 9155d1ca6..70fdb0af7 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -302,30 +302,119 @@ def _get_genes_transcripts(self):
                                     .where(db.Gene.reference_set == ref_set))}
         return genes, transcripts
 
+    def _parse_variant_row(self, line: str, batch_cont: dict, headers: list, vep_field_names: list):  # pylint: disable=too-many-locals,too-many-branches,too-many-statements
+        """
+        Parse a VCF row for a position (potentially multiple variants).
+
+        Data is added in-place.
+
+        Args:
+            line (str): the raw text row
+            batch_cont (dict): should contain batch, genes, transcripts
+
+        """
+        base = {'dataset_version': self.dataset_version}
+        for i, item in enumerate(line.strip().split("\t")):
+            if i < 7:
+                base[headers[i][0]] = headers[i][1](item)
+            elif i == 7 or not self.settings.beacon_only:
+                # only parse column 7 (maybe also for non-beacon-import?)
+                info = {a[0]:a[1] for a in map(lambda x: x.split('=', 1) if '=' in x
+                                               else (x, x), re.split(r';(?=\w)', item))}
+
+        if base["chrom"].startswith('GL') or base["chrom"].startswith('MT'):
+            return
+
+        consequence_array = info['CSQ'].split(',') if 'CSQ' in info else []
+
+        alt_alleles = base['alt'].split(",")
+        rsids = [int(rsid.strip('rs'))
+                 for rsid in base['rsid'].split(';')
+                 if rsid.startswith('rs')]
+        if not rsids:
+            rsids = [None]
+
+        try:
+            hom_counts = [int(info['AC_Hom'])]
+        except KeyError:
+            hom_counts = None  # null is better than 0, as 0 has a meaning
+        except ValueError:
+            # multiple variants on same row
+            hom_counts = [int(count) for count in info['AC_Hom'].split(',')]
+
+        fmt_alleles = [f'{base["chrom"]}-{base["pos"]}-{base["ref"]}-{x}'
+                       for x in alt_alleles]
+
+        for i, alt in enumerate(alt_alleles):
+            data = dict(base)
+            data['alt'] = alt
+            data['orig_alt_alleles'] = fmt_alleles
+
+            if len(rsids) <= i:
+                data['rsid'] = rsids[-1]  # same id as the last alternate
+            else:
+                data['rsid'] = rsids[i]
+
+            data['allele_num'] = int((info['AN_Adj'] if 'AN_Adj' in info else info['AN']))
+            data['allele_freq'] = None
+
+            data['allele_count'] = int((info['AC_Adj'] if 'AC_Adj' in info
+                                        else info['AC']).split(',')[i])
+            if 'AF' in info and data['allele_num'] > 0:
+                data['allele_freq'] = data['allele_count']/data['allele_num']
+
+            if not self.settings.beacon_only:
+                annotations = [dict(zip(vep_field_names, x.split('|')))
+                               for x in consequence_array
+                               if len(vep_field_names) == len(x.split('|'))]
+                data['vep_annotations'] = [ann for ann in annotations
+                                           if int(ann['ALLELE_NUM']) == i + 1]
+                batch_cont['genes'].append(list({annotation['Gene']
+                                                 for annotation in data['vep_annotations']
+                                                 if annotation['Gene'][:4] == 'ENSG'}))
+                batch_cont['transcripts'].append(list({annotation['Feature']
+                                                       for annotation in data['vep_annotations']
+                                                       if annotation['Feature'][:4] == 'ENST'}))
+
+            data['hom_count'] = hom_counts[i] if hom_counts else None
+
+            data['variant_id'] = '{}-{}-{}-{}'.format(data['chrom'],
+                                                      data['pos'],
+                                                      data['ref'],
+                                                      data['alt'])
+            data['quality_metrics'] = {x: info[x] for x in METRICS if x in info}
+            batch_cont['batch'] += [data]
+            if self.settings.count_calls:
+                self.get_callcount(data)  # count calls (one per reference)
+                self.counter['beaconvariants'] += 1  # count variants (one/alternate)
+
     def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches,too-many-statements
         """Import variants from a VCF file."""
         logging.info(f"Inserting variants{' (dry run)' if self.settings.dry_run else ''}")
-        header = [("chrom", str), ("pos", int), ("rsid", str), ("ref", str),
-                  ("alt", str), ("site_quality", float), ("filter_string", str)]
         start = time.time()
-        batch = []
-        genes = []
-        transcripts = []
+        headers = [("chrom", str), ("pos", int), ("rsid", str), ("ref", str),
+                   ("alt", str), ("site_quality", float), ("filter_string", str)]
+        batch_container = {'batch': [],
+                           'genes': [],
+                           'transcripts': []}
+
+        vep_field_names = None
 
         last_progress = -1.0
         counter = 0
         samples = 0
-        vep_field_names = None
+
+        references = dict(zip(('genes', 'transcripts'), self._get_genes_transcripts()))
+
         with db.database.atomic():
-            for filename in self.settings.variant_file:  # pylint: disable=too-many-nested-blocks
-                references = dict(zip(('genes', 'transcripts'), self._get_genes_transcripts()))
+            for filename in self.settings.variant_file:
                 for line in self._open(filename, binary=False):
                     line = line.strip()
 
                     if line.startswith("#"):
                         # Check for some information that we need
                         if line.startswith('##INFO=<ID=CSQ'):
-                            vep_field_names = line.split('Format: ')[-1].strip('">').split('|')
+                            vep_field_names = (line.split('Format: ')[-1].strip('">').split('|'))
                         if line.startswith('#CHROM'):
                             samples = len(line.split('\t')[9:])
                         continue
@@ -336,108 +425,29 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
                                           "Make sure VCF header is present.")
                             sys.exit(1)
 
-                    base = self.parse_baseinfo(header, line)
-                    info = parse_info(line)
-
-                    if is_non_chromosome(base["chrom"]):
-                        continue
-
-                    consequence_array = info['CSQ'].split(',') if 'CSQ' in info else []
-                    if not self.settings.beacon_only:
-                        annotations = [dict(zip(vep_field_names, x.split('|')))
-                                       for x in consequence_array
-                                       if len(vep_field_names) == len(x.split('|'))]
-
-                    alt_alleles = base['alt'].split(",")
-                    rsids = [int(rsid.strip('rs'))
-                             for rsid in base['rsid'].split(';')
-                             if rsid.startswith('rs')]
-                    if not rsids:
-                        rsids = [None]
-
-                    try:
-                        hom_counts = [int(info['AC_Hom'])]
-                    except KeyError:
-                        hom_counts = None  # null is better than 0, as 0 has a meaning
-                    except ValueError:
-                        # multiple variants on same row
-                        hom_counts = [int(count) for count in info['AC_Hom'].split(',')]
-
-                    fmt_alleles = [f'{base["chrom"]}-{base["pos"]}-{base["ref"]}-{x}'
-                                   for x in alt_alleles]
-
-                    for i, alt in enumerate(alt_alleles):
-                        if not self.settings.beacon_only:
-                            vep_annotations = [ann for ann in annotations
-                                               if int(ann['ALLELE_NUM']) == i + 1]
-
-                        data = dict(base)
-                        data['pos'], data['ref'], data['alt'] = base['pos'], base['ref'], alt
-                        data['orig_alt_alleles'] = fmt_alleles
-
-                        if len(rsids) <= i:
-                            data['rsid'] = rsids[-1]  # same id as the last alternate
-                        else:
-                            data['rsid'] = rsids[i]
-
-                        an, ac = 'AN_Adj', 'AC_Adj'
-                        if 'AN_Adj' not in info:
-                            an = 'AN'
-                        if 'AC_Adj' not in info:
-                            ac = 'AC'
-
-                        data['allele_num'] = int(info[an])
-                        data['allele_freq'] = None
-                        if 'NS' in info and not samples:
-                            # save this unless we already know the sample size
-                            samples = int(info['NS'])
-
-                        data['allele_count'] = int(info[ac].split(',')[i])
-                        if 'AF' in info and data['allele_num'] > 0:
-                            data['allele_freq'] = data['allele_count']/float(info[an])
-
-                        if not self.settings.beacon_only:
-                            data['vep_annotations'] = vep_annotations
-
-                            genes.append(list({annotation['Gene']
-                                               for annotation in vep_annotations
-                                               if annotation['Gene'][:4] == 'ENSG'}))
-                            transcripts.append(list({annotation['Feature']
-                                                     for annotation in vep_annotations
-                                                     if annotation['Feature'][:4] == 'ENST'}))
-
-                        data['hom_count'] = hom_counts[i] if hom_counts else None
-
-                        data['variant_id'] = '{}-{}-{}-{}'.format(data['chrom'],
-                                                                  data['pos'],
-                                                                  data['ref'],
-                                                                  data['alt'])
-                        data['quality_metrics'] = {x: info[x] for x in METRICS if x in info}
-                        batch += [data]
-                        if self.settings.count_calls:
-                            self.get_callcount(data)  # count calls (one per reference)
-                            self.counter['beaconvariants'] += 1  # count variants (one/alternate)
+                    self._parse_variant_row(line, batch_container, headers, vep_field_names)
                     counter += 1  # count variants (one per vcf row)
 
-                    if len(batch) >= self.settings.batch_size:
+                    if len(batch_container['batch']) >= self.settings.batch_size:
                         if not self.settings.dry_run:
-                            self._add_variants_to_db(batch,
-                                                     genes,
-                                                     transcripts,
+                            self._add_variants_to_db(batch_container['batch'],
+                                                     batch_container['genes'],
+                                                     batch_container['transcripts'],
                                                      references)
-                        genes = []
-                        transcripts = []
-                        batch = []
+
+                        batch_container['genes'] = []
+                        batch_container['transcripts'] = []
+                        batch_container['batch'] = []
                         # Update progress
                         if self.counter['variants'] is not None:
                             last_progress = self._update_progress_bar(counter,
                                                                       self.counter['variants'],
                                                                       last_progress)
 
-            if batch and not self.settings.dry_run:
-                self._add_variants_to_db(batch,
-                                         genes,
-                                         transcripts,
+            if batch_container['batch'] and not self.settings.dry_run:
+                self._add_variants_to_db(batch_container['batch'],
+                                         batch_container['genes'],
+                                         batch_container['transcripts'],
                                          references)
 
         if self.settings.set_vcf_sampleset_size and samples:

From c2693e5bc757dc98dee0d04ef442567a35f26d9a Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 21 Aug 2019 08:34:17 +0200
Subject: [PATCH 105/126] Use functions for parsing, simplify code.

---
 .../data_importer/raw_data_importer.py        | 43 ++++++++-----------
 1 file changed, 17 insertions(+), 26 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 70fdb0af7..1bb461bac 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -302,7 +302,7 @@ def _get_genes_transcripts(self):
                                     .where(db.Gene.reference_set == ref_set))}
         return genes, transcripts
 
-    def _parse_variant_row(self, line: str, batch_cont: dict, headers: list, vep_field_names: list):  # pylint: disable=too-many-locals,too-many-branches,too-many-statements
+    def _parse_variant_row(self, line: str, batch_cont: dict, headers: list, vep_field_names: list):  # pylint: disable=too-many-locals
         """
         Parse a VCF row for a position (potentially multiple variants).
 
@@ -311,18 +311,14 @@ def _parse_variant_row(self, line: str, batch_cont: dict, headers: list, vep_fie
         Args:
             line (str): the raw text row
             batch_cont (dict): should contain batch, genes, transcripts
+            headers (list): (header, type)
+            vep_field_names (list): VEP field names
 
         """
-        base = {'dataset_version': self.dataset_version}
-        for i, item in enumerate(line.strip().split("\t")):
-            if i < 7:
-                base[headers[i][0]] = headers[i][1](item)
-            elif i == 7 or not self.settings.beacon_only:
-                # only parse column 7 (maybe also for non-beacon-import?)
-                info = {a[0]:a[1] for a in map(lambda x: x.split('=', 1) if '=' in x
-                                               else (x, x), re.split(r';(?=\w)', item))}
-
-        if base["chrom"].startswith('GL') or base["chrom"].startswith('MT'):
+        base = self.parse_baseinfo(headers, line)
+        info = parse_info(line)
+
+        if is_non_chromosome(base["chrom"]):
             return
 
         consequence_array = info['CSQ'].split(',') if 'CSQ' in info else []
@@ -337,23 +333,19 @@ def _parse_variant_row(self, line: str, batch_cont: dict, headers: list, vep_fie
         try:
             hom_counts = [int(info['AC_Hom'])]
         except KeyError:
-            hom_counts = None  # null is better than 0, as 0 has a meaning
+            hom_counts = []  # null is better than 0, as 0 has a meaning
         except ValueError:
             # multiple variants on same row
             hom_counts = [int(count) for count in info['AC_Hom'].split(',')]
 
-        fmt_alleles = [f'{base["chrom"]}-{base["pos"]}-{base["ref"]}-{x}'
-                       for x in alt_alleles]
+        base['orig_alt_alleles'] = [f'{base["chrom"]}-{base["pos"]}-{base["ref"]}-{x}'
+                                    for x in alt_alleles]
 
         for i, alt in enumerate(alt_alleles):
             data = dict(base)
             data['alt'] = alt
-            data['orig_alt_alleles'] = fmt_alleles
 
-            if len(rsids) <= i:
-                data['rsid'] = rsids[-1]  # same id as the last alternate
-            else:
-                data['rsid'] = rsids[i]
+            data['rsid'] = rsids[i] if i < len(rsids) else rsids[-1]
 
             data['allele_num'] = int((info['AN_Adj'] if 'AN_Adj' in info else info['AN']))
             data['allele_freq'] = None
@@ -388,7 +380,7 @@ def _parse_variant_row(self, line: str, batch_cont: dict, headers: list, vep_fie
                 self.get_callcount(data)  # count calls (one per reference)
                 self.counter['beaconvariants'] += 1  # count variants (one/alternate)
 
-    def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches,too-many-statements
+    def _insert_variants(self):
         """Import variants from a VCF file."""
         logging.info(f"Inserting variants{' (dry run)' if self.settings.dry_run else ''}")
         start = time.time()
@@ -414,16 +406,15 @@ def _insert_variants(self):  # pylint: disable=too-many-locals,too-many-branches
                     if line.startswith("#"):
                         # Check for some information that we need
                         if line.startswith('##INFO=<ID=CSQ'):
-                            vep_field_names = (line.split('Format: ')[-1].strip('">').split('|'))
+                            vep_field_names = line.split('Format: ')[-1].strip('">').split('|')
                         if line.startswith('#CHROM'):
                             samples = len(line.split('\t')[9:])
                         continue
 
-                    if not self.settings.beacon_only:
-                        if vep_field_names is None:
-                            logging.error("VEP_field_names is empty. " +
-                                          "Make sure VCF header is present.")
-                            sys.exit(1)
+                    if not self.settings.beacon_only and not vep_field_names:
+                        logging.error("VEP_field_names is empty. " +
+                                      "Make sure VCF header is present.")
+                        sys.exit(1)
 
                     self._parse_variant_row(line, batch_container, headers, vep_field_names)
                     counter += 1  # count variants (one per vcf row)

From 415a436151f6f83a26972e888ae51569b414e11d Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 21 Aug 2019 10:36:09 +0200
Subject: [PATCH 106/126] Add tests for schema and country list.

---
 backend/tests/test_application.py | 62 +++++++++++++++++++++++++++++++
 1 file changed, 62 insertions(+)
 create mode 100644 backend/tests/test_application.py

diff --git a/backend/tests/test_application.py b/backend/tests/test_application.py
new file mode 100644
index 000000000..ba5a9fd67
--- /dev/null
+++ b/backend/tests/test_application.py
@@ -0,0 +1,62 @@
+"""
+Test the browser handlers
+"""
+import json
+
+import requests
+
+BASE_URL = "http://localhost:4000"
+
+def test_get_schema():
+    """
+    Test GetSchema.get()
+    """
+    response = requests.get(f'{BASE_URL}/api/schema')
+    data = json.loads(response.text)
+    expected = {'@context': 'http://schema.org/',
+                '@type': 'DataCatalog',
+                'name': 'SweFreq',
+                'alternateName': ['The Swedish Frequency resource for genomics']}
+    assert len(data) == 10
+    for value in expected:
+        assert data[value] == expected[value]
+
+    ds_name = 'SweGen'
+    response = requests.get(f'{BASE_URL}/api/schema?url={BASE_URL}/dataset/{ds_name}/browser')
+    data = json.loads(response.text)
+    expected = {"@type": "Dataset",
+                "url": f"{BASE_URL}/dataset/{ds_name}",
+                "@id": f"{BASE_URL}/dataset/{ds_name}",
+                "name": f"{ds_name}",
+                "description": "desc",
+                "identifier": f"{ds_name}",
+                "citation": "doi"}
+    assert data['dataset'] == expected
+
+    response = requests.get(f'{BASE_URL}/api/schema?url={BASE_URL}/dataset/{ds_name}/beacon')
+    data = json.loads(response.text)
+    expected = {'@id': 'https://swefreq.nbis.se/api/beacon-elixir/',
+                '@type': 'Beacon',
+                'dct:conformsTo': 'https://bioschemas.org/specifications/drafts/Beacon/',
+                'name': 'Swefreq Beacon',
+                'provider': {'@type': 'Organization',
+                             'name': 'National Bioinformatics Infrastructure Sweden',
+                             'alternateName': ['NBIS', 'ELIXIR Sweden'],
+                             'logo': 'http://nbis.se/assets/img/logos/nbislogo-green.svg',
+                             'url': 'https://nbis.se/'},
+                'supportedRefs': ['GRCh37'],
+                'description': 'Beacon API Web Server based on the GA4GH Beacon API',
+                'aggregator': False,
+                'url': 'https://swefreq.nbis.se/api/beacon-elixir/'}
+    for value in expected:
+        assert data[value] == expected[value]
+
+
+def test_get_countrylist():
+    """
+    Test CountryList.get()
+    """
+    response = requests.get(f'{BASE_URL}/api/countries')
+    data = json.loads(response.text)
+
+    assert len(data['countries']) == 240

From 4c16acb367c0e1120dc7fdc293efa2995aeebcc2 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 21 Aug 2019 13:02:31 +0200
Subject: [PATCH 107/126] No longer necessecary to handle exceptions as they
 are managed within get_dataset_version().

---
 backend/application.py | 44 ++++++++++++++++++------------------------
 1 file changed, 19 insertions(+), 25 deletions(-)

diff --git a/backend/application.py b/backend/application.py
index 99bd49672..d5ffde0da 100644
--- a/backend/application.py
+++ b/backend/application.py
@@ -102,33 +102,27 @@ def get(self):
         if dataset:
             dataset_schema = {'@type': "Dataset"}
 
-            try:
-                dataset_version = db.get_dataset_version(dataset, version)
-                if dataset_version is None:
-                    self.send_error(status_code=404)
+            dataset_version = db.get_dataset_version(dataset, version)
+            if dataset_version is None:
+                self.send_error(status_code=404)
+                return
+
+            if dataset_version.available_from > datetime.now():
+                # If it's not available yet, only return if user is admin.
+                if not (self.current_user and
+                        self.current_user.is_admin(dataset_version.dataset)):
+                    self.send_error(status_code=403)
                     return
 
-                if dataset_version.available_from > datetime.now():
-                    # If it's not available yet, only return if user is admin.
-                    if not (self.current_user and
-                            self.current_user.is_admin(dataset_version.dataset)):
-                        self.send_error(status_code=403)
-                        return
-
-                base_url = "%s://%s" % (self.request.protocol, self.request.host)
-                dataset_schema['url'] = base_url + "/dataset/" + dataset_version.dataset.short_name
-                dataset_schema['@id'] = dataset_schema['url']
-                dataset_schema['name'] = dataset_version.dataset.short_name
-                dataset_schema['description'] = dataset_version.description
-                dataset_schema['identifier'] = dataset_schema['name']
-                dataset_schema['citation'] = dataset_version.ref_doi
-
-                base["dataset"] = dataset_schema
-
-            except db.DatasetVersion.DoesNotExist as err:
-                logging.error(f"Dataset version does not exist: {err}")
-            except db.DatasetVersionCurrent.DoesNotExist as err:
-                logging.error(f"Dataset does not exist: {err}")
+            base_url = "%s://%s" % (self.request.protocol, self.request.host)
+            dataset_schema['url'] = base_url + "/dataset/" + dataset_version.dataset.short_name
+            dataset_schema['@id'] = dataset_schema['url']
+            dataset_schema['name'] = dataset_version.dataset.short_name
+            dataset_schema['description'] = dataset_version.description
+            dataset_schema['identifier'] = dataset_schema['name']
+            dataset_schema['citation'] = dataset_version.ref_doi
+
+            base["dataset"] = dataset_schema
 
         if beacon:
             base = {"@context": "http://schema.org",

From 890a625f9a06a11898c215d73d2cf5aff3d2d9fa Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Wed, 21 Aug 2019 14:03:06 +0200
Subject: [PATCH 108/126] Make methods private, make function static methods

---
 .../data_importer/raw_data_importer.py        | 56 ++++++++++---------
 1 file changed, 29 insertions(+), 27 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 1bb461bac..bf2f21a0e 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -144,7 +144,7 @@ def _insert_coverage(self):
                     if line.startswith("#"):
                         continue
 
-                    data = self.parse_baseinfo(header, line)
+                    data = self._parse_baseinfo(header, line)
 
                     # re-format coverage for batch
                     data['coverage'] = [data['cov1'], data['cov5'], data['cov10'],
@@ -180,7 +180,7 @@ def _insert_coverage(self):
                                                       self.counter['coverage'],
                                                       last_progress,
                                                       finished=True)
-        self.log_insertion(counter, "coverage", start)
+        self._log_insertion(counter, "coverage", start)
 
     def _parse_manta(self):
         """Parse a manta file."""
@@ -197,17 +197,17 @@ def _parse_manta(self):
                 if line.startswith("#"):
                     continue
 
-                base = self.parse_baseinfo(header, line)
-                info = parse_info(line)
+                base = self._parse_baseinfo(header, line)
+                info = self._parse_info(line)
 
                 if info.get('SVTYPE') != 'BND':
                     continue
 
-                if is_non_chromosome(base["chrom"]):
+                if self._is_non_chromosome(base["chrom"]):
                     # A BND *from* a non-chromosome.
                     continue
 
-                batch += self.parse_bnd_alleles(base, info)
+                batch += self._parse_bnd_alleles(base, info)
 
                 # count variants (one per vcf row)
                 counter += 1
@@ -232,7 +232,7 @@ def _parse_manta(self):
                                                       self.counter['variants'],
                                                       last_progress,
                                                       finished=True)
-        self.log_insertion(counter, "breakend", start)
+        self._log_insertion(counter, "breakend", start)
 
     def _estimate_variant_lastid(self):  # pylint: disable=no-self-use
         """
@@ -315,10 +315,10 @@ def _parse_variant_row(self, line: str, batch_cont: dict, headers: list, vep_fie
             vep_field_names (list): VEP field names
 
         """
-        base = self.parse_baseinfo(headers, line)
-        info = parse_info(line)
+        base = self._parse_baseinfo(headers, line)
+        info = self._parse_info(line)
 
-        if is_non_chromosome(base["chrom"]):
+        if self._is_non_chromosome(base["chrom"]):
             return
 
         consequence_array = info['CSQ'].split(',') if 'CSQ' in info else []
@@ -377,7 +377,7 @@ def _parse_variant_row(self, line: str, batch_cont: dict, headers: list, vep_fie
             data['quality_metrics'] = {x: info[x] for x in METRICS if x in info}
             batch_cont['batch'] += [data]
             if self.settings.count_calls:
-                self.get_callcount(data)  # count calls (one per reference)
+                self._get_callcount(data)  # count calls (one per reference)
                 self.counter['beaconvariants'] += 1  # count variants (one/alternate)
 
     def _insert_variants(self):
@@ -453,9 +453,9 @@ def _insert_variants(self):
                                                       last_progress,
                                                       finished=True)
 
-        self.log_insertion(counter, "variant", start)
+        self._log_insertion(counter, "variant", start)
 
-    def get_callcount(self, data):
+    def _get_callcount(self, data):
         """Increment the call count by the calls found at this position."""
         if data['chrom'] == self.chrom and data['pos'] < self.lastpos:
             # If this position is smaller than the last, the file order might be invalid.
@@ -561,7 +561,7 @@ def _add_variant_transcripts(self, variant_indexes: list,
         if not self.settings.dry_run:
             db.VariantTranscripts.insert_many(batch).execute()
 
-    def log_insertion(self, counter, insertion_type, start):
+    def _log_insertion(self, counter, insertion_type, start):
         """Log the progress of the import."""
         action = "Inserted" if not self.settings.dry_run else "Dry-ran insertion of"
         logging.info("{} {} {} records in {}".format(action,
@@ -569,7 +569,7 @@ def log_insertion(self, counter, insertion_type, start):
                                                      insertion_type,
                                                      self._time_since(start)))
 
-    def parse_bnd_alleles(self, base, info):
+    def _parse_bnd_alleles(self, base, info):
         """Parse alleles of a structural variant (BND) in a manta file."""
         batch = []
         for alt in base['alt'].split(","):
@@ -577,7 +577,7 @@ def parse_bnd_alleles(self, base, info):
             data['allele_freq'] = float(info.get('FRQ'))
             data['alt'], data['mate_chrom'], data['mate_start'] = \
                     re.search(r'(.+)[[\]](.*?):(\d+)[[\]]', alt).groups()
-            if is_non_chromosome(data['mate_chrom']):
+            if self._is_non_chromosome(data['mate_chrom']):
                 # A BND from a chromosome to a non-chromosome.
                 # TODO ask a bioinformatician if these cases should be included or not   # pylint: disable=fixme
                 continue
@@ -614,7 +614,7 @@ def parse_bnd_alleles(self, base, info):
 
         return batch
 
-    def parse_baseinfo(self, header, line):
+    def _parse_baseinfo(self, header, line):
         """
         Parse the fixed columns of a vcf data line.
 
@@ -632,15 +632,17 @@ def parse_baseinfo(self, header, line):
         return base
 
 
-def parse_info(line):
-    """Parse the INFO field of a vcf line."""
-    parts = re.split(r';(?=\w)', line.split('\t')[7])
-    return {x[0]: x[1] for x in map(lambda s: s.split('=', 1) if '=' in s else (s, s), parts)}
+    @staticmethod
+    def _parse_info(line):
+        """Parse the INFO field of a vcf line."""
+        parts = re.split(r';(?=\w)', line.split('\t')[7])
+        return {x[0]: x[1] for x in map(lambda s: s.split('=', 1) if '=' in s else (s, s), parts)}
 
 
-def is_non_chromosome(chrom):
-    """
-    Checks if this is a GL or MT.
-    GL is an unplaced scaffold, MT is mitochondria.
-    """
-    return chrom.startswith('GL') or chrom.startswith('MT')
+    @staticmethod
+    def _is_non_chromosome(chrom):
+        """
+        Checks if this is a GL or MT.
+        GL is an unplaced scaffold, MT is mitochondria.
+        """
+        return chrom.startswith('GL') or chrom.startswith('MT')

From 08fc825ddd3f3b9b322e443fd448824889979a22 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 21 Aug 2019 14:10:44 +0200
Subject: [PATCH 109/126] Don't crash GetVariant.get() if there is a dataset
 with only non-released versions.

---
 backend/modules/browser/browser_handlers.py | 3 +++
 1 file changed, 3 insertions(+)

diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index 568064cd9..2586998c1 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -355,6 +355,9 @@ def get(self, dataset: str, variant: str, ds_version: str = None):
         curr_dsv = db.get_dataset_version(dataset, ds_version)
         dsvs = [db.get_dataset_version(dset.short_name) for dset in db.Dataset.select()
                 if dset.short_name != dataset]
+        # if the only available version is not released yet
+        dsvs = [dsv for dsv in dsvs if dsv]
+        logging.error(dsvs)
         dsvs = [dsv for dsv in dsvs if dsv.reference_set == curr_dsv.reference_set]
         dsv_groups = [(curr_dsv, variant)]
         for dsv in dsvs:

From c7bfa94f7fe83970d8e81687c24f83f0f95b9355 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 21 Aug 2019 14:16:51 +0200
Subject: [PATCH 110/126] Test GetDataset.

---
 backend/tests/test_application.py | 76 +++++++++++++++++++++++++++++++
 1 file changed, 76 insertions(+)

diff --git a/backend/tests/test_application.py b/backend/tests/test_application.py
index ba5a9fd67..b00df0a4a 100644
--- a/backend/tests/test_application.py
+++ b/backend/tests/test_application.py
@@ -33,6 +33,19 @@ def test_get_schema():
                 "citation": "doi"}
     assert data['dataset'] == expected
 
+    response = requests.get(f'{BASE_URL}/api/schema?url={BASE_URL}/dataset/{ds_name}/version/123456/browser')
+    assert not response.text
+    assert response.status_code == 404
+
+    response = requests.get(f'{BASE_URL}/api/schema?url={BASE_URL}/dataset/bad_ds_name/browser')
+    assert not response.text
+    assert response.status_code == 404
+
+    ds_name = 'SweGen2'
+    response = requests.get(f'{BASE_URL}/api/schema?url={BASE_URL}/dataset/{ds_name}/version/UNRELEASED/browser')
+    assert not response.text
+    assert response.status_code == 403
+
     response = requests.get(f'{BASE_URL}/api/schema?url={BASE_URL}/dataset/{ds_name}/beacon')
     data = json.loads(response.text)
     expected = {'@id': 'https://swefreq.nbis.se/api/beacon-elixir/',
@@ -60,3 +73,66 @@ def test_get_countrylist():
     data = json.loads(response.text)
 
     assert len(data['countries']) == 240
+
+
+def test_get_dataset():
+    """
+    Test GetDataset.get()
+    """
+    ds_name = 'SweGen'
+    response = requests.get(f'{BASE_URL}/api/dataset/{ds_name}')
+    data = json.loads(response.text)
+    expected = {"study": 1,
+                "shortName": "SweGen",
+                "fullName": "SweGen",
+                "version": {"version": "20180409",
+                            "description": "desc",
+                            "terms": "terms",
+                            "availableFrom": "2001-01-04",
+                            "refDoi": "doi",
+                            "dataContactName": "place",
+                            "dataContactLink": "email",
+                            "numVariants": None,
+                            "coverageLevels": [1, 5, 10, 15, 20, 25, 30, 50, 100],
+                            "portalAvail": True,
+                            "fileAccess": "REGISTERED",
+                            "beaconAccess": "PUBLIC",
+                            "dataset": 1,
+                            "referenceSet": 1,
+                            "varCallRef": None},
+                "future": False}
+    for value in expected:
+        assert data[value] == expected[value]
+    assert len(data) == 14
+
+    ds_name = 'SweGen2'
+    response = requests.get(f'{BASE_URL}/api/dataset/{ds_name}')
+    data = json.loads(response.text)
+    expected = {"study": 1,
+                "shortName": "SweGen2",
+                "fullName": "SweGen2",
+                "version": {"version": "20190409",
+                            "description": "desc",
+                            "terms": "terms",
+                            "availableFrom": "2001-01-05",
+                            "refDoi": "doi",
+                            "dataContactName": "place",
+                            "dataContactLink": "email",
+                            "numVariants": None,
+                            "coverageLevels": [1, 5, 10, 15, 20, 25, 30, 50, 100],
+                            "portalAvail": True,
+                            "fileAccess": "REGISTERED",
+                            "beaconAccess": "PUBLIC",
+                            "dataset": 2,
+                            "referenceSet": 1,
+                            "varCallRef":None},
+                "future": False}
+    for value in expected:
+        assert data[value] == expected[value]
+    assert len(data) == 14
+
+    ds_name = 'Unrel'
+    response = requests.get(f'{BASE_URL}/api/dataset/{ds_name}')
+    assert not response.text
+    assert response.status_code == 404
+

From 96042ad2dd67d5b70bd415d5d10da0871f3ed9d1 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Wed, 21 Aug 2019 14:18:32 +0200
Subject: [PATCH 111/126] Add test dataset and versions to test unreleased
 versions.

---
 test/data/browser_test_data.sql | 3 +++
 1 file changed, 3 insertions(+)

diff --git a/test/data/browser_test_data.sql b/test/data/browser_test_data.sql
index c5966b1f6..aac3f713b 100644
--- a/test/data/browser_test_data.sql
+++ b/test/data/browser_test_data.sql
@@ -20,6 +20,7 @@ COPY data.studies (id, pi_name, pi_email, contact_name, contact_email, title, st
 COPY data.datasets (id, study, short_name, full_name, browser_uri, beacon_uri, beacon_description, avg_seq_depth, seq_type, seq_tech, seq_center, dataset_size) FROM stdin;
 1	1	SweGen	SweGen	url	\N	\N	0	type	method	place	0
 2	1	SweGen2	SweGen2	url	\N	\N	0	type	method	place	0
+3	1	Unrel	Unreleased dataset	url	\N	\N	0	type	method	place	0
 \.
 
 COPY data.reference_sets (id, reference_build, reference_name, ensembl_version, gencode_version, dbnsfp_version) FROM stdin;
@@ -32,6 +33,8 @@ COPY data.dataset_versions (id, dataset, reference_set, dataset_version, dataset
 3	1	1	20171025	desc	terms	2001-01-03 00:00:00	doi	place	email	\N	{1,5,10,15,20,25,30,50,100}	TRUE	REGISTERED	PUBLIC
 4	1	1	20180409	desc	terms	2001-01-04 00:00:00	doi	place	email	\N	{1,5,10,15,20,25,30,50,100}	TRUE	REGISTERED	PUBLIC
 5	2	1	20190409	desc	terms	2001-01-05 00:00:00	doi	place	email	\N	{1,5,10,15,20,25,30,50,100}	TRUE	REGISTERED	PUBLIC
+6	2	1	UNRELEASED	desc	terms	9999-12-31 00:00:00	doi	place	email	\N	{1,5,10,15,20,25,30,50,100}	TRUE	REGISTERED	PUBLIC
+7	3	1	UNRELEASED	desc	terms	9999-12-31 00:00:00	doi	place	email	\N	{1,5,10,15,20,25,30,50,100}	TRUE	REGISTERED	PUBLIC
 \.
 
 COPY data.coverage (id, dataset_version, chrom, pos, mean, median, coverage) FROM stdin;

From a81166b0c0c27c3ffafe9e6981f0883c0387ab90 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Wed, 21 Aug 2019 14:06:07 +0200
Subject: [PATCH 112/126] order helpers alphabetically

---
 .../data_importer/raw_data_importer.py        | 50 +++++++++----------
 1 file changed, 25 insertions(+), 25 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index bf2f21a0e..002036e4e 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -561,6 +561,14 @@ def _add_variant_transcripts(self, variant_indexes: list,
         if not self.settings.dry_run:
             db.VariantTranscripts.insert_many(batch).execute()
 
+    @staticmethod
+    def _is_non_chromosome(chrom):
+        """
+        Checks if this is a GL or MT.
+        GL is an unplaced scaffold, MT is mitochondria.
+        """
+        return chrom.startswith('GL') or chrom.startswith('MT')
+
     def _log_insertion(self, counter, insertion_type, start):
         """Log the progress of the import."""
         action = "Inserted" if not self.settings.dry_run else "Dry-ran insertion of"
@@ -569,6 +577,23 @@ def _log_insertion(self, counter, insertion_type, start):
                                                      insertion_type,
                                                      self._time_since(start)))
 
+    def _parse_baseinfo(self, header, line):
+        """
+        Parse the fixed columns of a vcf data line.
+
+        Args:
+              header (list): tuples of titles and converter functions for the colums of interest.
+                  Ex ["chrom", str), ("pos", int)].
+              line (str): a vcf line
+
+        Returns a dictionary giving all info specified by the header, plus the dataset_version.
+        """
+        base = {'dataset_version': self.dataset_version}
+        line_info = line.split("\t")
+        for i, (title, conv) in enumerate(header):
+            base[title] = conv(line_info[i])
+        return base
+
     def _parse_bnd_alleles(self, base, info):
         """Parse alleles of a structural variant (BND) in a manta file."""
         batch = []
@@ -614,24 +639,6 @@ def _parse_bnd_alleles(self, base, info):
 
         return batch
 
-    def _parse_baseinfo(self, header, line):
-        """
-        Parse the fixed columns of a vcf data line.
-
-        Args:
-              header (list): tuples of titles and converter functions for the colums of interest.
-                  Ex ["chrom", str), ("pos", int)].
-              line (str): a vcf line
-
-        Returns a dictionary giving all info specified by the header, plus the dataset_version.
-        """
-        base = {'dataset_version': self.dataset_version}
-        line_info = line.split("\t")
-        for i, (title, conv) in enumerate(header):
-            base[title] = conv(line_info[i])
-        return base
-
-
     @staticmethod
     def _parse_info(line):
         """Parse the INFO field of a vcf line."""
@@ -639,10 +646,3 @@ def _parse_info(line):
         return {x[0]: x[1] for x in map(lambda s: s.split('=', 1) if '=' in s else (s, s), parts)}
 
 
-    @staticmethod
-    def _is_non_chromosome(chrom):
-        """
-        Checks if this is a GL or MT.
-        GL is an unplaced scaffold, MT is mitochondria.
-        """
-        return chrom.startswith('GL') or chrom.startswith('MT')

From bf7d48a7a2a49599b5b6e55ac8dc482f1103eafd Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Wed, 21 Aug 2019 14:26:05 +0200
Subject: [PATCH 113/126] Remove newlines

---
 scripts/importer/data_importer/raw_data_importer.py | 2 --
 1 file changed, 2 deletions(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index 002036e4e..c73c07515 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -644,5 +644,3 @@ def _parse_info(line):
         """Parse the INFO field of a vcf line."""
         parts = re.split(r';(?=\w)', line.split('\t')[7])
         return {x[0]: x[1] for x in map(lambda s: s.split('=', 1) if '=' in s else (s, s), parts)}
-
-

From a4e2b455b3f64d9e227835f46c8a58873b3cf45a Mon Sep 17 00:00:00 2001
From: MalinAhlberg <ahlberg.malin@gmail.com>
Date: Wed, 21 Aug 2019 14:50:11 +0200
Subject: [PATCH 114/126] Fix docstring

---
 scripts/importer/data_importer/raw_data_importer.py | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index c73c07515..c49a98a02 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -586,7 +586,8 @@ def _parse_baseinfo(self, header, line):
                   Ex ["chrom", str), ("pos", int)].
               line (str): a vcf line
 
-        Returns a dictionary giving all info specified by the header, plus the dataset_version.
+        Returns:
+            dict: the parsed info specified as by the header, plus the dataset_version.
         """
         base = {'dataset_version': self.dataset_version}
         line_info = line.split("\t")

From 053e6115ee01c2d4032fc42db2c813988b8e4d98 Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Wed, 21 Aug 2019 14:52:17 +0200
Subject: [PATCH 115/126] fix word order

---
 scripts/importer/data_importer/raw_data_importer.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index c49a98a02..b1bb4b85a 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -587,7 +587,7 @@ def _parse_baseinfo(self, header, line):
               line (str): a vcf line
 
         Returns:
-            dict: the parsed info specified as by the header, plus the dataset_version.
+            dict: the parsed info as specified by the header, plus the dataset_version.
         """
         base = {'dataset_version': self.dataset_version}
         line_info = line.split("\t")

From ca424d2d74c14ade939dc5726129f52952b3feec Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 22 Aug 2019 08:15:55 +0200
Subject: [PATCH 116/126] Use filter instead of a list comprehension.

Co-Authored-By: MalinAhlberg <ahlberg.malin@gmail.com>
---
 backend/modules/browser/browser_handlers.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index 2586998c1..7bcc52fa8 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -356,7 +356,7 @@ def get(self, dataset: str, variant: str, ds_version: str = None):
         dsvs = [db.get_dataset_version(dset.short_name) for dset in db.Dataset.select()
                 if dset.short_name != dataset]
         # if the only available version is not released yet
-        dsvs = [dsv for dsv in dsvs if dsv]
+        dsvs = list(filter(lambda dsv: dsv, dsvs))
         logging.error(dsvs)
         dsvs = [dsv for dsv in dsvs if dsv.reference_set == curr_dsv.reference_set]
         dsv_groups = [(curr_dsv, variant)]

From 1058bd3f7b408f8430447b4689f245f11ce7585f Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 22 Aug 2019 08:42:22 +0200
Subject: [PATCH 117/126] Fix docstring style.

---
 backend/modules/browser/browser_handlers.py | 12 +++++++++---
 1 file changed, 9 insertions(+), 3 deletions(-)

diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index 7bcc52fa8..eea827275 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -21,6 +21,7 @@ def get(self, dataset: str, query: str, ds_version: str = None):
             dataset (str): dataset short name
             query (str): query
             ds_version (str): dataset version
+
         """
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
         ret = {}
@@ -47,6 +48,7 @@ def get(self, dataset: str, datatype: str, item: str,  # pylint: disable=too-man
             item (str): query item
             ds_version (str): dataset version
             filter_type (str): type of filter to apply
+
         """
         # ctrl.filterVariantsBy~ctrl.filterIncludeNonPass
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
@@ -89,6 +91,7 @@ def get(self, dataset: str, datatype: str, item: str, ds_version: str = None):
             datatype (str): type of data
             item (str): query item
             ds_version (str): dataset version
+
         """
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
         try:
@@ -114,6 +117,7 @@ def get(self, dataset: str, datatype: str, item: str, ds_version: str = None):
             datatype (str): type of data
             item (str): query item
             ds_version (str): dataset version
+
         """
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
         try:
@@ -139,6 +143,7 @@ def get(self, dataset: str, gene: str, ds_version: str = None):
             dataset (str): short name of the dataset
             gene (str): the gene id
             ds_version (str): dataset version
+
         """
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
         gene_id = gene
@@ -193,6 +198,7 @@ def get(self, dataset: str, region: str, ds_version: str = None):
             dataset (str): short name of the dataset
             region (str): the region in the format chr-startpos-endpos
             ds_version (str): dataset version
+
         """
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
 
@@ -232,9 +238,6 @@ def get(self, dataset: str, transcript: str, ds_version: str = None):
             dataset (str): short name of the dataset
             transcript (str): the transcript id
 
-        Returns:
-            dict: transcript (transcript and exons), gene (gene information)
-
         """
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
         transcript_id = transcript
@@ -282,6 +285,7 @@ def get(self, dataset: str, variant: str, ds_version: str = None):
         Args:
             dataset (str): short name of the dataset
             variant (str): variant in the format chrom-pos-ref-alt
+
         """
         # pylint: disable=too-many-locals,too-many-branches,too-many-statements
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
@@ -413,6 +417,7 @@ def get(self, dataset: str, datatype: str, item: str, ds_version: str = None):
             dataset (str): short name of the dataset
             datatype (str): gene, region, or transcript
             item (str): item to query
+
         """
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
         try:
@@ -443,6 +448,7 @@ def get(self, dataset: str, query: str, ds_version: str = None):
         Args:
             dataset (str): short name of the dataset
             query (str): search query
+
         """
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
         ret = {"dataset": dataset, "value": None, "type": None}

From 0d1483996c9c537be80329069c4e674955b933f5 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 22 Aug 2019 09:11:46 +0200
Subject: [PATCH 118/126] Check no longer needed as its handled by the earlier
 exception.

---
 backend/modules/browser/browser_handlers.py | 3 ---
 1 file changed, 3 deletions(-)

diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index eea827275..e1021560b 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -160,9 +160,6 @@ def get(self, dataset: str, gene: str, ds_version: str = None):
             self.send_error(status_code=400, reason=str(err))
             return
 
-        if not gene:
-            self.send_error(status_code=404, reason='Gene not found')
-            return
         ret['gene'] = gene
 
         # Add exons from transcript

From b07993fd6bfeae8c5d6c0936b10b978f2be21fec Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 22 Aug 2019 09:15:35 +0200
Subject: [PATCH 119/126] Don't handle exceptions that are not raised by the
 function.

---
 backend/modules/browser/browser_handlers.py | 3 ---
 1 file changed, 3 deletions(-)

diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index e1021560b..aa760c766 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -156,9 +156,6 @@ def get(self, dataset: str, gene: str, ds_version: str = None):
         except error.NotFoundError as err:
             self.send_error(status_code=404, reason=str(err))
             return
-        except (error.ParsingError, error.MalformedRequest) as err:
-            self.send_error(status_code=400, reason=str(err))
-            return
 
         ret['gene'] = gene
 

From 2c8e251f434816fcb69baa2af2b4d20104369fb2 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 22 Aug 2019 09:23:52 +0200
Subject: [PATCH 120/126] Add negative tests for coverage pos and variant.

---
 backend/modules/browser/tests/test_browser_handlers.py | 10 ++++++++++
 1 file changed, 10 insertions(+)

diff --git a/backend/modules/browser/tests/test_browser_handlers.py b/backend/modules/browser/tests/test_browser_handlers.py
index e0c2c025e..95f3fd489 100644
--- a/backend/modules/browser/tests/test_browser_handlers.py
+++ b/backend/modules/browser/tests/test_browser_handlers.py
@@ -81,6 +81,12 @@ def test_get_coverage_pos():
     assert cov_pos['stop'] == 100101
     assert cov_pos['chrom'] == '22'
 
+    dataset = 'SweGen'
+    data_type = 'transcript'
+    data_item = 'BAD_TRANSCRIPT'
+    response = requests.get('{}/api/dataset/{}/browser/coverage_pos/{}/{}'.format(BASE_URL, dataset, data_type, data_item))
+    assert response.status_code == 404
+
 
 def test_get_gene():
     """
@@ -197,6 +203,10 @@ def test_get_variant():
     response = requests.get('{}/api/dataset/{}/browser/variant/{}'.format(BASE_URL, dataset, variant_id))
     assert response.status_code == 400
 
+    variant_id = '1-2-3-4-5-6'
+    response = requests.get('{}/api/dataset/{}/browser/variant/{}'.format(BASE_URL, dataset, variant_id))
+    assert response.status_code == 400
+
 
 def test_get_variants():
     """

From 811c0707f1f891a36d6cf70f8dceaed2f36c0ef1 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Thu, 22 Aug 2019 09:43:09 +0200
Subject: [PATCH 121/126] More bad request tests for coverage pos.

---
 backend/modules/browser/tests/test_browser_handlers.py | 10 ++++++++++
 1 file changed, 10 insertions(+)

diff --git a/backend/modules/browser/tests/test_browser_handlers.py b/backend/modules/browser/tests/test_browser_handlers.py
index 95f3fd489..debcc9bbd 100644
--- a/backend/modules/browser/tests/test_browser_handlers.py
+++ b/backend/modules/browser/tests/test_browser_handlers.py
@@ -81,6 +81,16 @@ def test_get_coverage_pos():
     assert cov_pos['stop'] == 100101
     assert cov_pos['chrom'] == '22'
 
+    data_type = 'region'
+    data_item = '22-100001-200101'
+    response = requests.get('{}/api/dataset/{}/browser/coverage_pos/{}/{}'.format(BASE_URL, dataset, data_type, data_item))
+    assert response.status_code == 400
+
+    data_type = 'region'
+    data_item = '22-1-11-101'
+    response = requests.get('{}/api/dataset/{}/browser/coverage_pos/{}/{}'.format(BASE_URL, dataset, data_type, data_item))
+    assert response.status_code == 400
+
     dataset = 'SweGen'
     data_type = 'transcript'
     data_item = 'BAD_TRANSCRIPT'

From 82691ac5a6dd32123fcb65e1d8da3e9cf1adbe0c Mon Sep 17 00:00:00 2001
From: MalinAhlberg <malin.ahlberg@nbis.se>
Date: Thu, 22 Aug 2019 10:52:39 +0200
Subject: [PATCH 122/126] docstyling

---
 scripts/importer/data_importer/raw_data_importer.py | 4 +++-
 1 file changed, 3 insertions(+), 1 deletion(-)

diff --git a/scripts/importer/data_importer/raw_data_importer.py b/scripts/importer/data_importer/raw_data_importer.py
index b1bb4b85a..3c8c0cc99 100644
--- a/scripts/importer/data_importer/raw_data_importer.py
+++ b/scripts/importer/data_importer/raw_data_importer.py
@@ -564,7 +564,8 @@ def _add_variant_transcripts(self, variant_indexes: list,
     @staticmethod
     def _is_non_chromosome(chrom):
         """
-        Checks if this is a GL or MT.
+        Check if this is a GL or MT.
+
         GL is an unplaced scaffold, MT is mitochondria.
         """
         return chrom.startswith('GL') or chrom.startswith('MT')
@@ -588,6 +589,7 @@ def _parse_baseinfo(self, header, line):
 
         Returns:
             dict: the parsed info as specified by the header, plus the dataset_version.
+
         """
         base = {'dataset_version': self.dataset_version}
         line_info = line.split("\t")

From a012d6e971ebd70a6d20172d2356b89d2a9c0665 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 26 Aug 2019 08:56:23 +0200
Subject: [PATCH 123/126] eslint fixes.

---
 .../src/js/controller.browserController.js    | 72 +++++++++----------
 .../js/controller.datasetBeaconController.js  | 26 +++----
 .../controller.datasetDownloadController.js   |  6 +-
 frontend/src/js/factory.beacon.js             | 45 ++++++------
 frontend/src/js/factory.browser.js            | 18 ++---
 5 files changed, 84 insertions(+), 83 deletions(-)

diff --git a/frontend/src/js/controller.browserController.js b/frontend/src/js/controller.browserController.js
index 89b40003b..5de46a03e 100644
--- a/frontend/src/js/controller.browserController.js
+++ b/frontend/src/js/controller.browserController.js
@@ -55,95 +55,95 @@
                 localThis.itemType = "transcript";
                 localThis.item = $routeParams.transcript;
                 Browser.getTranscript($routeParams.dataset, $routeParams.version, $routeParams.transcript)
-		    .then( function(data) {
+                    .then( function(data) {
 			localThis.transcript = data.transcript;
 			localThis.gene       = data.gene;
 			localThis.coverage.region.exons = data.exons;
                     })
-		    .catch((err) => {
+                    .catch((err) => {
 			localThis.transcript = {"statusCode": err.status,
 						"statusText": err.statusText};
-		    });
-;
+                    });
+
             }
             if ($routeParams.region) {
                 localThis.itemType = "region";
                 localThis.item = $routeParams.region;
                 Browser.getRegion($routeParams.dataset, $routeParams.version, $routeParams.region)
-		    .then( function(data) {
+                    .then( function(data) {
 			localThis.region = data.region;
                     })
-		    .catch((err) => {
+                    .catch((err) => {
 			localThis.region = {"statusCode": err.status,
-					    "statusText": err.statusText,
-					    "variantId": $routeParams.region};
-		    });
+                                            "statusText": err.statusText,
+                                            "variantId": $routeParams.region};
+                    });
             }
             if ($routeParams.gene) {
                 localThis.itemType = "gene";
                 localThis.item = $routeParams.gene;
                 Browser.getGene($routeParams.dataset, $routeParams.version, $routeParams.gene)
-		    .then( function(data) {
+                    .then( function(data) {
 			localThis.gene = data.gene;
 			localThis.transcripts = data.transcripts;
 			localThis.coverage.region.exons = data.exons;
                     })
-		    .catch((err) => {
+                    .catch((err) => {
 			localThis.gene = {"statusCode": err.status,
-					  "statusText": err.statusText};
-		    });
+                                          "statusText": err.statusText};
+                    });
             }
            if (localThis.itemType) {
                Browser.getVariants($routeParams.dataset, $routeParams.version, localThis.itemType, localThis.item)
-		   .then( function(data) {
+                   .then( function(data) {
                        localThis.variants = data.variants;
                        localThis.headers = data.headers;
 
                        // TODO Move to function later
                        let mapFunction = function(variant) {
                            variant.isPass     = variant.filter == "PASS";
-			   if (variant.flags.indexOf("LoF") === -1)
-			       variant.isLof = false;
-			   else
-			       variant.isLof = true;
+                           if (variant.flags.indexOf("LoF") === -1)
+                               variant.isLof = false;
+                           else
+                               variant.isLof = true;
                            variant.isMissense = variant.majorConsequence == "missense";
                        };
                        localThis.variants.map(mapFunction);
 
                        localThis.filterVariants();
-		       localThis.variants.loaded = true;
+                       localThis.variants.loaded = true;
                    })
-	       	   .catch((err) => {
-		       localThis.variants = {"statusCode": err.status,
-					     "statusText": err.statusText,
-					     "loaded": true,};
-		   });
+                   .catch((err) => {
+                       localThis.variants = {"statusCode": err.status,
+                                             "statusText": err.statusText,
+                                             "loaded": true,};
+                   });
                Browser.getCoveragePos($routeParams.dataset, $routeParams.version, localThis.itemType, localThis.item)
-		   .then( function(data) {
+                   .then( function(data) {
                        localThis.coverage.region.start = data.start;
                        localThis.coverage.region.stop  = data.stop;
                        localThis.coverage.region.chrom = data.chrom;
                    });
                Browser.getCoverage($routeParams.dataset, $routeParams.version, localThis.itemType, localThis.item)
-		   .then(function(data) {
+                   .then(function(data) {
                        localThis.coverage.data = data.coverage;
                        localThis.coverage.loaded = true;
                    })
-		   .catch((err) => {
-		       localThis.coverage = {"statusCode": err.status,
-					     "statusText": err.statusText,
-					     "loaded": true,};
-		   });
+                   .catch((err) => {
+                       localThis.coverage = {"statusCode": err.status,
+                                             "statusText": err.statusText,
+                                             "loaded": true,};
+                   });
             }
             if ($routeParams.variant) {
                 Browser.getVariant($routeParams.dataset, $routeParams.version, $routeParams.variant)
-		    .then( function(data) {
+                    .then( function(data) {
 			localThis.variant = data.variant;
                     })
-		    .catch((err) => {
-			localThis.variant = {"statusCode": err.status,
-					     "statusText": err.statusText};
-		    });
+                    .catch((err) => {
+                        localThis.variant = {"statusCode": err.status,
+                                             "statusText": err.statusText};
+                    });
 
             }
             Dataset.getDataset($routeParams.dataset, $routeParams.version, $routeParams.version)
diff --git a/frontend/src/js/controller.datasetBeaconController.js b/frontend/src/js/controller.datasetBeaconController.js
index d194c395f..a7b08635c 100644
--- a/frontend/src/js/controller.datasetBeaconController.js
+++ b/frontend/src/js/controller.datasetBeaconController.js
@@ -12,9 +12,9 @@
         function activate() {
             Beacon.getBeaconReferences($routeParams.dataset, $routeParams.version)
 		.then(function(data) {
-		    if (data) {
+                    if (data) {
 			localThis.beaconInfo = data;
-		    }
+                    }
                 });
 
             User.getUser().then(function(data) {
@@ -34,7 +34,7 @@
         function search() {
             Beacon.queryBeacon(localThis)
                 .then(function(response) {
-		    if (response.data.exists===false) { // value may be null -> error
+                    if (response.data.exists===false) { // value may be null -> error
 			localThis.queryResponses.push({
                             "response": { "state": "Absent" },
                             "query": {
@@ -44,19 +44,19 @@
 				"referenceAllele": localThis.referenceAllele,
                             }
 			});
-		    }
-		    else if (response.data.exists===true) {
+                    }
+                    else if (response.data.exists===true) {
 			localThis.queryResponses.push({
-			    "response": { "state": "Present" },
-			    "query": {
+                            "response": { "state": "Present" },
+                            "query": {
 				"chromosome":      localThis.chromosome,
 				"position":        localThis.position,
 				"allele":          localThis.allele,
 				"referenceAllele": localThis.referenceAllele,
                             }
 			});
-		    }
-		    else {
+                    }
+                    else {
 			localThis.queryResponses.push({
                             "response": { "state": "Error" },
                             "query": {
@@ -82,10 +82,10 @@
             );
         }
 	function fillExample() {
-	    localThis.chromosome = "22";
-	    localThis.position = 46615880;
-	    localThis.referenceAllele = "T";
-	    localThis.allele = "C";
+            localThis.chromosome = "22";
+            localThis.position = 46615880;
+            localThis.referenceAllele = "T";
+            localThis.allele = "C";
 	}
     }]);
 })();
diff --git a/frontend/src/js/controller.datasetDownloadController.js b/frontend/src/js/controller.datasetDownloadController.js
index 3336bcbdc..21f97f20a 100644
--- a/frontend/src/js/controller.datasetDownloadController.js
+++ b/frontend/src/js/controller.datasetDownloadController.js
@@ -44,10 +44,10 @@
         }
 
         function updateAuthorizationLevel() {
-            if (!localThis.hasOwnProperty("user") || localThis.user.user == null) {
+            if (!Object.prototype.hasOwnProperty.call(localThis, "user") || localThis.user.user == null) {
                 localThis.authorizationLevel = "logged_out";
             }
-            else if (localThis.hasOwnProperty("dataset")) {
+            else if (Object.prototype.hasOwnProperty.call(localThis, "dataset")) {
                 localThis.authorizationLevel = localThis.dataset.authorizationLevel;
             }
         }
@@ -89,7 +89,7 @@
         }
 
         function dataContactIsEmail() {
-            return localThis.hasOwnProperty("dataset") &&
+            return Object.prototype.hasOwnProperty.call(localThis, "dataset") &&
                     localThis.dataset.version.dataContactLink.indexOf("@") > -1;
         }
     }]);
diff --git a/frontend/src/js/factory.beacon.js b/frontend/src/js/factory.beacon.js
index 066a1e91e..a97b3b650 100644
--- a/frontend/src/js/factory.beacon.js
+++ b/frontend/src/js/factory.beacon.js
@@ -8,41 +8,42 @@
 
         function getBeaconReferences(name, version) {
             return $http.get("/api/beacon-elixir/").then(function(data) {
-                var d = data.data.datasets;
+                let d = data.data.datasets;
 
 		if (version) {
-                    for (var i = 0; i < d.length; i++) {
-			var dataset = d[i].id;
+                    for (let i = 0; i < d.length; i++) {
+			let dataset = d[i].id;
 			if (dataset.indexOf(name) != -1 && dataset.indexOf(version) != -1) {
-			    return {
-				"reference": dataset.split(":")[0].substring(0, 6),
-				"datasetId": dataset,
-			    }
+                            return {
+                                "reference": dataset.split(":")[0].substring(0, 6),
+                                "datasetId": dataset,
+                            };
 			}
                     }
 		}
 		else {
-		    var references = [];
-		    for (var i = 0; i < d.length; i++) {
-			var dataset = d[i].id;
+                    let references = [];
+                    for (let i = 0; i < d.length; i++) {
+			let dataset = d[i].id;
 			if (dataset.indexOf(name) !== -1) {
-			    references.push(dataset);
+                            references.push(dataset);
 			}
                     }
-		    var highest_ver = 0;
-		    var reference = "";
-		    for (var i = 0; i < references.length; i++) {
-			var ver = parseInt(references[i].split(":")[2]);
-			if (ver > highest_ver) {
-			    highest_ver = ver;
-			    reference = references[i].split(":")[0].substring(0, 6);
-			    beaconId = references[i];
+                    let beaconId = "";
+                    let highestVer = 0;
+                    let reference = "";
+                    for (let i = 0; i < references.length; i++) {
+                        let ver = parseInt(references[i].split(":")[2]);
+                        if (ver > highestVer) {
+                            highestVer = ver;
+                            reference = references[i].split(":")[0].substring(0, 6);
+                            beaconId = references[i];
 			}
-		    }
-		    return {
+                    }
+                    return {
 			"reference": reference,
 			"datasetId": beaconId,
-		    }
+                    };
 		}
             });
         }
diff --git a/frontend/src/js/factory.browser.js b/frontend/src/js/factory.browser.js
index c5f1fba79..99ef4246a 100644
--- a/frontend/src/js/factory.browser.js
+++ b/frontend/src/js/factory.browser.js
@@ -14,16 +14,16 @@
         };
 
 	function baseUrl(dataset, version) {
-	    var url = "/api/dataset/" + dataset + "/";
-	    if ( version ) {
-		url += "version/" + version + "/"
-	    }
-	    url += 'browser/';
-	    return url;
+            var url = "/api/dataset/" + dataset + "/";
+            if ( version ) {
+		url += "version/" + version + "/";
+            }
+            url += "browser/";
+            return url;
 	}
 	
         function getGene(dataset, version, gene) {
-	    return $http.get(baseUrl(dataset, version) + "gene/" + gene).then(function(data) {
+            return $http.get(baseUrl(dataset, version) + "gene/" + gene).then(function(data) {
                 return data.data;
             });
         }
@@ -41,9 +41,9 @@
         }
 
         function getVariant(dataset, version, variant) {
-	    return $http.get(baseUrl(dataset, version) + "variant/" + variant).then(function(data) {
+            return $http.get(baseUrl(dataset, version) + "variant/" + variant).then(function(data) {
                 return data.data;
-	    });
+            });
         }
 
         function search(dataset, version, query) {

From 7d22eaa5ddc3bd67029688a7c4966472197f9f64 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 26 Aug 2019 09:08:48 +0200
Subject: [PATCH 124/126] Fix bad f-string.

---
 backend/modules/browser/browser_handlers.py | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index aa760c766..4ab19e163 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -52,9 +52,10 @@ def get(self, dataset: str, datatype: str, item: str,  # pylint: disable=too-man
         """
         # ctrl.filterVariantsBy~ctrl.filterIncludeNonPass
         dataset, ds_version = utils.parse_dataset(dataset, ds_version)
+        filename = f'{dataset}_{datatype}_{item}.csv'
         self.set_header('Content-Type', 'text/csv')
         self.set_header(f'content-Disposition',
-                        'attachement; filename={f"{dataset}_{datatype}_{item}.csv"}')
+                        f'attachement; filename={filename}')
 
         data = utils.get_variant_list(dataset, datatype, item, ds_version)
         # filter variants based on what is shown

From ac8e1d8d670f687fed1742ded8b046c5b6b219e8 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 26 Aug 2019 09:25:33 +0200
Subject: [PATCH 125/126] Fix spelling error (attachement).

---
 backend/modules/browser/browser_handlers.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/backend/modules/browser/browser_handlers.py b/backend/modules/browser/browser_handlers.py
index 4ab19e163..3a726d068 100644
--- a/backend/modules/browser/browser_handlers.py
+++ b/backend/modules/browser/browser_handlers.py
@@ -55,7 +55,7 @@ def get(self, dataset: str, datatype: str, item: str,  # pylint: disable=too-man
         filename = f'{dataset}_{datatype}_{item}.csv'
         self.set_header('Content-Type', 'text/csv')
         self.set_header(f'content-Disposition',
-                        f'attachement; filename={filename}')
+                        f'attachment; filename={filename}')
 
         data = utils.get_variant_list(dataset, datatype, item, ds_version)
         # filter variants based on what is shown

From ea3bb870785d58bc534e7b81eea9a86263652368 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Linus=20=C3=96stberg?= <linus.ostberg@scilifelab.uu.se>
Date: Mon, 26 Aug 2019 09:31:42 +0200
Subject: [PATCH 126/126] Add filename check to download tests.

---
 backend/modules/browser/tests/test_browser_handlers.py | 7 +++++--
 1 file changed, 5 insertions(+), 2 deletions(-)

diff --git a/backend/modules/browser/tests/test_browser_handlers.py b/backend/modules/browser/tests/test_browser_handlers.py
index debcc9bbd..2657323de 100644
--- a/backend/modules/browser/tests/test_browser_handlers.py
+++ b/backend/modules/browser/tests/test_browser_handlers.py
@@ -33,19 +33,22 @@ def test_download():
     response = requests.get('{}/api/dataset/{}/browser/download/{}/{}'.format(BASE_URL, dataset, data_type, data_item))
     assert len(response.text.split('\n')) == 180  # header + 178 + \n
     response = requests.get('{}/api/dataset/{}/browser/download/{}/{}/filter/all~false'.format(BASE_URL, dataset, data_type, data_item))
-    import logging
-    logging.error(response.text.split('\n'))
     assert len(response.text.split('\n')) == 8
     response = requests.get('{}/api/dataset/{}/browser/download/{}/{}/filter/all~true'.format(BASE_URL, dataset, data_type, data_item))
     assert len(response.text.split('\n')) == 180
     response = requests.get('{}/api/dataset/{}/browser/download/{}/{}/filter/mislof~true'.format(BASE_URL, dataset, data_type, data_item))
     assert len(response.text.split('\n')) == 2
+    filename = f'{dataset}_{data_type}_{data_item}.csv'
+    assert response.headers['content-disposition'] == f'attachment; filename={filename}'
+
     data_type = 'region'
     data_item = '22-29450622-29465622'
     response = requests.get('{}/api/dataset/{}/browser/download/{}/{}/filter/mislof~false'.format(BASE_URL, dataset, data_type, data_item))
     assert len(response.text.split('\n')) == 3
     response = requests.get('{}/api/dataset/{}/browser/download/{}/{}/filter/lof~false'.format(BASE_URL, dataset, data_type, data_item))
     assert len(response.text.split('\n')) == 3
+    filename = f'{dataset}_{data_type}_{data_item}.csv'
+    assert response.headers['content-disposition'] == f'attachment; filename={filename}'
 
 
 def test_get_coverage():