From b19b19833975fb8f675612b38560a17735be191e Mon Sep 17 00:00:00 2001
From: Sascha Mann <SaschaMann@users.noreply.github.com>
Date: Wed, 8 Feb 2017 15:56:20 +0100
Subject: [PATCH] Add exercise: nucleotide count (#31)

* Add exercise: nucleotide count

* Remove hard-coded tuple of valid symbols
---
 config.json                                   |  9 +++++++++
 exercises/nucleotide-count/example.jl         |  8 ++++++++
 .../nucleotide-count/nucleotide-count.jl      |  3 +++
 exercises/nucleotide-count/runtests.jl        | 19 +++++++++++++++++++
 4 files changed, 39 insertions(+)
 create mode 100644 exercises/nucleotide-count/example.jl
 create mode 100644 exercises/nucleotide-count/nucleotide-count.jl
 create mode 100644 exercises/nucleotide-count/runtests.jl

diff --git a/config.json b/config.json
index 6fef5e31355cc..edbdf79643a56 100644
--- a/config.json
+++ b/config.json
@@ -35,6 +35,15 @@
         "generators"
       ]
     },
+    {
+      "slug": "nucleotide-count",
+      "difficulty": 1,
+      "topics": [
+        "chars",
+        "strings",
+        "control-flow (loops)"
+      ]
+    },
     {
       "slug": "word-count",
       "difficulty": 1,
diff --git a/exercises/nucleotide-count/example.jl b/exercises/nucleotide-count/example.jl
new file mode 100644
index 0000000000000..7e1658fca4967
--- /dev/null
+++ b/exercises/nucleotide-count/example.jl
@@ -0,0 +1,8 @@
+function count_nucleotides(strand::AbstractString)
+    counter = Dict('A' => 0, 'C' => 0, 'G' => 0, 'T' => 0)
+    for sym in strand
+        sym in keys(counter) || error("Invalid nucleotide in strand")
+        counter[sym] += 1
+    end
+    return counter
+end
diff --git a/exercises/nucleotide-count/nucleotide-count.jl b/exercises/nucleotide-count/nucleotide-count.jl
new file mode 100644
index 0000000000000..460d4b0d64544
--- /dev/null
+++ b/exercises/nucleotide-count/nucleotide-count.jl
@@ -0,0 +1,3 @@
+function count_nucleotides(strand::AbstractString)
+
+end
diff --git a/exercises/nucleotide-count/runtests.jl b/exercises/nucleotide-count/runtests.jl
new file mode 100644
index 0000000000000..25f227b35a569
--- /dev/null
+++ b/exercises/nucleotide-count/runtests.jl
@@ -0,0 +1,19 @@
+using Base.Test
+
+include("nucleotide-count.jl")
+
+@testset "empty strand" begin
+    @test count_nucleotides("") == Dict('A' => 0, 'C' => 0, 'G' => 0, 'T' => 0)
+end
+
+@testset "strand with repeated nucleotide" begin
+    @test count_nucleotides("GGGGGGG") == Dict('A' => 0, 'C' => 0, 'G' => 7, 'T' => 0)
+end
+
+@testset "strand with multiple nucleotides" begin
+    @test count_nucleotides("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC") == Dict('A' => 20, 'C' => 12, 'G' => 17, 'T' => 21)
+end
+
+@testset "strand with invalid nucleotides" begin
+    @test_throws ErrorException count_nucleotides("AGXXACT")
+end