Issue with Color Overlap in IGV Genome Track

[yzhirui]

Hi,
I am using IGV version 2.18.2 on linux. When plotting reads per BAM file, I noticed that the genome track exhibits color overlap, as shown in the attached picture.

I also checked the initial bases of this region:
AGTCCAGCTGTGGACAGTGCTTCAGAGAGG
It's not caused by degenerate bases.

Could this overlap be due to alternative alleles in relative positions? How can I change this display to show the original genome bases instead?

And my bat file like this：

new
preference SAM.FILTER_DUPLICATES false
genome genome.fa
snapshotDirectory IGV_plot
load a.bam
load b.bam
load c.bam
snapshot plot.png
exit

Thank you!

[jrobinso]

Hi, sorry but I really don't know what you are showing us. What is that a picture of?

[yzhirui]

Hi, sorry but I really don't know what you are showing us. What is that a picture of?

Hi! Thanks for your quick response! The image is a snapshot of the genome sequence. I've included a complete example below.

Is that clearer now?

[jrobinso]

Yes that is clear. I don't know your screen resolution but you are possibly not zoomed in far enough to see individual bases.

[yzhirui]

Yes that is clear. I don't know your screen resolution but you are possibly not zoomed in far enough to see individual bases.

Ok, you are totally right. I used 300bp before, and when zoomed in to 100bp, this problem has been resolved.
Thank you again for your kindly help！