New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

MET Exon 14 skipping #1

Open

inodb opened this issue Jul 21, 2022 · 0 comments

Contributor

inodb commented Jul 21, 2022 •

edited

Loading

Example, one gets annotated and the other doesn't

7,116411875,116411894,CAAGCTCTTTCTTTCTCTCT,C (no oncokb annotation)
7,116411874,116411895,ACAAGCTCTTTCTTTCTCTCTG,A (onckb annotation)

Some potential solutions:

Short term. In OncoKB include deletions of splice_polyrimidine_tract_variant around protein position 963 as well
Long term. Manage this MET splice logic in REVUE, so we can group all of these together as “MET exon 14 skipping” and OncoKB doesn’t have to worry about it

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment