From c78108089c96508135b397a94da0d9f6dfc0878f Mon Sep 17 00:00:00 2001 From: Adam Talbot <12817534+adamrtalbot@users.noreply.github.com> Date: Wed, 3 Jan 2024 14:14:22 +0000 Subject: [PATCH] Revert "Update FastQC and UMItools modules" --- CHANGELOG.md | 15 - modules.json | 64 +-- modules/nf-core/fastp/environment.yml | 7 - modules/nf-core/fastp/main.nf | 8 +- modules/nf-core/fastp/meta.yml | 4 +- modules/nf-core/fastp/tests/main.nf.test | 485 ------------------ modules/nf-core/fastp/tests/main.nf.test.snap | 52 -- modules/nf-core/fastp/tests/nextflow.config | 6 - modules/nf-core/fastp/tests/tags.yml | 2 - modules/nf-core/fastqc/environment.yml | 7 - modules/nf-core/fastqc/main.nf | 6 +- modules/nf-core/fastqc/meta.yml | 5 - modules/nf-core/fastqc/tests/main.nf.test | 73 +-- modules/nf-core/fastqc/tests/tags.yml | 2 - .../picard/markduplicates/environment.yml | 7 - modules/nf-core/picard/markduplicates/main.nf | 6 +- .../nf-core/picard/markduplicates/meta.yml | 4 - .../picard/markduplicates/tests/main.nf.test | 111 ---- .../markduplicates/tests/main.nf.test.snap | 44 -- .../markduplicates/tests/nextflow.config | 6 - .../picard/markduplicates/tests/tags.yml | 2 - modules/nf-core/rseqc/bamstat/environment.yml | 8 - modules/nf-core/rseqc/bamstat/main.nf | 2 +- modules/nf-core/rseqc/bamstat/meta.yml | 3 - .../nf-core/rseqc/bamstat/tests/main.nf.test | 38 -- .../rseqc/bamstat/tests/main.nf.test.snap | 31 -- .../rseqc/bamstat/tests/nextflow.config | 5 - modules/nf-core/rseqc/bamstat/tests/tags.yml | 2 - .../rseqc/inferexperiment/environment.yml | 8 - modules/nf-core/rseqc/inferexperiment/main.nf | 2 +- .../nf-core/rseqc/inferexperiment/meta.yml | 4 - .../rseqc/inferexperiment/tests/main.nf.test | 34 -- .../inferexperiment/tests/main.nf.test.snap | 31 -- .../inferexperiment/tests/nextflow.config | 5 - .../rseqc/inferexperiment/tests/tags.yml | 2 - .../rseqc/innerdistance/environment.yml | 8 - modules/nf-core/rseqc/innerdistance/main.nf | 2 +- modules/nf-core/rseqc/innerdistance/meta.yml | 4 - .../rseqc/innerdistance/tests/main.nf.test | 41 -- .../innerdistance/tests/main.nf.test.snap | 68 --- .../rseqc/innerdistance/tests/nextflow.config | 5 - .../rseqc/innerdistance/tests/tags.yml | 2 - .../rseqc/junctionannotation/environment.yml | 8 - .../nf-core/rseqc/junctionannotation/main.nf | 4 +- .../nf-core/rseqc/junctionannotation/meta.yml | 3 - .../junctionannotation/tests/main.nf.test | 37 -- .../tests/main.nf.test.snap | 24 - .../rseqc/junctionannotation/tests/tags.yml | 2 - .../rseqc/junctionsaturation/environment.yml | 8 - .../nf-core/rseqc/junctionsaturation/main.nf | 2 +- .../nf-core/rseqc/junctionsaturation/meta.yml | 3 - .../junctionsaturation/tests/main.nf.test | 36 -- .../tests/main.nf.test.snap | 30 -- .../rseqc/junctionsaturation/tests/tags.yml | 2 - .../rseqc/readdistribution/environment.yml | 8 - .../nf-core/rseqc/readdistribution/main.nf | 2 +- .../nf-core/rseqc/readdistribution/meta.yml | 3 - .../rseqc/readdistribution/tests/main.nf.test | 33 -- .../readdistribution/tests/main.nf.test.snap | 33 -- .../rseqc/readdistribution/tests/tags.yml | 2 - .../rseqc/readduplication/environment.yml | 8 - modules/nf-core/rseqc/readduplication/main.nf | 2 +- .../nf-core/rseqc/readduplication/meta.yml | 5 - .../rseqc/readduplication/tests/main.nf.test | 36 -- .../readduplication/tests/main.nf.test.snap | 58 --- .../rseqc/readduplication/tests/tags.yml | 2 - modules/nf-core/rseqc/tin/environment.yml | 8 - modules/nf-core/rseqc/tin/main.nf | 2 +- modules/nf-core/rseqc/tin/meta.yml | 2 - modules/nf-core/rseqc/tin/tests/main.nf.test | 35 -- .../nf-core/rseqc/tin/tests/main.nf.test.snap | 47 -- modules/nf-core/rseqc/tin/tests/tags.yml | 2 - .../nf-core/samtools/flagstat/environment.yml | 7 - modules/nf-core/samtools/flagstat/main.nf | 6 +- modules/nf-core/samtools/flagstat/meta.yml | 2 - .../samtools/flagstat/tests/main.nf.test | 36 -- .../samtools/flagstat/tests/main.nf.test.snap | 16 - .../nf-core/samtools/flagstat/tests/tags.yml | 2 - .../nf-core/samtools/idxstats/environment.yml | 7 - modules/nf-core/samtools/idxstats/main.nf | 6 +- modules/nf-core/samtools/idxstats/meta.yml | 2 - .../samtools/idxstats/tests/main.nf.test | 36 -- .../samtools/idxstats/tests/main.nf.test.snap | 16 - .../nf-core/samtools/idxstats/tests/tags.yml | 2 - .../nf-core/samtools/index/environment.yml | 7 - modules/nf-core/samtools/index/main.nf | 6 +- modules/nf-core/samtools/index/meta.yml | 4 - .../samtools/index/tests/csi.nextflow.config | 7 - .../nf-core/samtools/index/tests/main.nf.test | 87 ---- .../samtools/index/tests/main.nf.test.snap | 28 - modules/nf-core/samtools/index/tests/tags.yml | 2 - modules/nf-core/samtools/sort/environment.yml | 7 - modules/nf-core/samtools/sort/main.nf | 6 +- modules/nf-core/samtools/sort/meta.yml | 3 - .../nf-core/samtools/sort/tests/main.nf.test | 73 --- .../samtools/sort/tests/main.nf.test.snap | 48 -- .../samtools/sort/tests/nextflow.config | 7 - modules/nf-core/samtools/sort/tests/tags.yml | 3 - .../nf-core/samtools/stats/environment.yml | 7 - modules/nf-core/samtools/stats/main.nf | 6 +- modules/nf-core/samtools/stats/meta.yml | 4 - .../nf-core/samtools/stats/tests/main.nf.test | 78 --- .../samtools/stats/tests/main.nf.test.snap | 64 --- modules/nf-core/samtools/stats/tests/tags.yml | 2 - modules/nf-core/trimgalore/environment.yml | 7 - modules/nf-core/trimgalore/main.nf | 2 +- modules/nf-core/trimgalore/meta.yml | 4 - modules/nf-core/trimgalore/tests/main.nf.test | 105 ---- .../trimgalore/tests/main.nf.test.snap | 148 ------ modules/nf-core/trimgalore/tests/tags.yml | 2 - .../nf-core/umitools/dedup/environment.yml | 7 - modules/nf-core/umitools/dedup/main.nf | 6 +- modules/nf-core/umitools/dedup/meta.yml | 9 +- .../nf-core/umitools/extract/environment.yml | 7 - modules/nf-core/umitools/extract/main.nf | 6 +- modules/nf-core/umitools/extract/meta.yml | 17 +- .../umitools/extract/tests/main.nf.test | 35 -- .../umitools/extract/tests/main.nf.test.snap | 10 - .../umitools/extract/tests/nextflow.config | 9 - .../nf-core/umitools/extract/tests/tags.yml | 2 - .../meta.yml | 4 +- .../tests/main.nf.test | 51 -- .../tests/main.nf.test.snap | 41 -- .../tests/tags.yml | 2 - .../bam_markduplicates_picard/meta.yml | 5 +- subworkflows/nf-core/bam_rseqc/main.nf | 158 +++--- subworkflows/nf-core/bam_rseqc/meta.yml | 73 +-- .../nf-core/bam_rseqc/tests/main.nf.test | 96 ---- .../nf-core/bam_rseqc/tests/main.nf.test.snap | 151 ------ subworkflows/nf-core/bam_rseqc/tests/tags.yml | 2 - .../nf-core/bam_sort_stats_samtools/meta.yml | 3 - .../tests/main.nf.test | 78 --- .../tests/main.nf.test.snap | 86 ---- .../bam_sort_stats_samtools/tests/tags.yml | 2 - .../nf-core/bam_stats_samtools/meta.yml | 2 - .../bam_stats_samtools/tests/main.nf.test | 102 ---- .../tests/main.nf.test.snap | 128 ----- .../nf-core/bam_stats_samtools/tests/tags.yml | 2 - .../fastq_fastqc_umitools_fastp/meta.yml | 8 +- .../tests/main.nf.test | 60 --- .../tests/main.nf.test.snap | 81 --- .../tests/tags.yml | 2 - .../fastq_fastqc_umitools_trimgalore/meta.yml | 10 +- workflows/rnaseq.nf | 28 +- 144 files changed, 205 insertions(+), 3601 deletions(-) delete mode 100644 modules/nf-core/fastp/environment.yml delete mode 100644 modules/nf-core/fastp/tests/main.nf.test delete mode 100644 modules/nf-core/fastp/tests/main.nf.test.snap delete mode 100644 modules/nf-core/fastp/tests/nextflow.config delete mode 100644 modules/nf-core/fastp/tests/tags.yml delete mode 100644 modules/nf-core/fastqc/environment.yml delete mode 100644 modules/nf-core/fastqc/tests/tags.yml delete mode 100644 modules/nf-core/picard/markduplicates/environment.yml delete mode 100644 modules/nf-core/picard/markduplicates/tests/main.nf.test delete mode 100644 modules/nf-core/picard/markduplicates/tests/main.nf.test.snap delete mode 100644 modules/nf-core/picard/markduplicates/tests/nextflow.config delete mode 100644 modules/nf-core/picard/markduplicates/tests/tags.yml delete mode 100644 modules/nf-core/rseqc/bamstat/environment.yml delete mode 100644 modules/nf-core/rseqc/bamstat/tests/main.nf.test delete mode 100644 modules/nf-core/rseqc/bamstat/tests/main.nf.test.snap delete mode 100644 modules/nf-core/rseqc/bamstat/tests/nextflow.config delete mode 100644 modules/nf-core/rseqc/bamstat/tests/tags.yml delete mode 100644 modules/nf-core/rseqc/inferexperiment/environment.yml delete mode 100644 modules/nf-core/rseqc/inferexperiment/tests/main.nf.test delete mode 100644 modules/nf-core/rseqc/inferexperiment/tests/main.nf.test.snap delete mode 100644 modules/nf-core/rseqc/inferexperiment/tests/nextflow.config delete mode 100644 modules/nf-core/rseqc/inferexperiment/tests/tags.yml delete mode 100644 modules/nf-core/rseqc/innerdistance/environment.yml delete mode 100644 modules/nf-core/rseqc/innerdistance/tests/main.nf.test delete mode 100644 modules/nf-core/rseqc/innerdistance/tests/main.nf.test.snap delete mode 100644 modules/nf-core/rseqc/innerdistance/tests/nextflow.config delete mode 100644 modules/nf-core/rseqc/innerdistance/tests/tags.yml delete mode 100644 modules/nf-core/rseqc/junctionannotation/environment.yml delete mode 100644 modules/nf-core/rseqc/junctionannotation/tests/main.nf.test delete mode 100644 modules/nf-core/rseqc/junctionannotation/tests/main.nf.test.snap delete mode 100644 modules/nf-core/rseqc/junctionannotation/tests/tags.yml delete mode 100644 modules/nf-core/rseqc/junctionsaturation/environment.yml delete mode 100644 modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test delete mode 100644 modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test.snap delete mode 100644 modules/nf-core/rseqc/junctionsaturation/tests/tags.yml delete mode 100644 modules/nf-core/rseqc/readdistribution/environment.yml delete mode 100644 modules/nf-core/rseqc/readdistribution/tests/main.nf.test delete mode 100644 modules/nf-core/rseqc/readdistribution/tests/main.nf.test.snap delete mode 100644 modules/nf-core/rseqc/readdistribution/tests/tags.yml delete mode 100644 modules/nf-core/rseqc/readduplication/environment.yml delete mode 100644 modules/nf-core/rseqc/readduplication/tests/main.nf.test delete mode 100644 modules/nf-core/rseqc/readduplication/tests/main.nf.test.snap delete mode 100644 modules/nf-core/rseqc/readduplication/tests/tags.yml delete mode 100644 modules/nf-core/rseqc/tin/environment.yml delete mode 100644 modules/nf-core/rseqc/tin/tests/main.nf.test delete mode 100644 modules/nf-core/rseqc/tin/tests/main.nf.test.snap delete mode 100644 modules/nf-core/rseqc/tin/tests/tags.yml delete mode 100644 modules/nf-core/samtools/flagstat/environment.yml delete mode 100644 modules/nf-core/samtools/flagstat/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/flagstat/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/flagstat/tests/tags.yml delete mode 100644 modules/nf-core/samtools/idxstats/environment.yml delete mode 100644 modules/nf-core/samtools/idxstats/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/idxstats/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/idxstats/tests/tags.yml delete mode 100644 modules/nf-core/samtools/index/environment.yml delete mode 100644 modules/nf-core/samtools/index/tests/csi.nextflow.config delete mode 100644 modules/nf-core/samtools/index/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/index/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/index/tests/tags.yml delete mode 100644 modules/nf-core/samtools/sort/environment.yml delete mode 100644 modules/nf-core/samtools/sort/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/sort/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/sort/tests/nextflow.config delete mode 100644 modules/nf-core/samtools/sort/tests/tags.yml delete mode 100644 modules/nf-core/samtools/stats/environment.yml delete mode 100644 modules/nf-core/samtools/stats/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/stats/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/stats/tests/tags.yml delete mode 100644 modules/nf-core/trimgalore/environment.yml delete mode 100644 modules/nf-core/trimgalore/tests/main.nf.test delete mode 100644 modules/nf-core/trimgalore/tests/main.nf.test.snap delete mode 100644 modules/nf-core/trimgalore/tests/tags.yml delete mode 100644 modules/nf-core/umitools/dedup/environment.yml delete mode 100644 modules/nf-core/umitools/extract/environment.yml delete mode 100644 modules/nf-core/umitools/extract/tests/main.nf.test delete mode 100644 modules/nf-core/umitools/extract/tests/main.nf.test.snap delete mode 100644 modules/nf-core/umitools/extract/tests/nextflow.config delete mode 100644 modules/nf-core/umitools/extract/tests/tags.yml delete mode 100644 subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test delete mode 100644 subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap delete mode 100644 subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml delete mode 100644 subworkflows/nf-core/bam_rseqc/tests/main.nf.test delete mode 100644 subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap delete mode 100644 subworkflows/nf-core/bam_rseqc/tests/tags.yml delete mode 100644 subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test delete mode 100644 subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap delete mode 100644 subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml delete mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test delete mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap delete mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/tags.yml delete mode 100644 subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test delete mode 100644 subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap delete mode 100644 subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml diff --git a/CHANGELOG.md b/CHANGELOG.md index ba6701c2f..d6544378a 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -10,26 +10,11 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### Enhancements & fixes - [PR #1135](https://github.com/nf-core/rnaseq/pull/1135) - Update [action-tower-launch](https://github.com/marketplace/actions/action-tower-launch) to v2 which supports more variable handling. -- [PR #1138](https://github.com/nf-core/rnaseq/pull/1138) - Updates FASTQC and UMITOOLS modules and their dependencies which have had their version string extraction commands updated ([#1103](https://github.com/nf-core/rnaseq/issues/1103)) -- Update Rseqc and Fastp modules to print STDERR to screen and file. ### Software dependencies -| Dependency | Old version | New version | -| ---------- | ----------- | ----------- | -| `picard` | 3.0.0 | 3.1.1 | -| `samtools` | 1.17 | 1.18 | - -> **NB:** Dependency has been **updated** if both old and new version information is present. -> -> **NB:** Dependency has been **added** if just the new version information is present. -> -> **NB:** Dependency has been **removed** if new version information isn't present. - ### Modules / Subworkflows -- BAM_RSEQC subworkflow updated with new channel names. - ## [[3.13.2](https://github.com/nf-core/rnaseq/releases/tag/3.13.2)] - 2023-11-21 ### Credits diff --git a/modules.json b/modules.json index 7cc90d6d3..e78ca060c 100644 --- a/modules.json +++ b/modules.json @@ -27,12 +27,12 @@ }, "fastp": { "branch": "master", - "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde", - "installed_by": ["modules", "fastq_fastqc_umitools_fastp"] + "git_sha": "d497a4868ace3302016ea8ed4b395072d5e833cd", + "installed_by": ["fastq_fastqc_umitools_fastp", "modules"] }, "fastqc": { "branch": "master", - "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53", + "git_sha": "102cc9b709a6da9f7cee2373563ab1464fca9c0a", "installed_by": ["fastq_fastqc_umitools_trimgalore", "fastq_fastqc_umitools_fastp"] }, "fq/subsample": { @@ -77,7 +77,7 @@ }, "picard/markduplicates": { "branch": "master", - "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447", + "git_sha": "2ee934606f1fdf7fc1cb05d6e8abc13bec8ab448", "installed_by": ["bam_markduplicates_picard"] }, "preseq/lcextrap": { @@ -102,42 +102,42 @@ }, "rseqc/bamstat": { "branch": "master", - "git_sha": "65acf692457e8c466e104c6a3e5ac392e98fe688", + "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", "installed_by": ["bam_rseqc"] }, "rseqc/inferexperiment": { "branch": "master", - "git_sha": "f2a3328fde9a2b4185285057f8d3727f39dd2aef", + "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", "installed_by": ["bam_rseqc"] }, "rseqc/innerdistance": { "branch": "master", - "git_sha": "3e839096a1be5da4f68d1de1066e4d0bc13f5d6d", + "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", "installed_by": ["bam_rseqc"] }, "rseqc/junctionannotation": { "branch": "master", - "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde", + "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", "installed_by": ["bam_rseqc"] }, "rseqc/junctionsaturation": { "branch": "master", - "git_sha": "9dfed3180f80f599c91daf5112d73a5e59367c24", + "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", "installed_by": ["bam_rseqc"] }, "rseqc/readdistribution": { "branch": "master", - "git_sha": "7bb1b295a359bcbf0a0ea03d19d40a00916805ee", + "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", "installed_by": ["bam_rseqc"] }, "rseqc/readduplication": { "branch": "master", - "git_sha": "db02573fdd89210d09ce9e2ac06857902a7fffec", + "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", "installed_by": ["bam_rseqc"] }, "rseqc/tin": { "branch": "master", - "git_sha": "4acfdd20843d5b6d63f9181721a6856447cb7bec", + "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", "installed_by": ["bam_rseqc"] }, "salmon/index": { @@ -152,31 +152,31 @@ }, "samtools/flagstat": { "branch": "master", - "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", + "git_sha": "570ec5bcfe19c49e16c9ca35a7a116563af6cc1c", "installed_by": ["bam_stats_samtools"] }, "samtools/idxstats": { "branch": "master", - "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", + "git_sha": "e662ab16e0c11f1e62983e21de9871f59371a639", "installed_by": ["bam_stats_samtools"] }, "samtools/index": { "branch": "master", - "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", + "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", "installed_by": [ - "bam_dedup_stats_samtools_umitools", "bam_markduplicates_picard", - "bam_sort_stats_samtools" + "bam_sort_stats_samtools", + "bam_dedup_stats_samtools_umitools" ] }, "samtools/sort": { "branch": "master", - "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", + "git_sha": "a0f7be95788366c1923171e358da7d049eb440f9", "installed_by": ["bam_sort_stats_samtools"] }, "samtools/stats": { "branch": "master", - "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", + "git_sha": "735e1e04e7e01751d2d6e97055bbdb6f70683cc1", "installed_by": ["bam_stats_samtools"] }, "sortmerna": { @@ -206,7 +206,7 @@ }, "trimgalore": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", + "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", "installed_by": ["fastq_fastqc_umitools_trimgalore"] }, "ucsc/bedclip": { @@ -221,13 +221,13 @@ }, "umitools/dedup": { "branch": "master", - "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53", + "git_sha": "7297204bf49273300a3dbfa4b7a4027c8683f1bd", "installed_by": ["bam_dedup_stats_samtools_umitools"] }, "umitools/extract": { "branch": "master", - "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53", - "installed_by": ["fastq_fastqc_umitools_trimgalore", "fastq_fastqc_umitools_fastp"] + "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", + "installed_by": ["fastq_fastqc_umitools_fastp", "fastq_fastqc_umitools_trimgalore"] }, "untar": { "branch": "master", @@ -240,31 +240,31 @@ "nf-core": { "bam_dedup_stats_samtools_umitools": { "branch": "master", - "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", + "git_sha": "dedc0e31087f3306101c38835d051bf49789445a", "installed_by": ["subworkflows"] }, "bam_markduplicates_picard": { "branch": "master", - "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", + "git_sha": "dedc0e31087f3306101c38835d051bf49789445a", "installed_by": ["subworkflows"] }, "bam_rseqc": { "branch": "master", - "git_sha": "92793c143c93acd9129f15f35f25d3aab2b23c0e", + "git_sha": "a9784afdd5dcda23b84e64db75dc591065d64653", "installed_by": ["subworkflows"] }, "bam_sort_stats_samtools": { "branch": "master", - "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", + "git_sha": "dedc0e31087f3306101c38835d051bf49789445a", "installed_by": ["fastq_align_hisat2"] }, "bam_stats_samtools": { "branch": "master", - "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", + "git_sha": "dedc0e31087f3306101c38835d051bf49789445a", "installed_by": [ - "bam_dedup_stats_samtools_umitools", + "bam_sort_stats_samtools", "bam_markduplicates_picard", - "bam_sort_stats_samtools" + "bam_dedup_stats_samtools_umitools" ] }, "bedgraph_bedclip_bedgraphtobigwig": { @@ -279,12 +279,12 @@ }, "fastq_fastqc_umitools_fastp": { "branch": "master", - "git_sha": "3e8b0c1144ccf60b7848efbdc2be285ff20b49ee", + "git_sha": "dedc0e31087f3306101c38835d051bf49789445a", "installed_by": ["subworkflows"] }, "fastq_fastqc_umitools_trimgalore": { "branch": "master", - "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", + "git_sha": "dedc0e31087f3306101c38835d051bf49789445a", "installed_by": ["subworkflows"] }, "fastq_subsample_fq_salmon": { diff --git a/modules/nf-core/fastp/environment.yml b/modules/nf-core/fastp/environment.yml deleted file mode 100644 index 70389e664..000000000 --- a/modules/nf-core/fastp/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: fastp -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::fastp=0.23.4 diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf index 5fac3c1ad..831b7f128 100644 --- a/modules/nf-core/fastp/main.nf +++ b/modules/nf-core/fastp/main.nf @@ -2,7 +2,7 @@ process FASTP { tag "$meta.id" label 'process_medium' - conda "${moduleDir}/environment.yml" + conda "bioconda::fastp=0.23.4" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/fastp:0.23.4--h5f740d0_0' : 'biocontainers/fastp:0.23.4--h5f740d0_0' }" @@ -45,7 +45,7 @@ process FASTP { $adapter_list \\ $fail_fastq \\ $args \\ - 2> >(tee ${prefix}.fastp.log >&2) \\ + 2> ${prefix}.fastp.log \\ | gzip -c > ${prefix}.fastp.fastq.gz cat <<-END_VERSIONS > versions.yml @@ -66,7 +66,7 @@ process FASTP { $adapter_list \\ $fail_fastq \\ $args \\ - 2> >(tee ${prefix}.fastp.log >&2) + 2> ${prefix}.fastp.log cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -91,7 +91,7 @@ process FASTP { --thread $task.cpus \\ --detect_adapter_for_pe \\ $args \\ - 2> >(tee ${prefix}.fastp.log >&2) + 2> ${prefix}.fastp.log cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml index c22a16abd..197ea7ca6 100644 --- a/modules/nf-core/fastp/meta.yml +++ b/modules/nf-core/fastp/meta.yml @@ -33,6 +33,7 @@ input: - save_merged: type: boolean description: Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz` + output: - meta: type: map @@ -70,6 +71,3 @@ output: authors: - "@drpatelh" - "@kevinmenden" -maintainers: - - "@drpatelh" - - "@kevinmenden" diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test deleted file mode 100644 index f610b735e..000000000 --- a/modules/nf-core/fastp/tests/main.nf.test +++ /dev/null @@ -1,485 +0,0 @@ -nextflow_process { - - name "Test Process FASTP" - script "../main.nf" - process "FASTP" - tag "modules" - tag "modules_nfcore" - tag "fastp" - - test("test_fastp_single_end") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = false - - input[0] = [ - [ id:'test', single_end:true ], - [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] - ] - - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged - """ - } - } - - then { - def html_text = [ "Q20 bases:12.922000 K (92.984097%)", - "single end (151 cycles)" ] - def log_text = [ "Q20 bases: 12922(92.9841%)", - "reads passed filter: 99" ] - def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { assert snapshot(process.out.json).match("test_fastp_single_end_json") }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions") } - ) - } - } - - test("test_fastp_paired_end") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = false - - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] - ] - - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged - """ - } - } - - then { - def html_text = [ "Q20 bases:25.719000 K (93.033098%)", - "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] - def log_text = [ "No adapter detected for read1", - "Q30 bases: 12281(88.3716%)"] - def json_text = ['"passed_filter_reads": 198'] - def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions") } - ) - } - } - - test("fastp test_fastp_interleaved") { - config './nextflow.config' - when { - params { - outdir = "$outputDir" - } - process { - """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = false - - input[0] = [ [ id:'test', single_end:true ], // meta map - [ file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) ] - ] - - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged - """ - } - } - - then { - def html_text = [ "Q20 bases:25.719000 K (93.033098%)", - "paired end (151 cycles + 151 cycles)"] - def log_text = [ "Q20 bases: 12922(92.9841%)", - "reads passed filter: 198"] - def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions") } - ) - } - } - - test("test_fastp_single_end_trim_fail") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - adapter_fasta = [] - save_trimmed_fail = true - save_merged = false - - input[0] = [ [ id:'test', single_end:true ], // meta map - [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] - ] - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged - """ - } - } - - then { - def html_text = [ "Q20 bases:12.922000 K (92.984097%)", - "single end (151 cycles)"] - def log_text = [ "Q20 bases: 12922(92.9841%)", - "reads passed filter: 99" ] - def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } - } - }, - { failed_read_lines.each { failed_read_line -> - { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions") } - ) - } - } - - test("test_fastp_paired_end_trim_fail") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - adapter_fasta = [] - save_trimmed_fail = true - save_merged = false - - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) - ] - ] - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged - """ - } - } - - then { - def html_text = [ "Q20 bases:25.719000 K (93.033098%)", - "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] - def log_text = [ "No adapter detected for read1", - "Q30 bases: 12281(88.3716%)"] - def json_text = ['"passed_filter_reads": 198'] - def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { failed_read2_lines.each { failed_read2_line -> - { assert path(process.out.reads_fail.get(0).get(1).get(1)).linesGzip.contains(failed_read2_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions") } - ) - } - } - - test("test_fastp_paired_end_merged") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = true - - input[0] = [ [ id:'test', single_end:false ], // meta map - [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] - ] - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged - """ - } - } - - then { - def html_text = [ "
"] - def log_text = [ "Merged and filtered:", - "total reads: 75", - "total bases: 13683"] - def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683'] - def read1_lines = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", - "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", - "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { read_merged_lines.each { read_merged_line -> - { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions") } - ) - } - } - - test("test_fastp_paired_end_merged_adapterlist") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - adapter_fasta = file("https://github.com/nf-core/test-datasets/raw/modules/data/delete_me/fastp/adapters.fasta", checkIfExists: true) - save_trimmed_fail = false - save_merged = true - - input[0] = [ [ id:'test', single_end:false ], // meta map - [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] - ] - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged - """ - } - } - - then { - def html_text = [ "
"] - def log_text = [ "Merged and filtered:", - "total reads: 75", - "total bases: 13683"] - def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"] - def read1_lines = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", - "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", - "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { read_merged_lines.each { read_merged_line -> - { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions") } - ) - } - } -} diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap deleted file mode 100644 index 0fa68c7d7..000000000 --- a/modules/nf-core/fastp/tests/main.nf.test.snap +++ /dev/null @@ -1,52 +0,0 @@ -{ - "fastp test_fastp_interleaved_json": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,168f516f7bd4b7b6c32da7cba87299a4" - ] - ] - ], - "timestamp": "2023-10-17T11:04:45.794175881" - }, - "test_fastp_single_end_json": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" - ] - ] - ], - "timestamp": "2023-10-17T11:04:10.566343705" - }, - "versions": { - "content": [ - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] - ], - "timestamp": "2023-10-17T11:04:10.582076024" - }, - "test_fastp_single_end_trim_fail_json": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" - ] - ] - ], - "timestamp": "2023-10-17T11:05:00.379878948" - } -} \ No newline at end of file diff --git a/modules/nf-core/fastp/tests/nextflow.config b/modules/nf-core/fastp/tests/nextflow.config deleted file mode 100644 index 0f7849ad9..000000000 --- a/modules/nf-core/fastp/tests/nextflow.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - - withName: FASTP { - ext.args = "--interleaved_in" - } -} diff --git a/modules/nf-core/fastp/tests/tags.yml b/modules/nf-core/fastp/tests/tags.yml deleted file mode 100644 index c1afcce75..000000000 --- a/modules/nf-core/fastp/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -fastp: - - modules/nf-core/fastp/** diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml deleted file mode 100644 index 1787b38a9..000000000 --- a/modules/nf-core/fastqc/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: fastqc -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index 9e19a74c5..67209f793 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -2,7 +2,7 @@ process FASTQC { tag "$meta.id" label 'process_medium' - conda "${moduleDir}/environment.yml" + conda "bioconda::fastqc=0.12.1" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' : 'biocontainers/fastqc:0.12.1--hdfd78af_0' }" @@ -37,7 +37,7 @@ process FASTQC { cat <<-END_VERSIONS > versions.yml "${task.process}": - fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) + fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" ) END_VERSIONS """ @@ -49,7 +49,7 @@ process FASTQC { cat <<-END_VERSIONS > versions.yml "${task.process}": - fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) + fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" ) END_VERSIONS """ } diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index ee5507e06..4da5bb5a0 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -50,8 +50,3 @@ authors: - "@grst" - "@ewels" - "@FelixKrueger" -maintainers: - - "@drpatelh" - - "@grst" - - "@ewels" - - "@FelixKrueger" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test index b9e8f926e..badb67161 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -1,11 +1,10 @@ nextflow_process { name "Test Process FASTQC" - script "../main.nf" + script "modules/nf-core/fastqc/main.nf" process "FASTQC" - tag "modules" - tag "modules_nfcore" tag "fastqc" + tag "modules_nfcore" test("Single-Read") { @@ -38,72 +37,4 @@ nextflow_process { ) } } -// TODO -// // -// // Test with paired-end data -// // -// workflow test_fastqc_paired_end { -// input = [ -// [id: 'test', single_end: false], // meta map -// [ -// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), -// file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) -// ] -// ] - -// FASTQC ( input ) -// } - -// // -// // Test with interleaved data -// // -// workflow test_fastqc_interleaved { -// input = [ -// [id: 'test', single_end: false], // meta map -// file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) -// ] - -// FASTQC ( input ) -// } - -// // -// // Test with bam data -// // -// workflow test_fastqc_bam { -// input = [ -// [id: 'test', single_end: false], // meta map -// file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) -// ] - -// FASTQC ( input ) -// } - -// // -// // Test with multiple samples -// // -// workflow test_fastqc_multiple { -// input = [ -// [id: 'test', single_end: false], // meta map -// [ -// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), -// file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true), -// file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true), -// file(params.test_data['sarscov2']['illumina']['test2_2_fastq_gz'], checkIfExists: true) -// ] -// ] - -// FASTQC ( input ) -// } - -// // -// // Test with custom prefix -// // -// workflow test_fastqc_custom_prefix { -// input = [ -// [ id:'mysample', single_end:true ], // meta map -// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) -// ] - -// FASTQC ( input ) -// } } diff --git a/modules/nf-core/fastqc/tests/tags.yml b/modules/nf-core/fastqc/tests/tags.yml deleted file mode 100644 index 7834294ba..000000000 --- a/modules/nf-core/fastqc/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -fastqc: - - modules/nf-core/fastqc/** diff --git a/modules/nf-core/picard/markduplicates/environment.yml b/modules/nf-core/picard/markduplicates/environment.yml deleted file mode 100644 index 58b795f54..000000000 --- a/modules/nf-core/picard/markduplicates/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: picard_markduplicates -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::picard=3.1.1 diff --git a/modules/nf-core/picard/markduplicates/main.nf b/modules/nf-core/picard/markduplicates/main.nf index 80930cc41..ebfa0864d 100644 --- a/modules/nf-core/picard/markduplicates/main.nf +++ b/modules/nf-core/picard/markduplicates/main.nf @@ -2,10 +2,10 @@ process PICARD_MARKDUPLICATES { tag "$meta.id" label 'process_medium' - conda "${moduleDir}/environment.yml" + conda "bioconda::picard=3.0.0" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/picard:3.1.1--hdfd78af_0' : - 'biocontainers/picard:3.1.1--hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/picard:3.0.0--hdfd78af_1' : + 'biocontainers/picard:3.0.0--hdfd78af_1' }" input: tuple val(meta), path(bam) diff --git a/modules/nf-core/picard/markduplicates/meta.yml b/modules/nf-core/picard/markduplicates/meta.yml index 1ab90c075..f7693d2f0 100644 --- a/modules/nf-core/picard/markduplicates/meta.yml +++ b/modules/nf-core/picard/markduplicates/meta.yml @@ -69,7 +69,3 @@ authors: - "@drpatelh" - "@projectoriented" - "@ramprasadn" -maintainers: - - "@drpatelh" - - "@projectoriented" - - "@ramprasadn" diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test b/modules/nf-core/picard/markduplicates/tests/main.nf.test deleted file mode 100644 index b2bba094f..000000000 --- a/modules/nf-core/picard/markduplicates/tests/main.nf.test +++ /dev/null @@ -1,111 +0,0 @@ -nextflow_process { - - name "Test Process PICARD_MARKDUPLICATES" - script "../main.nf" - process "PICARD_MARKDUPLICATES" - config "./nextflow.config" - tag "modules" - tag "modules_nfcore" - tag "picard" - tag "picard/markduplicates" - - test("sarscov2 - bam, fasta, fai - sorted bam") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) - ] - input[2] = [ - [ id:'genome' ], - file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.bam[0][1]).name, - path(process.out.metrics.get(0).get(1)).readLines()[0..2], - process.out.versions - ).match() } - ) - } - } - - test("sarscov2 - bam, fasta, fai - unsorted bam") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) - ] - input[2] = [ - [ id:'genome' ], - file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.bam[0][1]).name, - path(process.out.metrics.get(0).get(1)).readLines()[0..2], - process.out.versions - ).match() } - ) - } - } - - test("homo_sapiens - cram, fasta, fai") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], - file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) - ] - input[2] = [ - [ id:'genome' ], - file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.bam[0][1]).name, - path(process.out.metrics.get(0).get(1)).readLines()[0..2], - process.out.versions - ).match() } - ) - } - } - -} diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap deleted file mode 100644 index cd788a4d6..000000000 --- a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap +++ /dev/null @@ -1,44 +0,0 @@ -{ - "sarscov2 - bam, fasta, fai - unsorted bam": { - "content": [ - "test.marked.bam", - [ - "## htsjdk.samtools.metrics.StringHeader", - "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", - "## htsjdk.samtools.metrics.StringHeader" - ], - [ - "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" - ] - ], - "timestamp": "2023-11-28T10:50:37.735339781" - }, - "homo_sapiens - cram, fasta, fai": { - "content": [ - "test.marked.bam", - [ - "## htsjdk.samtools.metrics.StringHeader", - "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", - "## htsjdk.samtools.metrics.StringHeader" - ], - [ - "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" - ] - ], - "timestamp": "2023-11-28T10:50:48.897954543" - }, - "sarscov2 - bam, fasta, fai - sorted bam": { - "content": [ - "test.marked.bam", - [ - "## htsjdk.samtools.metrics.StringHeader", - "# MarkDuplicates --INPUT test.paired_end.sorted.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", - "## htsjdk.samtools.metrics.StringHeader" - ], - [ - "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" - ] - ], - "timestamp": "2023-11-28T10:50:26.591387512" - } -} \ No newline at end of file diff --git a/modules/nf-core/picard/markduplicates/tests/nextflow.config b/modules/nf-core/picard/markduplicates/tests/nextflow.config deleted file mode 100644 index 02818dd6e..000000000 --- a/modules/nf-core/picard/markduplicates/tests/nextflow.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - withName: PICARD_MARKDUPLICATES { - ext.prefix = { "${meta.id}.marked" } - ext.args = '--ASSUME_SORT_ORDER queryname' - } -} diff --git a/modules/nf-core/picard/markduplicates/tests/tags.yml b/modules/nf-core/picard/markduplicates/tests/tags.yml deleted file mode 100644 index 4f213d620..000000000 --- a/modules/nf-core/picard/markduplicates/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -picard/markduplicates: - - modules/nf-core/picard/markduplicates/** diff --git a/modules/nf-core/rseqc/bamstat/environment.yml b/modules/nf-core/rseqc/bamstat/environment.yml deleted file mode 100644 index bf0bf0829..000000000 --- a/modules/nf-core/rseqc/bamstat/environment.yml +++ /dev/null @@ -1,8 +0,0 @@ -name: rseqc_bamstat -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::rseqc=3.0.1 - - conda-forge::r-base>=3.5 diff --git a/modules/nf-core/rseqc/bamstat/main.nf b/modules/nf-core/rseqc/bamstat/main.nf index 33e6959e7..04c1eefd0 100644 --- a/modules/nf-core/rseqc/bamstat/main.nf +++ b/modules/nf-core/rseqc/bamstat/main.nf @@ -2,7 +2,7 @@ process RSEQC_BAMSTAT { tag "$meta.id" label 'process_medium' - conda "${moduleDir}/environment.yml" + conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' : 'biocontainers/rseqc:3.0.1--py37h516909a_1' }" diff --git a/modules/nf-core/rseqc/bamstat/meta.yml b/modules/nf-core/rseqc/bamstat/meta.yml index 72745310c..2d7fa7996 100644 --- a/modules/nf-core/rseqc/bamstat/meta.yml +++ b/modules/nf-core/rseqc/bamstat/meta.yml @@ -35,6 +35,3 @@ output: authors: - "@drpatelh" - "@kevinmenden" -maintainers: - - "@drpatelh" - - "@kevinmenden" diff --git a/modules/nf-core/rseqc/bamstat/tests/main.nf.test b/modules/nf-core/rseqc/bamstat/tests/main.nf.test deleted file mode 100644 index 1facabea0..000000000 --- a/modules/nf-core/rseqc/bamstat/tests/main.nf.test +++ /dev/null @@ -1,38 +0,0 @@ -nextflow_process { - - name "Test Process RSEQC_BAMSTAT" - script "../main.nf" - process "RSEQC_BAMSTAT" - - tag "modules" - tag "modules_nfcore" - tag "rseqc" - tag "rseqc/bamstat" - - config "./nextflow.config" - - test("sarscov2 - [meta] - bam") { - - when { - params { - // define parameters here. Example: - // outdir = "tests/results" - } - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) - ] - """ - } - } - - then { - assert process.success - assert snapshot(process.out).match() - } - - } - -} diff --git a/modules/nf-core/rseqc/bamstat/tests/main.nf.test.snap b/modules/nf-core/rseqc/bamstat/tests/main.nf.test.snap deleted file mode 100644 index b3cc3f55f..000000000 --- a/modules/nf-core/rseqc/bamstat/tests/main.nf.test.snap +++ /dev/null @@ -1,31 +0,0 @@ -{ - "sarscov2 - [meta] - bam": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bam_stat.txt:md5,2675857864c1d1139b2a19d25dc36b09" - ] - ], - "1": [ - "versions.yml:md5,300e8a9b6f8213d3621e53af09a9c728" - ], - "txt": [ - [ - { - "id": "test" - }, - "test.bam_stat.txt:md5,2675857864c1d1139b2a19d25dc36b09" - ] - ], - "versions": [ - "versions.yml:md5,300e8a9b6f8213d3621e53af09a9c728" - ] - } - ], - "timestamp": "2023-11-23T11:26:51.281041171" - } -} \ No newline at end of file diff --git a/modules/nf-core/rseqc/bamstat/tests/nextflow.config b/modules/nf-core/rseqc/bamstat/tests/nextflow.config deleted file mode 100644 index 8730f1c4b..000000000 --- a/modules/nf-core/rseqc/bamstat/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - - publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } - -} diff --git a/modules/nf-core/rseqc/bamstat/tests/tags.yml b/modules/nf-core/rseqc/bamstat/tests/tags.yml deleted file mode 100644 index ed9a41fa9..000000000 --- a/modules/nf-core/rseqc/bamstat/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -rseqc/bamstat: - - modules/nf-core/rseqc/bamstat/** diff --git a/modules/nf-core/rseqc/inferexperiment/environment.yml b/modules/nf-core/rseqc/inferexperiment/environment.yml deleted file mode 100644 index 1d3936f4e..000000000 --- a/modules/nf-core/rseqc/inferexperiment/environment.yml +++ /dev/null @@ -1,8 +0,0 @@ -name: rseqc_inferexperiment -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::rseqc=3.0.1 - - conda-forge::r-base>=3.5 diff --git a/modules/nf-core/rseqc/inferexperiment/main.nf b/modules/nf-core/rseqc/inferexperiment/main.nf index db6163387..5f9f4b111 100644 --- a/modules/nf-core/rseqc/inferexperiment/main.nf +++ b/modules/nf-core/rseqc/inferexperiment/main.nf @@ -2,7 +2,7 @@ process RSEQC_INFEREXPERIMENT { tag "$meta.id" label 'process_medium' - conda "${moduleDir}/environment.yml" + conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' : 'biocontainers/rseqc:3.0.1--py37h516909a_1' }" diff --git a/modules/nf-core/rseqc/inferexperiment/meta.yml b/modules/nf-core/rseqc/inferexperiment/meta.yml index d9b9ff63e..b4162059d 100644 --- a/modules/nf-core/rseqc/inferexperiment/meta.yml +++ b/modules/nf-core/rseqc/inferexperiment/meta.yml @@ -2,7 +2,6 @@ name: rseqc_inferexperiment description: Infer strandedness from sequencing reads keywords: - rnaseq - - strandedness - experiment tools: - rseqc: @@ -39,6 +38,3 @@ output: authors: - "@drpatelh" - "@kevinmenden" -maintainers: - - "@drpatelh" - - "@kevinmenden" diff --git a/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test b/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test deleted file mode 100644 index 97cd2cb9a..000000000 --- a/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test +++ /dev/null @@ -1,34 +0,0 @@ -nextflow_process { - - name "Test Process RSEQC_INFEREXPERIMENT" - script "../main.nf" - process "RSEQC_INFEREXPERIMENT" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "rseqc" - tag "rseqc/inferexperiment" - - test("sarscov2 - [[meta] - bam] - bed") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) - ] - input[1] = file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true) - """ - } - } - - then { - assert process.success - assert snapshot(process.out).match() - } - - } - -} diff --git a/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test.snap b/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test.snap deleted file mode 100644 index ca4faba2d..000000000 --- a/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test.snap +++ /dev/null @@ -1,31 +0,0 @@ -{ - "sarscov2 - [[meta] - bam] - bed": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.infer_experiment.txt:md5,f9d0bfc239df637cd8aeda40ade3c59a" - ] - ], - "1": [ - "versions.yml:md5,c0d7ecdb2e1fbf7a2ba0c28dae49e428" - ], - "txt": [ - [ - { - "id": "test" - }, - "test.infer_experiment.txt:md5,f9d0bfc239df637cd8aeda40ade3c59a" - ] - ], - "versions": [ - "versions.yml:md5,c0d7ecdb2e1fbf7a2ba0c28dae49e428" - ] - } - ], - "timestamp": "2023-11-23T16:21:55.713158354" - } -} \ No newline at end of file diff --git a/modules/nf-core/rseqc/inferexperiment/tests/nextflow.config b/modules/nf-core/rseqc/inferexperiment/tests/nextflow.config deleted file mode 100644 index 8730f1c4b..000000000 --- a/modules/nf-core/rseqc/inferexperiment/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - - publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } - -} diff --git a/modules/nf-core/rseqc/inferexperiment/tests/tags.yml b/modules/nf-core/rseqc/inferexperiment/tests/tags.yml deleted file mode 100644 index f9ba7e26a..000000000 --- a/modules/nf-core/rseqc/inferexperiment/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -rseqc/inferexperiment: - - modules/nf-core/rseqc/inferexperiment/** diff --git a/modules/nf-core/rseqc/innerdistance/environment.yml b/modules/nf-core/rseqc/innerdistance/environment.yml deleted file mode 100644 index bb61cce24..000000000 --- a/modules/nf-core/rseqc/innerdistance/environment.yml +++ /dev/null @@ -1,8 +0,0 @@ -name: rseqc_innerdistance -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::rseqc=3.0.1 - - conda-forge::r-base>=3.5 diff --git a/modules/nf-core/rseqc/innerdistance/main.nf b/modules/nf-core/rseqc/innerdistance/main.nf index a87399a98..a63a2bf03 100644 --- a/modules/nf-core/rseqc/innerdistance/main.nf +++ b/modules/nf-core/rseqc/innerdistance/main.nf @@ -2,7 +2,7 @@ process RSEQC_INNERDISTANCE { tag "$meta.id" label 'process_medium' - conda "${moduleDir}/environment.yml" + conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' : 'biocontainers/rseqc:3.0.1--py37h516909a_1' }" diff --git a/modules/nf-core/rseqc/innerdistance/meta.yml b/modules/nf-core/rseqc/innerdistance/meta.yml index d0a5bf181..d10a4c445 100644 --- a/modules/nf-core/rseqc/innerdistance/meta.yml +++ b/modules/nf-core/rseqc/innerdistance/meta.yml @@ -1,7 +1,6 @@ name: rseqc_innerdistance description: Calculate inner distance between read pairs. keywords: - - read_pairs - fragment_size - inner_distance tools: @@ -55,6 +54,3 @@ output: authors: - "@drpatelh" - "@kevinmenden" -maintainers: - - "@drpatelh" - - "@kevinmenden" diff --git a/modules/nf-core/rseqc/innerdistance/tests/main.nf.test b/modules/nf-core/rseqc/innerdistance/tests/main.nf.test deleted file mode 100644 index ee8901422..000000000 --- a/modules/nf-core/rseqc/innerdistance/tests/main.nf.test +++ /dev/null @@ -1,41 +0,0 @@ -nextflow_process { - - name "Test Process RSEQC_INNERDISTANCE" - script "../main.nf" - process "RSEQC_INNERDISTANCE" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "rseqc" - tag "rseqc/innerdistance" - - test("sarscov2 - [[meta] - bam] - bed") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) - ] - input[1] = file(params.test_data['sarscov2']['genome']['test_bed12'], checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.distance).match("pe_distance") }, - { assert snapshot(process.out.freq).match("freq") }, - { assert snapshot(process.out.mean).match("mean") }, - { assert snapshot(process.out.freq).match("rscript") }, - { assert snapshot(process.out.versions).match("pe_versions") }, - { assert snapshot(file(process.out.pdf[0][1]).name).match("pdf") } - ) - } - - } - -} diff --git a/modules/nf-core/rseqc/innerdistance/tests/main.nf.test.snap b/modules/nf-core/rseqc/innerdistance/tests/main.nf.test.snap deleted file mode 100644 index 9743d1bd6..000000000 --- a/modules/nf-core/rseqc/innerdistance/tests/main.nf.test.snap +++ /dev/null @@ -1,68 +0,0 @@ -{ - "pe_distance": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.inner_distance.txt:md5,a1acc9def0f64a5500d4c4cb47cbe32b" - ] - ] - ], - "timestamp": "2023-11-23T16:59:21.812491711" - }, - "rscript": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.inner_distance_freq.txt:md5,3fc037501f5899b5da009c8ce02fc25e" - ] - ] - ], - "timestamp": "2023-11-23T16:59:21.847527889" - }, - "pdf": { - "content": [ - "test.inner_distance_plot.pdf" - ], - "timestamp": "2023-11-23T17:23:20.046679629" - }, - "mean": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.inner_distance_mean.txt:md5,58398b7d5a29a5e564f9e3c50b55996c" - ] - ] - ], - "timestamp": "2023-11-23T16:59:21.839422659" - }, - "freq": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.inner_distance_freq.txt:md5,3fc037501f5899b5da009c8ce02fc25e" - ] - ] - ], - "timestamp": "2023-11-23T16:59:21.83183025" - }, - "pe_versions": { - "content": [ - [ - "versions.yml:md5,c2a05298a9c55bd61cc6e07396815a27" - ] - ], - "timestamp": "2023-11-23T16:59:21.854738078" - } -} \ No newline at end of file diff --git a/modules/nf-core/rseqc/innerdistance/tests/nextflow.config b/modules/nf-core/rseqc/innerdistance/tests/nextflow.config deleted file mode 100644 index 8730f1c4b..000000000 --- a/modules/nf-core/rseqc/innerdistance/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - - publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } - -} diff --git a/modules/nf-core/rseqc/innerdistance/tests/tags.yml b/modules/nf-core/rseqc/innerdistance/tests/tags.yml deleted file mode 100644 index 4a9d0acf9..000000000 --- a/modules/nf-core/rseqc/innerdistance/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -rseqc/innerdistance: - - modules/nf-core/rseqc/innerdistance/** diff --git a/modules/nf-core/rseqc/junctionannotation/environment.yml b/modules/nf-core/rseqc/junctionannotation/environment.yml deleted file mode 100644 index 105ea25ea..000000000 --- a/modules/nf-core/rseqc/junctionannotation/environment.yml +++ /dev/null @@ -1,8 +0,0 @@ -name: rseqc_junctionannotation -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::rseqc=3.0.1 - - conda-forge::r-base>=3.5 diff --git a/modules/nf-core/rseqc/junctionannotation/main.nf b/modules/nf-core/rseqc/junctionannotation/main.nf index 58574a278..4029ac765 100644 --- a/modules/nf-core/rseqc/junctionannotation/main.nf +++ b/modules/nf-core/rseqc/junctionannotation/main.nf @@ -2,7 +2,7 @@ process RSEQC_JUNCTIONANNOTATION { tag "$meta.id" label 'process_medium' - conda "${moduleDir}/environment.yml" + conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' : 'biocontainers/rseqc:3.0.1--py37h516909a_1' }" @@ -33,7 +33,7 @@ process RSEQC_JUNCTIONANNOTATION { -r $bed \\ -o $prefix \\ $args \\ - 2> >(tee ${prefix}.junction_annotation.log >&2) + 2> ${prefix}.junction_annotation.log cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/rseqc/junctionannotation/meta.yml b/modules/nf-core/rseqc/junctionannotation/meta.yml index a88aa2db3..48c43260e 100644 --- a/modules/nf-core/rseqc/junctionannotation/meta.yml +++ b/modules/nf-core/rseqc/junctionannotation/meta.yml @@ -63,6 +63,3 @@ output: authors: - "@drpatelh" - "@kevinmenden" -maintainers: - - "@drpatelh" - - "@kevinmenden" diff --git a/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test b/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test deleted file mode 100644 index ed2c27558..000000000 --- a/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test +++ /dev/null @@ -1,37 +0,0 @@ -nextflow_process { - - name "Test Process RSEQC_JUNCTIONANNOTATION" - script "../main.nf" - process "RSEQC_JUNCTIONANNOTATION" - tag "modules" - tag "modules_nfcore" - tag "rseqc" - tag "rseqc/junctionannotation" - - test("sarscov2 - paired end [bam]") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end: false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) - ] - input[1] = file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.log).match("log") }, - { assert snapshot(process.out.versions).match("versions") }, - { assert process.out.xls.get(0).get(1) ==~ ".*/test.junction.xls" }, - { assert process.out.rscript.get(0).get(1) ==~ ".*/test.junction_plot.r" } - ) - } - - } - -} diff --git a/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test.snap b/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test.snap deleted file mode 100644 index a9fc2cbb7..000000000 --- a/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test.snap +++ /dev/null @@ -1,24 +0,0 @@ -{ - "log": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.junction_annotation.log:md5,ef37d06d169a1adbeec23fddf82aee2b" - ] - ] - ], - "timestamp": "2023-11-23T21:11:28.772327081" - }, - "versions": { - "content": [ - [ - "versions.yml:md5,78807fd7b5d9df98730e6c66641b48a0" - ] - ], - "timestamp": "2023-11-23T21:11:28.7811548" - } -} \ No newline at end of file diff --git a/modules/nf-core/rseqc/junctionannotation/tests/tags.yml b/modules/nf-core/rseqc/junctionannotation/tests/tags.yml deleted file mode 100644 index 5f719fb8d..000000000 --- a/modules/nf-core/rseqc/junctionannotation/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -rseqc/junctionannotation: - - modules/nf-core/rseqc/junctionannotation/** diff --git a/modules/nf-core/rseqc/junctionsaturation/environment.yml b/modules/nf-core/rseqc/junctionsaturation/environment.yml deleted file mode 100644 index 78ffd06ad..000000000 --- a/modules/nf-core/rseqc/junctionsaturation/environment.yml +++ /dev/null @@ -1,8 +0,0 @@ -name: rseqc_junctionsaturation -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::rseqc=3.0.1 - - conda-forge::r-base>=3.5 diff --git a/modules/nf-core/rseqc/junctionsaturation/main.nf b/modules/nf-core/rseqc/junctionsaturation/main.nf index 552865bbf..93cc61b23 100644 --- a/modules/nf-core/rseqc/junctionsaturation/main.nf +++ b/modules/nf-core/rseqc/junctionsaturation/main.nf @@ -2,7 +2,7 @@ process RSEQC_JUNCTIONSATURATION { tag "$meta.id" label 'process_medium' - conda "${moduleDir}/environment.yml" + conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' : 'biocontainers/rseqc:3.0.1--py37h516909a_1' }" diff --git a/modules/nf-core/rseqc/junctionsaturation/meta.yml b/modules/nf-core/rseqc/junctionsaturation/meta.yml index 19ae3f52d..340fec0d0 100644 --- a/modules/nf-core/rseqc/junctionsaturation/meta.yml +++ b/modules/nf-core/rseqc/junctionsaturation/meta.yml @@ -43,6 +43,3 @@ output: authors: - "@drpatelh" - "@kevinmenden" -maintainers: - - "@drpatelh" - - "@kevinmenden" diff --git a/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test b/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test deleted file mode 100644 index 347b5fccd..000000000 --- a/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test +++ /dev/null @@ -1,36 +0,0 @@ -nextflow_process { - - name "Test Process RSEQC_JUNCTIONSATURATION" - script "../main.nf" - process "RSEQC_JUNCTIONSATURATION" - tag "modules" - tag "modules_nfcore" - tag "rseqc" - tag "rseqc/junctionsaturation" - - test("sarscov2 paired-end [bam]") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end: false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) - ] - input[1] = file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.rscript).match("rscript") }, - { assert snapshot(process.out.versions).match("versions") }, - { assert snapshot(file(process.out.pdf[0][1]).name).match("pdf") } - ) - } - - } - -} diff --git a/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test.snap b/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test.snap deleted file mode 100644 index 708782da6..000000000 --- a/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test.snap +++ /dev/null @@ -1,30 +0,0 @@ -{ - "rscript": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.junctionSaturation_plot.r:md5,caa6e63dcb477aabb169882b2f30dadd" - ] - ] - ], - "timestamp": "2023-11-24T00:15:43.655261555" - }, - "pdf": { - "content": [ - "test.junctionSaturation_plot.pdf" - ], - "timestamp": "2023-11-24T00:15:43.682673802" - }, - "versions": { - "content": [ - [ - "versions.yml:md5,2a187a15edb3a5ba114ab3d9f003a8bc" - ] - ], - "timestamp": "2023-11-24T00:15:43.667463564" - } -} \ No newline at end of file diff --git a/modules/nf-core/rseqc/junctionsaturation/tests/tags.yml b/modules/nf-core/rseqc/junctionsaturation/tests/tags.yml deleted file mode 100644 index 7022b59ad..000000000 --- a/modules/nf-core/rseqc/junctionsaturation/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -rseqc/junctionsaturation: - - modules/nf-core/rseqc/junctionsaturation/** diff --git a/modules/nf-core/rseqc/readdistribution/environment.yml b/modules/nf-core/rseqc/readdistribution/environment.yml deleted file mode 100644 index a20fef74e..000000000 --- a/modules/nf-core/rseqc/readdistribution/environment.yml +++ /dev/null @@ -1,8 +0,0 @@ -name: rseqc_readdistribution -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::rseqc=3.0.1 - - conda-forge::r-base>=3.5 diff --git a/modules/nf-core/rseqc/readdistribution/main.nf b/modules/nf-core/rseqc/readdistribution/main.nf index 901b364c0..f3e588d69 100644 --- a/modules/nf-core/rseqc/readdistribution/main.nf +++ b/modules/nf-core/rseqc/readdistribution/main.nf @@ -2,7 +2,7 @@ process RSEQC_READDISTRIBUTION { tag "$meta.id" label 'process_medium' - conda "${moduleDir}/environment.yml" + conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' : 'biocontainers/rseqc:3.0.1--py37h516909a_1' }" diff --git a/modules/nf-core/rseqc/readdistribution/meta.yml b/modules/nf-core/rseqc/readdistribution/meta.yml index 989792faa..94c647120 100644 --- a/modules/nf-core/rseqc/readdistribution/meta.yml +++ b/modules/nf-core/rseqc/readdistribution/meta.yml @@ -39,6 +39,3 @@ output: authors: - "@drpatelh" - "@kevinmenden" -maintainers: - - "@drpatelh" - - "@kevinmenden" diff --git a/modules/nf-core/rseqc/readdistribution/tests/main.nf.test b/modules/nf-core/rseqc/readdistribution/tests/main.nf.test deleted file mode 100644 index 4da721ab6..000000000 --- a/modules/nf-core/rseqc/readdistribution/tests/main.nf.test +++ /dev/null @@ -1,33 +0,0 @@ -nextflow_process { - - name "Test Process RSEQC_READDISTRIBUTION" - script "../main.nf" - process "RSEQC_READDISTRIBUTION" - tag "modules" - tag "modules_nfcore" - tag "rseqc" - tag "rseqc/readdistribution" - - test("sarscov2 paired-end [bam]") { - - when { - process { - """ - input[0] = [ [ id:'test', single_end: false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) - ] - input[1] = file(params.test_data['sarscov2']['genome']['test_bed12'], checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/rseqc/readdistribution/tests/main.nf.test.snap b/modules/nf-core/rseqc/readdistribution/tests/main.nf.test.snap deleted file mode 100644 index 90cf8b029..000000000 --- a/modules/nf-core/rseqc/readdistribution/tests/main.nf.test.snap +++ /dev/null @@ -1,33 +0,0 @@ -{ - "sarscov2 paired-end [bam]": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.read_distribution.txt:md5,56893fdc0809d968629a363551a1655f" - ] - ], - "1": [ - "versions.yml:md5,15fd23aafd4d3aeabc4fede518d1b3a4" - ], - "txt": [ - [ - { - "id": "test", - "single_end": false - }, - "test.read_distribution.txt:md5,56893fdc0809d968629a363551a1655f" - ] - ], - "versions": [ - "versions.yml:md5,15fd23aafd4d3aeabc4fede518d1b3a4" - ] - } - ], - "timestamp": "2023-11-24T00:35:28.404023432" - } -} \ No newline at end of file diff --git a/modules/nf-core/rseqc/readdistribution/tests/tags.yml b/modules/nf-core/rseqc/readdistribution/tests/tags.yml deleted file mode 100644 index c0c477b6d..000000000 --- a/modules/nf-core/rseqc/readdistribution/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -rseqc/readdistribution: - - modules/nf-core/rseqc/readdistribution/** diff --git a/modules/nf-core/rseqc/readduplication/environment.yml b/modules/nf-core/rseqc/readduplication/environment.yml deleted file mode 100644 index bba52d8fa..000000000 --- a/modules/nf-core/rseqc/readduplication/environment.yml +++ /dev/null @@ -1,8 +0,0 @@ -name: rseqc_readduplication -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::rseqc=3.0.1 - - conda-forge::r-base>=3.5 diff --git a/modules/nf-core/rseqc/readduplication/main.nf b/modules/nf-core/rseqc/readduplication/main.nf index 68c1296ea..023118536 100644 --- a/modules/nf-core/rseqc/readduplication/main.nf +++ b/modules/nf-core/rseqc/readduplication/main.nf @@ -2,7 +2,7 @@ process RSEQC_READDUPLICATION { tag "$meta.id" label 'process_medium' - conda "${moduleDir}/environment.yml" + conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' : 'biocontainers/rseqc:3.0.1--py37h516909a_1' }" diff --git a/modules/nf-core/rseqc/readduplication/meta.yml b/modules/nf-core/rseqc/readduplication/meta.yml index 4b24d3032..5a8666435 100644 --- a/modules/nf-core/rseqc/readduplication/meta.yml +++ b/modules/nf-core/rseqc/readduplication/meta.yml @@ -3,8 +3,6 @@ description: Calculate read duplication rate keywords: - rnaseq - duplication - - sequence-based - - mapping-based tools: - rseqc: description: | @@ -52,6 +50,3 @@ output: authors: - "@drpatelh" - "@kevinmenden" -maintainers: - - "@drpatelh" - - "@kevinmenden" diff --git a/modules/nf-core/rseqc/readduplication/tests/main.nf.test b/modules/nf-core/rseqc/readduplication/tests/main.nf.test deleted file mode 100644 index 93d0cccd6..000000000 --- a/modules/nf-core/rseqc/readduplication/tests/main.nf.test +++ /dev/null @@ -1,36 +0,0 @@ -nextflow_process { - - name "Test Process RSEQC_READDUPLICATION" - script "../main.nf" - process "RSEQC_READDUPLICATION" - tag "modules" - tag "modules_nfcore" - tag "rseqc" - tag "rseqc/readduplication" - - test("sarscov2 paired-end [bam]") { - - when { - process { - """ - input[0] = [ [ id:'test', single_end: false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.seq_xls).match("seq_xls") }, - { assert snapshot(process.out.pos_xls).match("pos_xls") }, - { assert snapshot(process.out.rscript).match("rscript") }, - { assert snapshot(process.out.versions).match("versions") }, - { assert snapshot(file(process.out.pdf[0][1]).name).match("pdf") } - ) - } - - } - -} diff --git a/modules/nf-core/rseqc/readduplication/tests/main.nf.test.snap b/modules/nf-core/rseqc/readduplication/tests/main.nf.test.snap deleted file mode 100644 index e3e4ec3fd..000000000 --- a/modules/nf-core/rseqc/readduplication/tests/main.nf.test.snap +++ /dev/null @@ -1,58 +0,0 @@ -{ - "pos_xls": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.pos.DupRate.xls:md5,a859bc2031d46bf1cc4336205847caa3" - ] - ] - ], - "timestamp": "2023-11-24T00:52:45.27809706" - }, - "rscript": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.DupRate_plot.r:md5,3c0325095cee4835b921e57d61c23dca" - ] - ] - ], - "timestamp": "2023-11-24T00:52:45.285457599" - }, - "pdf": { - "content": [ - "test.DupRate_plot.pdf" - ], - "timestamp": "2023-11-24T00:52:45.304152477" - }, - "seq_xls": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.seq.DupRate.xls:md5,ee8783399eec5a18522a6f08bece338b" - ] - ] - ], - "timestamp": "2023-11-24T00:52:45.262656562" - }, - "versions": { - "content": [ - [ - "versions.yml:md5,06a70ece474de57fc1dc7585e7cfd5a0" - ] - ], - "timestamp": "2023-11-24T00:52:45.292599738" - } -} \ No newline at end of file diff --git a/modules/nf-core/rseqc/readduplication/tests/tags.yml b/modules/nf-core/rseqc/readduplication/tests/tags.yml deleted file mode 100644 index fce3d35d4..000000000 --- a/modules/nf-core/rseqc/readduplication/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -rseqc/readduplication: - - modules/nf-core/rseqc/readduplication/** diff --git a/modules/nf-core/rseqc/tin/environment.yml b/modules/nf-core/rseqc/tin/environment.yml deleted file mode 100644 index 48b7efa53..000000000 --- a/modules/nf-core/rseqc/tin/environment.yml +++ /dev/null @@ -1,8 +0,0 @@ -name: rseqc_tin -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::rseqc=3.0.1 - - conda-forge::r-base>=3.5 diff --git a/modules/nf-core/rseqc/tin/main.nf b/modules/nf-core/rseqc/tin/main.nf index 718aabb89..872938b62 100644 --- a/modules/nf-core/rseqc/tin/main.nf +++ b/modules/nf-core/rseqc/tin/main.nf @@ -2,7 +2,7 @@ process RSEQC_TIN { tag "$meta.id" label 'process_high' - conda "${moduleDir}/environment.yml" + conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' : 'biocontainers/rseqc:3.0.1--py37h516909a_1' }" diff --git a/modules/nf-core/rseqc/tin/meta.yml b/modules/nf-core/rseqc/tin/meta.yml index f760bb2f4..381edfde0 100644 --- a/modules/nf-core/rseqc/tin/meta.yml +++ b/modules/nf-core/rseqc/tin/meta.yml @@ -46,5 +46,3 @@ output: pattern: "versions.yml" authors: - "@drpatelh" -maintainers: - - "@drpatelh" diff --git a/modules/nf-core/rseqc/tin/tests/main.nf.test b/modules/nf-core/rseqc/tin/tests/main.nf.test deleted file mode 100644 index c339d343a..000000000 --- a/modules/nf-core/rseqc/tin/tests/main.nf.test +++ /dev/null @@ -1,35 +0,0 @@ -nextflow_process { - - name "Test Process RSEQC_TIN" - script "../main.nf" - process "RSEQC_TIN" - tag "modules" - tag "modules_nfcore" - tag "rseqc" - tag "rseqc/tin" - - test("sarscov2 paired-end [bam]") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) - ] - input[1] = file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/rseqc/tin/tests/main.nf.test.snap b/modules/nf-core/rseqc/tin/tests/main.nf.test.snap deleted file mode 100644 index 4bed8ac9b..000000000 --- a/modules/nf-core/rseqc/tin/tests/main.nf.test.snap +++ /dev/null @@ -1,47 +0,0 @@ -{ - "sarscov2 paired-end [bam]": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.paired_end.sorted.summary.txt:md5,9d98447e178b89a89f6f5aba7a772fe6" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.paired_end.sorted.tin.xls:md5,6b1b1b0dc1dc265342ba8c3f27fa60e6" - ] - ], - "2": [ - "versions.yml:md5,77a0664abb6e486d1a0dd2078d4916d2" - ], - "txt": [ - [ - { - "id": "test" - }, - "test.paired_end.sorted.summary.txt:md5,9d98447e178b89a89f6f5aba7a772fe6" - ] - ], - "versions": [ - "versions.yml:md5,77a0664abb6e486d1a0dd2078d4916d2" - ], - "xls": [ - [ - { - "id": "test" - }, - "test.paired_end.sorted.tin.xls:md5,6b1b1b0dc1dc265342ba8c3f27fa60e6" - ] - ] - } - ], - "timestamp": "2023-11-24T02:30:03.446989864" - } -} \ No newline at end of file diff --git a/modules/nf-core/rseqc/tin/tests/tags.yml b/modules/nf-core/rseqc/tin/tests/tags.yml deleted file mode 100644 index 741bbd0c0..000000000 --- a/modules/nf-core/rseqc/tin/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -rseqc/tin: - - modules/nf-core/rseqc/tin/** diff --git a/modules/nf-core/samtools/flagstat/environment.yml b/modules/nf-core/samtools/flagstat/environment.yml deleted file mode 100644 index 5efae053f..000000000 --- a/modules/nf-core/samtools/flagstat/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: samtools_flagstat -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/flagstat/main.nf b/modules/nf-core/samtools/flagstat/main.nf index f1893d7cc..b75707eca 100644 --- a/modules/nf-core/samtools/flagstat/main.nf +++ b/modules/nf-core/samtools/flagstat/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_FLAGSTAT { tag "$meta.id" label 'process_single' - conda "${moduleDir}/environment.yml" + conda "bioconda::samtools=1.17" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : - 'biocontainers/samtools:1.18--h50ea8bc_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : + 'biocontainers/samtools:1.17--h00cdaf9_0' }" input: tuple val(meta), path(bam), path(bai) diff --git a/modules/nf-core/samtools/flagstat/meta.yml b/modules/nf-core/samtools/flagstat/meta.yml index 97991358e..954225dfc 100644 --- a/modules/nf-core/samtools/flagstat/meta.yml +++ b/modules/nf-core/samtools/flagstat/meta.yml @@ -47,5 +47,3 @@ output: pattern: "versions.yml" authors: - "@drpatelh" -maintainers: - - "@drpatelh" diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test b/modules/nf-core/samtools/flagstat/tests/main.nf.test deleted file mode 100644 index c8dd8dc9f..000000000 --- a/modules/nf-core/samtools/flagstat/tests/main.nf.test +++ /dev/null @@ -1,36 +0,0 @@ -nextflow_process { - - name "Test Process SAMTOOLS_FLAGSTAT" - script "../main.nf" - process "SAMTOOLS_FLAGSTAT" - tag "modules" - tag "modules_nfcore" - tag "samtools" - tag "samtools/flagstat" - - test("BAM") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out.flagstat).match() }, - { assert path(process.out.versions.get(0)).getText().contains("samtools") } - ) - } - } -} diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap deleted file mode 100644 index 880019f2f..000000000 --- a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap +++ /dev/null @@ -1,16 +0,0 @@ -{ - "BAM": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" - ] - ] - ], - "timestamp": "2023-11-14T15:49:22.577133" - } -} \ No newline at end of file diff --git a/modules/nf-core/samtools/flagstat/tests/tags.yml b/modules/nf-core/samtools/flagstat/tests/tags.yml deleted file mode 100644 index 2d2b7255e..000000000 --- a/modules/nf-core/samtools/flagstat/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/flagstat: - - modules/nf-core/samtools/flagstat/** diff --git a/modules/nf-core/samtools/idxstats/environment.yml b/modules/nf-core/samtools/idxstats/environment.yml deleted file mode 100644 index 2401db0f1..000000000 --- a/modules/nf-core/samtools/idxstats/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: samtools_idxstats -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/idxstats/main.nf b/modules/nf-core/samtools/idxstats/main.nf index 00d916bbf..83c7c34b9 100644 --- a/modules/nf-core/samtools/idxstats/main.nf +++ b/modules/nf-core/samtools/idxstats/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_IDXSTATS { tag "$meta.id" label 'process_single' - conda "${moduleDir}/environment.yml" + conda "bioconda::samtools=1.17" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : - 'biocontainers/samtools:1.18--h50ea8bc_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : + 'biocontainers/samtools:1.17--h00cdaf9_0' }" input: tuple val(meta), path(bam), path(bai) diff --git a/modules/nf-core/samtools/idxstats/meta.yml b/modules/nf-core/samtools/idxstats/meta.yml index 344e92a3f..dda87e1ee 100644 --- a/modules/nf-core/samtools/idxstats/meta.yml +++ b/modules/nf-core/samtools/idxstats/meta.yml @@ -48,5 +48,3 @@ output: pattern: "versions.yml" authors: - "@drpatelh" -maintainers: - - "@drpatelh" diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test b/modules/nf-core/samtools/idxstats/tests/main.nf.test deleted file mode 100644 index f6c92150c..000000000 --- a/modules/nf-core/samtools/idxstats/tests/main.nf.test +++ /dev/null @@ -1,36 +0,0 @@ -nextflow_process { - - name "Test Process SAMTOOLS_IDXSTATS" - script "../main.nf" - process "SAMTOOLS_IDXSTATS" - tag "modules" - tag "modules_nfcore" - tag "samtools" - tag "samtools/idxstats" - - test("BAM") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out.idxstats).match() }, - { assert path(process.out.versions.get(0)).getText().contains("samtools") } - ) - } - } -} diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap deleted file mode 100644 index 4c6c12bd5..000000000 --- a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap +++ /dev/null @@ -1,16 +0,0 @@ -{ - "BAM": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" - ] - ] - ], - "timestamp": "2023-11-14T15:52:19.875194" - } -} \ No newline at end of file diff --git a/modules/nf-core/samtools/idxstats/tests/tags.yml b/modules/nf-core/samtools/idxstats/tests/tags.yml deleted file mode 100644 index d3057c61f..000000000 --- a/modules/nf-core/samtools/idxstats/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/idxstats: - - modules/nf-core/samtools/idxstats/** diff --git a/modules/nf-core/samtools/index/environment.yml b/modules/nf-core/samtools/index/environment.yml deleted file mode 100644 index 296ed99e5..000000000 --- a/modules/nf-core/samtools/index/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: samtools_index -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf index 8ad18fdc2..0b20aa4bb 100644 --- a/modules/nf-core/samtools/index/main.nf +++ b/modules/nf-core/samtools/index/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_INDEX { tag "$meta.id" label 'process_low' - conda "${moduleDir}/environment.yml" + conda "bioconda::samtools=1.17" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : - 'biocontainers/samtools:1.18--h50ea8bc_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : + 'biocontainers/samtools:1.17--h00cdaf9_0' }" input: tuple val(meta), path(input) diff --git a/modules/nf-core/samtools/index/meta.yml b/modules/nf-core/samtools/index/meta.yml index 01a4ee03e..8bd2fa6fb 100644 --- a/modules/nf-core/samtools/index/meta.yml +++ b/modules/nf-core/samtools/index/meta.yml @@ -51,7 +51,3 @@ authors: - "@drpatelh" - "@ewels" - "@maxulysse" -maintainers: - - "@drpatelh" - - "@ewels" - - "@maxulysse" diff --git a/modules/nf-core/samtools/index/tests/csi.nextflow.config b/modules/nf-core/samtools/index/tests/csi.nextflow.config deleted file mode 100644 index 0ed260efa..000000000 --- a/modules/nf-core/samtools/index/tests/csi.nextflow.config +++ /dev/null @@ -1,7 +0,0 @@ -process { - - withName: SAMTOOLS_INDEX { - ext.args = '-c' - } - -} diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test deleted file mode 100644 index c76a9169f..000000000 --- a/modules/nf-core/samtools/index/tests/main.nf.test +++ /dev/null @@ -1,87 +0,0 @@ -nextflow_process { - - name "Test Process SAMTOOLS_INDEX" - script "../main.nf" - process "SAMTOOLS_INDEX" - tag "modules" - tag "modules_nfcore" - tag "samtools" - tag "samtools/index" - - test("sarscov2 [BAI]") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out.bai).match("bai") }, - { assert path(process.out.versions.get(0)).getText().contains("samtools") } - ) - } - } - - test("homo_sapiens [CRAI]") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out.crai).match("crai") }, - { assert path(process.out.versions.get(0)).getText().contains("samtools") } - ) - } - } - - test("homo_sapiens [CSI]") { - - config "./csi.nextflow.config" - - when { - params { - outdir = "$outputDir" - } - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert path(process.out.csi.get(0).get(1)).exists() }, - { assert path(process.out.versions.get(0)).getText().contains("samtools") } - ) - } - } -} diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap deleted file mode 100644 index b3baee7fb..000000000 --- a/modules/nf-core/samtools/index/tests/main.nf.test.snap +++ /dev/null @@ -1,28 +0,0 @@ -{ - "crai": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" - ] - ] - ], - "timestamp": "2023-11-15T15:17:37.30801" - }, - "bai": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" - ] - ] - ], - "timestamp": "2023-11-15T15:17:30.869234" - } -} \ No newline at end of file diff --git a/modules/nf-core/samtools/index/tests/tags.yml b/modules/nf-core/samtools/index/tests/tags.yml deleted file mode 100644 index e0f58a7a3..000000000 --- a/modules/nf-core/samtools/index/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/index: - - modules/nf-core/samtools/index/** diff --git a/modules/nf-core/samtools/sort/environment.yml b/modules/nf-core/samtools/sort/environment.yml deleted file mode 100644 index cd50868c5..000000000 --- a/modules/nf-core/samtools/sort/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: samtools_sort -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf index 4a666d42e..2b7753fd8 100644 --- a/modules/nf-core/samtools/sort/main.nf +++ b/modules/nf-core/samtools/sort/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_SORT { tag "$meta.id" label 'process_medium' - conda "${moduleDir}/environment.yml" + conda "bioconda::samtools=1.17" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : - 'biocontainers/samtools:1.18--h50ea8bc_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : + 'biocontainers/samtools:1.17--h00cdaf9_0' }" input: tuple val(meta), path(bam) diff --git a/modules/nf-core/samtools/sort/meta.yml b/modules/nf-core/samtools/sort/meta.yml index 2200de72f..073284316 100644 --- a/modules/nf-core/samtools/sort/meta.yml +++ b/modules/nf-core/samtools/sort/meta.yml @@ -46,6 +46,3 @@ output: authors: - "@drpatelh" - "@ewels" -maintainers: - - "@drpatelh" - - "@ewels" diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test deleted file mode 100644 index abb80978e..000000000 --- a/modules/nf-core/samtools/sort/tests/main.nf.test +++ /dev/null @@ -1,73 +0,0 @@ -nextflow_process { - - name "Test Process SAMTOOLS_SORT" - script "../main.nf" - process "SAMTOOLS_SORT" - tag "modules" - tag "modules_nfcore" - tag "samtools" - tag "samtools/sort" - - test("test_samtools_sort") { - - config "./nextflow.config" - - when { - params { - outdir = "$outputDir" - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - [ - file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("test_samtools_sort_stub") { - - config "./nextflow.config" - options "-stub-run" - - when { - params { - outdir = "$outputDir" - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - [ - file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot( - file(process.out.bam[0][1]).name, - process.out.versions - ).match() } - ) - } - - } - -} diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap deleted file mode 100644 index ff7222597..000000000 --- a/modules/nf-core/samtools/sort/tests/main.nf.test.snap +++ /dev/null @@ -1,48 +0,0 @@ -{ - "test_samtools_sort": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.sorted.bam:md5,ea6a0fef94eb534e901f107a05a33a06" - ] - ], - "1": [ - - ], - "2": [ - "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80" - ], - "bam": [ - [ - { - "id": "test", - "single_end": false - }, - "test.sorted.bam:md5,ea6a0fef94eb534e901f107a05a33a06" - ] - ], - "csi": [ - - ], - "versions": [ - "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80" - ] - } - ], - "timestamp": "2023-12-04T11:11:22.005628301" - }, - "test_samtools_sort_stub": { - "content": [ - "test.sorted.bam", - [ - "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80" - ] - ], - "timestamp": "2023-12-04T17:47:22.314445935" - } -} \ No newline at end of file diff --git a/modules/nf-core/samtools/sort/tests/nextflow.config b/modules/nf-core/samtools/sort/tests/nextflow.config deleted file mode 100644 index d0f350868..000000000 --- a/modules/nf-core/samtools/sort/tests/nextflow.config +++ /dev/null @@ -1,7 +0,0 @@ -process { - - withName: SAMTOOLS_SORT { - ext.prefix = { "${meta.id}.sorted" } - } - -} diff --git a/modules/nf-core/samtools/sort/tests/tags.yml b/modules/nf-core/samtools/sort/tests/tags.yml deleted file mode 100644 index cd63ea208..000000000 --- a/modules/nf-core/samtools/sort/tests/tags.yml +++ /dev/null @@ -1,3 +0,0 @@ -samtools/sort: - - modules/nf-core/samtools/sort/** - - tests/modules/nf-core/samtools/sort/** diff --git a/modules/nf-core/samtools/stats/environment.yml b/modules/nf-core/samtools/stats/environment.yml deleted file mode 100644 index b89ce6475..000000000 --- a/modules/nf-core/samtools/stats/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: samtools_stats -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/stats/main.nf b/modules/nf-core/samtools/stats/main.nf index 7539140ab..4a2607ded 100644 --- a/modules/nf-core/samtools/stats/main.nf +++ b/modules/nf-core/samtools/stats/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_STATS { tag "$meta.id" label 'process_single' - conda "${moduleDir}/environment.yml" + conda "bioconda::samtools=1.17" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : - 'biocontainers/samtools:1.18--h50ea8bc_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : + 'biocontainers/samtools:1.17--h00cdaf9_0' }" input: tuple val(meta), path(input), path(input_index) diff --git a/modules/nf-core/samtools/stats/meta.yml b/modules/nf-core/samtools/stats/meta.yml index 735ff8122..90e6345f5 100644 --- a/modules/nf-core/samtools/stats/meta.yml +++ b/modules/nf-core/samtools/stats/meta.yml @@ -57,7 +57,3 @@ authors: - "@drpatelh" - "@FriederikeHanssen" - "@ramprasadn" -maintainers: - - "@drpatelh" - - "@FriederikeHanssen" - - "@ramprasadn" diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test b/modules/nf-core/samtools/stats/tests/main.nf.test deleted file mode 100644 index 20c3efe12..000000000 --- a/modules/nf-core/samtools/stats/tests/main.nf.test +++ /dev/null @@ -1,78 +0,0 @@ -nextflow_process { - - name "Test Process SAMTOOLS_STATS" - script "../main.nf" - process "SAMTOOLS_STATS" - tag "modules" - tag "modules_nfcore" - tag "samtools" - tag "samtools/stats" - - test("SAMTOOLS STATS Should run without failures") { - - when { - params { - - outdir = "$outputDir" - } - process { - """ - // define inputs of the process here. - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) - - ] - input[1] = [[],[]] - """ - - } - } - - then { - assertAll( - {assert process.success}, - {assert snapshot(process.out).match()} - ) - } - - } - - test("SAMTOOLS CRAM Should run without failures") { - - when { - params { - - outdir = "$outputDir" - } - process { - """ - // define inputs of the process here - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram'], checkIfExists: true), - file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram_crai'], checkIfExists: true) - - ] - input[1] = [ - [ id:'genome' ], - file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) - ] - """ - } - - - } - - then { - assertAll( - {assert process.success}, - {assert snapshot(process.out).match()} - ) - } - - } - - -} diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test.snap b/modules/nf-core/samtools/stats/tests/main.nf.test.snap deleted file mode 100644 index 025c83a55..000000000 --- a/modules/nf-core/samtools/stats/tests/main.nf.test.snap +++ /dev/null @@ -1,64 +0,0 @@ -{ - "SAMTOOLS STATS Should run without failures": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.stats:md5,045a48208b1c6f5b8af4347fe31f4def" - ] - ], - "1": [ - "versions.yml:md5,650a365c6635001436008350ae83337c" - ], - "stats": [ - [ - { - "id": "test", - "single_end": false - }, - "test.stats:md5,045a48208b1c6f5b8af4347fe31f4def" - ] - ], - "versions": [ - "versions.yml:md5,650a365c6635001436008350ae83337c" - ] - } - ], - "timestamp": "2023-12-04T11:07:28.26821485" - }, - "SAMTOOLS CRAM Should run without failures": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.stats:md5,dfbfa130d4a6925ddd1931dcd8354a43" - ] - ], - "1": [ - "versions.yml:md5,650a365c6635001436008350ae83337c" - ], - "stats": [ - [ - { - "id": "test", - "single_end": false - }, - "test.stats:md5,dfbfa130d4a6925ddd1931dcd8354a43" - ] - ], - "versions": [ - "versions.yml:md5,650a365c6635001436008350ae83337c" - ] - } - ], - "timestamp": "2023-12-04T11:07:50.356233402" - } -} \ No newline at end of file diff --git a/modules/nf-core/samtools/stats/tests/tags.yml b/modules/nf-core/samtools/stats/tests/tags.yml deleted file mode 100644 index 7c28e30f3..000000000 --- a/modules/nf-core/samtools/stats/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/stats: - - modules/nf-core/samtools/stats/** diff --git a/modules/nf-core/trimgalore/environment.yml b/modules/nf-core/trimgalore/environment.yml deleted file mode 100644 index 6cd0f51b3..000000000 --- a/modules/nf-core/trimgalore/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: trimgalore -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::trim-galore=0.6.7 diff --git a/modules/nf-core/trimgalore/main.nf b/modules/nf-core/trimgalore/main.nf index 24ead8714..dcb77ae7b 100644 --- a/modules/nf-core/trimgalore/main.nf +++ b/modules/nf-core/trimgalore/main.nf @@ -2,7 +2,7 @@ process TRIMGALORE { tag "$meta.id" label 'process_high' - conda "${moduleDir}/environment.yml" + conda "bioconda::trim-galore=0.6.7" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/trim-galore:0.6.7--hdfd78af_0' : 'biocontainers/trim-galore:0.6.7--hdfd78af_0' }" diff --git a/modules/nf-core/trimgalore/meta.yml b/modules/nf-core/trimgalore/meta.yml index e649088ce..f84c4d771 100644 --- a/modules/nf-core/trimgalore/meta.yml +++ b/modules/nf-core/trimgalore/meta.yml @@ -62,7 +62,3 @@ authors: - "@drpatelh" - "@ewels" - "@FelixKrueger" -maintainers: - - "@drpatelh" - - "@ewels" - - "@FelixKrueger" diff --git a/modules/nf-core/trimgalore/tests/main.nf.test b/modules/nf-core/trimgalore/tests/main.nf.test deleted file mode 100644 index bc6812ccd..000000000 --- a/modules/nf-core/trimgalore/tests/main.nf.test +++ /dev/null @@ -1,105 +0,0 @@ -nextflow_process { - - name "Test Process TRIMGALORE" - script "../main.nf" - process "TRIMGALORE" - tag "modules" - tag "modules_nfcore" - tag "trimgalore" - - test("test_trimgalore_single_end") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - input[0] = [ [ id:'test', single_end:true ], // meta map - [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] - ] - """ - } - } - - then { - def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } - } - }, - { report1_lines.each { report1_line -> - { assert path(process.out.log.get(0).get(1)).getText().contains(report1_line) } - } - } - ) - } - } - - test("test_trimgalore_paired_end") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - input[0] = [ [ id:'test', single_end:false ], // meta map - [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] - ] - """ - } - } - - then { - def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { report1_lines.each { report1_line -> - { assert path(process.out.log.get(0).get(1).get(0)).getText().contains(report1_line) } - } - }, - { report2_lines.each { report2_line -> - { assert path(process.out.log.get(0).get(1).get(1)).getText().contains(report2_line) } - } - } - ) - } - } -} diff --git a/modules/nf-core/trimgalore/tests/main.nf.test.snap b/modules/nf-core/trimgalore/tests/main.nf.test.snap deleted file mode 100644 index 84feacca2..000000000 --- a/modules/nf-core/trimgalore/tests/main.nf.test.snap +++ /dev/null @@ -1,148 +0,0 @@ -{ - "test_trimgalore_single_end": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test_trimmed.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastq.gz_trimming_report.txt:md5,a1ab3958205f1ddf48af623242b5b429" - ] - ], - "2": [ - - ], - "3": [ - - ], - "4": [ - - ], - "5": [ - "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" - ], - "html": [ - - ], - "log": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastq.gz_trimming_report.txt:md5,a1ab3958205f1ddf48af623242b5b429" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test_trimmed.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4" - ] - ], - "unpaired": [ - - ], - "versions": [ - "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" - ], - "zip": [ - - ] - } - ], - "timestamp": "2023-10-17T15:24:57.782141441" - }, - "test_trimgalore_paired_end": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1_val_1.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4", - "test_2_val_2.fq.gz:md5,f3d61189e6d10202da7b8686f1dbb71b" - ] - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastq.gz_trimming_report.txt:md5,315d40465412f9909bbaabf52269274d", - "test_2.fastq.gz_trimming_report.txt:md5,34436303da1c78811103427a2fb57f7b" - ] - ] - ], - "2": [ - - ], - "3": [ - - ], - "4": [ - - ], - "5": [ - "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" - ], - "html": [ - - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastq.gz_trimming_report.txt:md5,315d40465412f9909bbaabf52269274d", - "test_2.fastq.gz_trimming_report.txt:md5,34436303da1c78811103427a2fb57f7b" - ] - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1_val_1.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4", - "test_2_val_2.fq.gz:md5,f3d61189e6d10202da7b8686f1dbb71b" - ] - ] - ], - "unpaired": [ - - ], - "versions": [ - "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" - ], - "zip": [ - - ] - } - ], - "timestamp": "2023-10-17T15:25:08.513589909" - } -} \ No newline at end of file diff --git a/modules/nf-core/trimgalore/tests/tags.yml b/modules/nf-core/trimgalore/tests/tags.yml deleted file mode 100644 index e9937691a..000000000 --- a/modules/nf-core/trimgalore/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -trimgalore: - - modules/nf-core/trimgalore/** diff --git a/modules/nf-core/umitools/dedup/environment.yml b/modules/nf-core/umitools/dedup/environment.yml deleted file mode 100644 index f443735f4..000000000 --- a/modules/nf-core/umitools/dedup/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: umitools_dedup -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::umi_tools=1.1.4 diff --git a/modules/nf-core/umitools/dedup/main.nf b/modules/nf-core/umitools/dedup/main.nf index 64ab8f98e..56ea04691 100644 --- a/modules/nf-core/umitools/dedup/main.nf +++ b/modules/nf-core/umitools/dedup/main.nf @@ -2,7 +2,7 @@ process UMITOOLS_DEDUP { tag "$meta.id" label "process_medium" - conda "${moduleDir}/environment.yml" + conda "bioconda::umi_tools=1.1.4" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/umi_tools:1.1.4--py38hbff2b2d_1' : 'biocontainers/umi_tools:1.1.4--py38hbff2b2d_1' }" @@ -42,7 +42,7 @@ process UMITOOLS_DEDUP { cat <<-END_VERSIONS > versions.yml "${task.process}": - umitools: \$( umi_tools --version | sed '/version:/!d; s/.*: //' ) + umitools: \$(umi_tools --version 2>&1 | sed 's/^.*UMI-tools version://; s/ *\$//') END_VERSIONS """ @@ -56,7 +56,7 @@ process UMITOOLS_DEDUP { cat <<-END_VERSIONS > versions.yml "${task.process}": - umitools: \$( umi_tools --version | sed '/version:/!d; s/.*: //' ) + umitools: \$(umi_tools --version 2>&1 | sed 's/^.*UMI-tools version://; s/ *\$//') END_VERSIONS """ } diff --git a/modules/nf-core/umitools/dedup/meta.yml b/modules/nf-core/umitools/dedup/meta.yml index 38d3fd465..534d4c6b0 100644 --- a/modules/nf-core/umitools/dedup/meta.yml +++ b/modules/nf-core/umitools/dedup/meta.yml @@ -7,8 +7,8 @@ keywords: tools: - umi_tools: description: > - UMI-tools contains tools for dealing with Unique Molecular Identifiers (UMIs)/Random Molecular Tags (RMTs) and single cell RNA-Seq cell barcodes - + UMI-tools contains tools for dealing with Unique Molecular Identifiers (UMIs)/Random Molecular Tags (RMTs) + and single cell RNA-Seq cell barcodes documentation: https://umi-tools.readthedocs.io/en/latest/ license: ["MIT"] input: @@ -61,11 +61,8 @@ output: type: file description: File containing software versions pattern: "versions.yml" + authors: - "@drpatelh" - "@grst" - "@klkeys" -maintainers: - - "@drpatelh" - - "@grst" - - "@klkeys" diff --git a/modules/nf-core/umitools/extract/environment.yml b/modules/nf-core/umitools/extract/environment.yml deleted file mode 100644 index 7d08ac0ec..000000000 --- a/modules/nf-core/umitools/extract/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: umitools_extract -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::umi_tools=1.1.4 diff --git a/modules/nf-core/umitools/extract/main.nf b/modules/nf-core/umitools/extract/main.nf index 4bd79e79f..2f94fa93e 100644 --- a/modules/nf-core/umitools/extract/main.nf +++ b/modules/nf-core/umitools/extract/main.nf @@ -3,7 +3,7 @@ process UMITOOLS_EXTRACT { label "process_single" label "process_long" - conda "${moduleDir}/environment.yml" + conda "bioconda::umi_tools=1.1.4" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/umi_tools:1.1.4--py38hbff2b2d_1' : 'biocontainers/umi_tools:1.1.4--py38hbff2b2d_1' }" @@ -33,7 +33,7 @@ process UMITOOLS_EXTRACT { cat <<-END_VERSIONS > versions.yml "${task.process}": - umitools: \$( umi_tools --version | sed '/version:/!d; s/.*: //' ) + umitools: \$(umi_tools --version 2>&1 | sed 's/^.*UMI-tools version://; s/ *\$//') END_VERSIONS """ } else { @@ -49,7 +49,7 @@ process UMITOOLS_EXTRACT { cat <<-END_VERSIONS > versions.yml "${task.process}": - umitools: \$( umi_tools --version | sed '/version:/!d; s/.*: //' ) + umitools: \$(umi_tools --version 2>&1 | sed 's/^.*UMI-tools version://; s/ *\$//') END_VERSIONS """ } diff --git a/modules/nf-core/umitools/extract/meta.yml b/modules/nf-core/umitools/extract/meta.yml index 7695b2717..db64a0f88 100644 --- a/modules/nf-core/umitools/extract/meta.yml +++ b/modules/nf-core/umitools/extract/meta.yml @@ -1,16 +1,15 @@ name: umitools_extract description: Extracts UMI barcode from a read and add it to the read name, leaving any sample barcode in place keywords: - - UMI - - barcode - - extract - umitools + - extract tools: - umi_tools: description: > - UMI-tools contains tools for dealing with Unique Molecular Identifiers (UMIs)/Random Molecular Tags (RMTs) and single cell RNA-Seq cell barcodes + UMI-tools contains tools for dealing with Unique Molecular Identifiers (UMIs)/Random Molecular Tags (RMTs) + and single cell RNA-Seq cell barcodes documentation: https://umi-tools.readthedocs.io/en/latest/ - license: "MIT" + license: ["MIT"] input: - meta: type: map @@ -30,7 +29,9 @@ output: - reads: type: file description: > - Extracted FASTQ files. | For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. | For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz. + Extracted FASTQ files. | + For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. | + For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz. pattern: "*.{fastq.gz}" - log: type: file @@ -40,9 +41,7 @@ output: type: file description: File containing software versions pattern: "versions.yml" + authors: - "@drpatelh" - "@grst" -maintainers: - - "@drpatelh" - - "@grst" diff --git a/modules/nf-core/umitools/extract/tests/main.nf.test b/modules/nf-core/umitools/extract/tests/main.nf.test deleted file mode 100644 index 22242d1df..000000000 --- a/modules/nf-core/umitools/extract/tests/main.nf.test +++ /dev/null @@ -1,35 +0,0 @@ -nextflow_process { - - name "Test Process UMITOOLS_EXTRACT" - script "../main.nf" - process "UMITOOLS_EXTRACT" - config "./nextflow.config" - tag "modules_nfcore" - tag "modules" - tag "umitools" - tag "umitools/extract" - - test("Should run without failures") { - - when { - params { - outdir = "$outputDir" - } - process { - """ - input[0] = [ [ id:'test', single_end:true ], // meta map - [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out.versions).match("versions") } - ) - } - - } -} \ No newline at end of file diff --git a/modules/nf-core/umitools/extract/tests/main.nf.test.snap b/modules/nf-core/umitools/extract/tests/main.nf.test.snap deleted file mode 100644 index 6d5944f1d..000000000 --- a/modules/nf-core/umitools/extract/tests/main.nf.test.snap +++ /dev/null @@ -1,10 +0,0 @@ -{ - "versions": { - "content": [ - [ - "versions.yml:md5,5a18da2d3a5a4de15e7aaae9082d7abb" - ] - ], - "timestamp": "2023-12-08T09:41:43.540658352" - } -} \ No newline at end of file diff --git a/modules/nf-core/umitools/extract/tests/nextflow.config b/modules/nf-core/umitools/extract/tests/nextflow.config deleted file mode 100644 index c866f5a00..000000000 --- a/modules/nf-core/umitools/extract/tests/nextflow.config +++ /dev/null @@ -1,9 +0,0 @@ -process { - - publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } - - withName: UMITOOLS_EXTRACT { - ext.args = '--bc-pattern="NNNN"' - } - -} diff --git a/modules/nf-core/umitools/extract/tests/tags.yml b/modules/nf-core/umitools/extract/tests/tags.yml deleted file mode 100644 index c3fb23de4..000000000 --- a/modules/nf-core/umitools/extract/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -umitools/extract: - - modules/nf-core/umitools/extract/** diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/meta.yml b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/meta.yml index e655484e7..f11e7ab6f 100644 --- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/meta.yml +++ b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/meta.yml @@ -53,9 +53,7 @@ output: description: | Files containing software versions Structure: [ path(versions.yml) ] + authors: - "@drpatelh" - "@KamilMaliszArdigen" -maintainers: - - "@drpatelh" - - "@KamilMaliszArdigen" diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test deleted file mode 100644 index e3214d4f2..000000000 --- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test +++ /dev/null @@ -1,51 +0,0 @@ -nextflow_workflow { - - name "Test Workflow BAM_DEDUP_STATS_SAMTOOLS_UMITOOLS" - script "../main.nf" - workflow "BAM_DEDUP_STATS_SAMTOOLS_UMITOOLS" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "subworkflows/bam_dedup_stats_samtools_umitools" - tag "subworkflows/bam_stats_samtools" - tag "bam_dedup_stats_samtools_umitools" - tag "bam_stats_samtools" - tag "samtools" - tag "samtools/index" - tag "samtools/stats" - tag "samtools/idxstats" - tag "samtools/flagstat" - tag "umitools" - tag "umitools/dedup" - - test("sarscov2_bam_bai") { - - when { - params { - outdir = "$outputDir" - } - workflow { - """ - input[0] = [ - [ id:'test'], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) - ] - input[1] = false - """ - } - } - - then { - assertAll( - { assert workflow.success}, - { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, - { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, - { assert snapshot(workflow.out.stats).match("test_bam_dedup_stats_samtools_umitools_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_dedup_stats_samtools_umitools_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_dedup_stats_samtools_umitools_idxstats") } - ) - } - - } - -} diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap deleted file mode 100644 index 036a63bbe..000000000 --- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap +++ /dev/null @@ -1,41 +0,0 @@ -{ - "test_bam_dedup_stats_samtools_umitools_idxstats": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.idxstats:md5,1adb27b52d4d64b826f48b59d61dcd4d" - ] - ] - ], - "timestamp": "2023-11-06T09:58:40.394333937" - }, - "test_bam_dedup_stats_samtools_umitools_flagstats": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.flagstat:md5,0bb716e40fae381b97484b58e0b16efe" - ] - ] - ], - "timestamp": "2023-11-06T09:58:40.385185447" - }, - "test_bam_dedup_stats_samtools_umitools_stats": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.stats:md5,6c296bce3659651fb5a08c31db314d91" - ] - ] - ], - "timestamp": "2023-12-04T11:06:41.700472756" - } -} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml deleted file mode 100644 index bfd5e023e..000000000 --- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/bam_dedup_stats_samtools_umitools: - - subworkflows/nf-core/bam_dedup_stats_samtools_umitools/** diff --git a/subworkflows/nf-core/bam_markduplicates_picard/meta.yml b/subworkflows/nf-core/bam_markduplicates_picard/meta.yml index fe63068e6..b924596d8 100644 --- a/subworkflows/nf-core/bam_markduplicates_picard/meta.yml +++ b/subworkflows/nf-core/bam_markduplicates_picard/meta.yml @@ -6,6 +6,7 @@ keywords: - bam - sam - cram + components: - picard/markduplicates - samtools/index @@ -13,6 +14,7 @@ components: - samtools/idxstats - samtools/flagstat - bam_stats_samtools + input: - ch_bam: description: | @@ -58,6 +60,3 @@ output: authors: - "@dmarron" - "@drpatelh" -maintainers: - - "@dmarron" - - "@drpatelh" diff --git a/subworkflows/nf-core/bam_rseqc/main.nf b/subworkflows/nf-core/bam_rseqc/main.nf index bf530f09d..a698b30ab 100644 --- a/subworkflows/nf-core/bam_rseqc/main.nf +++ b/subworkflows/nf-core/bam_rseqc/main.nf @@ -28,153 +28,141 @@ workflow BAM_RSEQC { // // Run RSeQC bam_stat.py // - ch_bamstat = Channel.empty() + bamstat_txt = Channel.empty() if ('bam_stat' in rseqc_modules) { RSEQC_BAMSTAT ( ch_bam ) - ch_bamstat = RSEQC_BAMSTAT.out.txt + bamstat_txt = RSEQC_BAMSTAT.out.txt ch_versions = ch_versions.mix(RSEQC_BAMSTAT.out.versions.first()) } // // Run RSeQC inner_distance.py // - ch_innerdistance = Channel.empty() - ch_innerdistance_distance = Channel.empty() - ch_innerdistance_freq = Channel.empty() - ch_innerdistance_mean = Channel.empty() - ch_innerdistance_pdf = Channel.empty() - ch_innerdistance_rscript = Channel.empty() + innerdistance_distance = Channel.empty() + innerdistance_freq = Channel.empty() + innerdistance_mean = Channel.empty() + innerdistance_pdf = Channel.empty() + innerdistance_rscript = Channel.empty() if ('inner_distance' in rseqc_modules) { RSEQC_INNERDISTANCE ( ch_bam, ch_bed ) - ch_innerdistance_distance = RSEQC_INNERDISTANCE.out.distance - ch_innerdistance_freq = RSEQC_INNERDISTANCE.out.freq - ch_innerdistance_mean = RSEQC_INNERDISTANCE.out.mean - ch_innerdistance_pdf = RSEQC_INNERDISTANCE.out.pdf - ch_innerdistance_rscript = RSEQC_INNERDISTANCE.out.rscript - ch_innerdistance = ch_innerdistance_distance.mix(ch_innerdistance_freq, ch_innerdistance_mean, ch_innerdistance_pdf, ch_innerdistance_rscript) - ch_versions = ch_versions.mix(RSEQC_INNERDISTANCE.out.versions.first()) + innerdistance_distance = RSEQC_INNERDISTANCE.out.distance + innerdistance_freq = RSEQC_INNERDISTANCE.out.freq + innerdistance_mean = RSEQC_INNERDISTANCE.out.mean + innerdistance_pdf = RSEQC_INNERDISTANCE.out.pdf + innerdistance_rscript = RSEQC_INNERDISTANCE.out.rscript + ch_versions = ch_versions.mix(RSEQC_INNERDISTANCE.out.versions.first()) } // // Run RSeQC infer_experiment.py // - ch_inferexperiment = Channel.empty() + inferexperiment_txt = Channel.empty() if ('infer_experiment' in rseqc_modules) { RSEQC_INFEREXPERIMENT ( ch_bam, ch_bed ) - ch_inferexperiment = RSEQC_INFEREXPERIMENT.out.txt - ch_versions = ch_versions.mix(RSEQC_INFEREXPERIMENT.out.versions.first()) + inferexperiment_txt = RSEQC_INFEREXPERIMENT.out.txt + ch_versions = ch_versions.mix(RSEQC_INFEREXPERIMENT.out.versions.first()) } // // Run RSeQC junction_annotation.py // - ch_junctionannotation = Channel.empty() - ch_junctionannotation_bed = Channel.empty() - ch_junctionannotation_interact_bed = Channel.empty() - ch_junctionannotation_xls = Channel.empty() - ch_junctionannotation_pdf = Channel.empty() - ch_junctionannotation_events_pdf = Channel.empty() - ch_junctionannotation_rscript = Channel.empty() - ch_junctionannotation_log = Channel.empty() + junctionannotation_bed = Channel.empty() + junctionannotation_interact_bed = Channel.empty() + junctionannotation_xls = Channel.empty() + junctionannotation_pdf = Channel.empty() + junctionannotation_events_pdf = Channel.empty() + junctionannotation_rscript = Channel.empty() + junctionannotation_log = Channel.empty() if ('junction_annotation' in rseqc_modules) { RSEQC_JUNCTIONANNOTATION ( ch_bam, ch_bed ) - ch_junctionannotation_bed = RSEQC_JUNCTIONANNOTATION.out.bed - ch_junctionannotation_interact_bed = RSEQC_JUNCTIONANNOTATION.out.interact_bed - ch_junctionannotation_xls = RSEQC_JUNCTIONANNOTATION.out.xls - ch_junctionannotation_pdf = RSEQC_JUNCTIONANNOTATION.out.pdf - ch_junctionannotation_events_pdf = RSEQC_JUNCTIONANNOTATION.out.events_pdf - ch_junctionannotation_rscript = RSEQC_JUNCTIONANNOTATION.out.rscript - ch_junctionannotation_log = RSEQC_JUNCTIONANNOTATION.out.log - ch_junctionannotation = ch_junctionannotation_bed.mix(ch_junctionannotation_interact_bed, ch_junctionannotation_xls, ch_junctionannotation_pdf, ch_junctionannotation_events_pdf, ch_junctionannotation_rscript, ch_junctionannotation_log) - ch_versions = ch_versions.mix(RSEQC_JUNCTIONANNOTATION.out.versions.first()) + junctionannotation_bed = RSEQC_JUNCTIONANNOTATION.out.bed + junctionannotation_interact_bed = RSEQC_JUNCTIONANNOTATION.out.interact_bed + junctionannotation_xls = RSEQC_JUNCTIONANNOTATION.out.xls + junctionannotation_pdf = RSEQC_JUNCTIONANNOTATION.out.pdf + junctionannotation_events_pdf = RSEQC_JUNCTIONANNOTATION.out.events_pdf + junctionannotation_rscript = RSEQC_JUNCTIONANNOTATION.out.rscript + junctionannotation_log = RSEQC_JUNCTIONANNOTATION.out.log + ch_versions = ch_versions.mix(RSEQC_JUNCTIONANNOTATION.out.versions.first()) } // // Run RSeQC junction_saturation.py // - ch_junctionsaturation = Channel.empty() - ch_junctionsaturation_pdf = Channel.empty() - ch_junctionsaturation_rscript = Channel.empty() + junctionsaturation_pdf = Channel.empty() + junctionsaturation_rscript = Channel.empty() if ('junction_saturation' in rseqc_modules) { RSEQC_JUNCTIONSATURATION ( ch_bam, ch_bed ) - ch_junctionsaturation_pdf = RSEQC_JUNCTIONSATURATION.out.pdf - ch_junctionsaturation_rscript = RSEQC_JUNCTIONSATURATION.out.rscript - ch_junctionsaturation = ch_junctionsaturation_pdf.mix(ch_junctionsaturation_rscript) - ch_versions = ch_versions.mix(RSEQC_JUNCTIONSATURATION.out.versions.first()) + junctionsaturation_pdf = RSEQC_JUNCTIONSATURATION.out.pdf + junctionsaturation_rscript = RSEQC_JUNCTIONSATURATION.out.rscript + ch_versions = ch_versions.mix(RSEQC_JUNCTIONSATURATION.out.versions.first()) } // // Run RSeQC read_distribution.py // - ch_readdistribution = Channel.empty() + readdistribution_txt = Channel.empty() if ('read_distribution' in rseqc_modules) { RSEQC_READDISTRIBUTION ( ch_bam, ch_bed ) - ch_readdistribution = RSEQC_READDISTRIBUTION.out.txt - ch_versions = ch_versions.mix(RSEQC_READDISTRIBUTION.out.versions.first()) + readdistribution_txt = RSEQC_READDISTRIBUTION.out.txt + ch_versions = ch_versions.mix(RSEQC_READDISTRIBUTION.out.versions.first()) } // // Run RSeQC read_duplication.py // - ch_readduplication = Channel.empty() - ch_readduplication_seq_xls = Channel.empty() - ch_readduplication_pos_xls = Channel.empty() - ch_readduplication_pdf = Channel.empty() - ch_readduplication_rscript = Channel.empty() + readduplication_seq_xls = Channel.empty() + readduplication_pos_xls = Channel.empty() + readduplication_pdf = Channel.empty() + readduplication_rscript = Channel.empty() if ('read_duplication' in rseqc_modules) { RSEQC_READDUPLICATION ( ch_bam ) - ch_readduplication_seq_xls = RSEQC_READDUPLICATION.out.seq_xls - ch_readduplication_pos_xls = RSEQC_READDUPLICATION.out.pos_xls - ch_readduplication_pdf = RSEQC_READDUPLICATION.out.pdf - ch_readduplication_rscript = RSEQC_READDUPLICATION.out.rscript - ch_readduplication = ch_readduplication_seq_xls.mix(ch_readduplication_pos_xls, ch_readduplication_pdf, ch_readduplication_rscript) - ch_versions = ch_versions.mix(RSEQC_READDUPLICATION.out.versions.first()) + readduplication_seq_xls = RSEQC_READDUPLICATION.out.seq_xls + readduplication_pos_xls = RSEQC_READDUPLICATION.out.pos_xls + readduplication_pdf = RSEQC_READDUPLICATION.out.pdf + readduplication_rscript = RSEQC_READDUPLICATION.out.rscript + ch_versions = ch_versions.mix(RSEQC_READDUPLICATION.out.versions.first()) } // // Run RSeQC tin.py // - ch_tin = Channel.empty() + tin_txt = Channel.empty() if ('tin' in rseqc_modules) { RSEQC_TIN ( ch_bam_bai, ch_bed ) - ch_tin = RSEQC_TIN.out.txt + tin_txt = RSEQC_TIN.out.txt ch_versions = ch_versions.mix(RSEQC_TIN.out.versions.first()) } emit: - ch_bamstat // channel: [ val(meta), txt ] + bamstat_txt // channel: [ val(meta), txt ] - ch_innerdistance - ch_innerdistance_distance // channel: [ val(meta), txt ] - ch_innerdistance_freq // channel: [ val(meta), txt ] - ch_innerdistance_mean // channel: [ val(meta), txt ] - ch_innerdistance_pdf // channel: [ val(meta), pdf ] - ch_innerdistance_rscript // channel: [ val(meta), r ] + innerdistance_distance // channel: [ val(meta), txt ] + innerdistance_freq // channel: [ val(meta), txt ] + innerdistance_mean // channel: [ val(meta), txt ] + innerdistance_pdf // channel: [ val(meta), pdf ] + innerdistance_rscript // channel: [ val(meta), r ] - ch_inferexperiment // channel: [ val(meta), txt ] + inferexperiment_txt // channel: [ val(meta), txt ] - ch_junctionannotation - ch_junctionannotation_bed // channel: [ val(meta), bed ] - ch_junctionannotation_interact_bed // channel: [ val(meta), bed ] - ch_junctionannotation_xls // channel: [ val(meta), xls ] - ch_junctionannotation_pdf // channel: [ val(meta), pdf ] - ch_junctionannotation_events_pdf // channel: [ val(meta), pdf ] - ch_junctionannotation_rscript // channel: [ val(meta), r ] - ch_junctionannotation_log // channel: [ val(meta), log ] + junctionannotation_bed // channel: [ val(meta), bed ] + junctionannotation_interact_bed // channel: [ val(meta), bed ] + junctionannotation_xls // channel: [ val(meta), xls ] + junctionannotation_pdf // channel: [ val(meta), pdf ] + junctionannotation_events_pdf // channel: [ val(meta), pdf ] + junctionannotation_rscript // channel: [ val(meta), r ] + junctionannotation_log // channel: [ val(meta), log ] - ch_junctionsaturation - ch_junctionsaturation_pdf // channel: [ val(meta), pdf ] - ch_junctionsaturation_rscript // channel: [ val(meta), r ] + junctionsaturation_pdf // channel: [ val(meta), pdf ] + junctionsaturation_rscript // channel: [ val(meta), r ] - ch_readdistribution // channel: [ val(meta), txt ] + readdistribution_txt // channel: [ val(meta), txt ] - ch_readduplication - ch_readduplication_seq_xls // channel: [ val(meta), xls ] - ch_readduplication_pos_xls // channel: [ val(meta), xls ] - ch_readduplication_pdf // channel: [ val(meta), pdf ] - ch_readduplication_rscript // channel: [ val(meta), r ] + readduplication_seq_xls // channel: [ val(meta), xls ] + readduplication_pos_xls // channel: [ val(meta), xls ] + readduplication_pdf // channel: [ val(meta), pdf ] + readduplication_rscript // channel: [ val(meta), r ] - ch_tin // channel: [ val(meta), txt ] + tin_txt // channel: [ val(meta), txt ] - versions = ch_versions // channel: [ versions.yml ] + versions = ch_versions // channel: [ versions.yml ] } diff --git a/subworkflows/nf-core/bam_rseqc/meta.yml b/subworkflows/nf-core/bam_rseqc/meta.yml index 2fef88737..428b83e6d 100644 --- a/subworkflows/nf-core/bam_rseqc/meta.yml +++ b/subworkflows/nf-core/bam_rseqc/meta.yml @@ -12,16 +12,8 @@ keywords: - readdistribution - readduplication - tin -components: +modules: - rseqc - - rseqc/tin - - rseqc/readduplication - - rseqc/readdistribution - - rseqc/junctionsaturation - - rseqc/junctionannotation - - rseqc/innerdistance - - rseqc/inferexperiment - - rseqc/bamstat input: - meta: type: map @@ -46,107 +38,91 @@ input: List of rseqc modules to run e.g. [ 'bam_stat', 'infer_experiment' ] output: - - ch_bamstat: + - bamstat_txt: type: file description: bam statistics report pattern: "*.bam_stat.txt" - - ch_innerdistance: - type: file - description: All the output files from RSEQC_INNERDISTANCE - pattern: "*.{txt,pdf,R}" - - ch_innerdistance_distance: + - innerdistance_distance: type: file description: the inner distances pattern: "*.inner_distance.txt" - - ch_innerdistance_freq: + - innerdistance_freq: type: file description: frequencies of different insert sizes pattern: "*.inner_distance_freq.txt" - - ch_innerdistance_mean: + - innerdistance_mean: type: file description: mean/median values of inner distances pattern: "*.inner_distance_mean.txt" - - ch_innerdistance_pdf: + - innerdistance_pdf: type: file description: distribution plot of inner distances pattern: "*.inner_distance_plot.pdf" - - ch_innerdistance_rscript: + - innerdistance_rscript: type: file description: script to reproduce the plot pattern: "*.inner_distance_plot.R" - - ch_inferexperiment: + - inferexperiment_txt: type: file description: infer_experiment results report pattern: "*.infer_experiment.txt" - - ch_junctionannotation: - type: file - description: All the output files from RSEQC_JUNCTIONANNOTATION - pattern: "*.{bed,xls,pdf,R,log}" - - ch_junctionannotation_bed: + - junctionannotation_bed: type: file description: bed file of annotated junctions pattern: "*.junction.bed" - - ch_junctionannotation_interact_bed: + - junctionannotation_interact_bed: type: file description: Interact bed file pattern: "*.Interact.bed" - - ch_junctionannotation_xls: + - junctionannotation_xls: type: file description: xls file with junction information pattern: "*.xls" - - ch_junctionannotation_pdf: + - junctionannotation_pdf: type: file description: junction plot pattern: "*.junction.pdf" - - ch_junctionannotation_events_pdf: + - junctionannotation_events_pdf: type: file description: events plot pattern: "*.events.pdf" - - ch_junctionannotation_rscript: + - junctionannotation_rscript: type: file description: Rscript to reproduce the plots pattern: "*.r" - - ch_junctionannotation_log: + - junctionannotation_log: type: file description: Log file generated by tool pattern: "*.log" - - ch_junctionsaturation: - type: file - description: All the output files from RSEQC_JUNCTIONSATURATION - pattern: "*.{pdf,R}" - - ch_junctionsaturation_pdf: + - junctionsaturation_pdf: type: file description: Junction saturation report pattern: "*.pdf" - - ch_junctionsaturation_rscript: + - junctionsaturation_rscript: type: file description: Junction saturation R-script pattern: "*.r" - - ch_readdistribution: + - readdistribution_txt: type: file description: the read distribution report pattern: "*.read_distribution.txt" - - ch_readduplication: - type: file - description: All the output files from RSEQC_READDUPLICATION - pattern: "*.{xls,pdf,R}" - - ch_readduplication_seq_xls: + - readduplication_seq_xls: type: file description: Read duplication rate determined from mapping position of read pattern: "*seq.DupRate.xls" - - ch_readduplication_pos_xls: + - readduplication_pos_xls: type: file description: Read duplication rate determined from sequence of read pattern: "*pos.DupRate.xls" - - ch_readduplication_pdf: + - readduplication_pdf: type: file description: plot of duplication rate pattern: "*.pdf" - - ch_readduplication_rscript: + - readduplication_rscript: type: file description: script to reproduce the plot pattern: "*.R" - - ch_tin: + - tin_txt: type: file description: TXT file containing tin.py results summary pattern: "*.txt" @@ -157,6 +133,3 @@ output: authors: - "@drpatelh" - "@kevinmenden" -maintainers: - - "@drpatelh" - - "@kevinmenden" diff --git a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test deleted file mode 100644 index 171476a91..000000000 --- a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test +++ /dev/null @@ -1,96 +0,0 @@ -nextflow_workflow { - - name "Test Workflow BAM_RSEQC" - script "../main.nf" - workflow "BAM_RSEQC" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "subworkflows/bam_rseqc" - tag "bam_rseqc" - tag "rseqc" - tag "rseqc/bamstat" - tag "rseqc/inferexperiment" - tag "rseqc/innerdistance" - tag "rseqc/junctionannotation" - tag "rseqc/junctionsaturation" - tag "rseqc/readdistribution" - tag "rseqc/readduplication" - tag "rseqc/tin" - - test("sarscov2 paired-end [bam]") { - - when { - workflow { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) - ]) - input[1] = file(params.test_data['sarscov2']['genome']['test_bed12'], checkIfExists: true) - input[2] = ['bam_stat', 'inner_distance', 'infer_experiment', 'junction_annotation', 'junction_saturation', 'read_distribution', 'read_duplication', 'tin'] - """ - } - } - - then { - assertAll( - { assert workflow.success}, - { assert snapshot(workflow.out.ch_bamstat).match("bamstat")}, - - { assert snapshot(workflow.out.ch_innerdistance.findAll { it[1].endsWith('.pdf') == false }).match("inner_distance")}, - { assert workflow.out.ch_innerdistance.any { it[1].endsWith('.pdf') && file(it[1]).exists() } }, - - { assert snapshot(workflow.out.ch_inferexperiment).match("inferexperiment")}, - - { assert snapshot(workflow.out.ch_junctionannotation.findAll { - it[1].endsWith('.xls') == false && - it[1].endsWith('.r') == false }).match("junction_annotation")}, - - { assert snapshot(workflow.out.ch_junctionsaturation.findAll { it[1].endsWith('.pdf') == false }).match("junction_saturation")}, - { assert workflow.out.ch_junctionsaturation.any { it[1].endsWith('.pdf') && file(it[1]).exists() } }, - - { assert snapshot(workflow.out.ch_readdistribution).match("readdistribution")}, - - { assert snapshot(workflow.out.ch_readduplication.findAll { it[1].endsWith('.pdf') == false }).match("read_duplication")}, - { assert workflow.out.ch_readduplication.any { it[1].endsWith('.pdf') && file(it[1]).exists() } }, - - { assert snapshot(workflow.out.ch_tin).match("tin")}, - { assert snapshot(workflow.out.versions).match("versions")}, - ) - } - } - - test("sarscov2 paired-end [bam] no modules") { - - when { - workflow { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) - ]) - input[1] = file(params.test_data['sarscov2']['genome']['test_bed12'], checkIfExists: true) - input[2] = [] - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.out.ch_bamstat.size() == 0 }, - { assert workflow.out.ch_innerdistance.size() == 0 }, - { assert workflow.out.ch_inferexperiment.size() == 0 }, - { assert workflow.out.ch_junctionannotation.size() == 0 }, - { assert workflow.out.ch_junctionsaturation.size() == 0 }, - { assert workflow.out.ch_readdistribution.size() == 0 }, - { assert workflow.out.ch_readduplication.size() == 0 }, - { assert workflow.out.ch_tin.size() == 0 }, - { assert workflow.out.versions.size() == 0 }, - ) - } - } - -} diff --git a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap deleted file mode 100644 index 13285ef06..000000000 --- a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap +++ /dev/null @@ -1,151 +0,0 @@ -{ - "inner_distance": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.inner_distance.txt:md5,a1acc9def0f64a5500d4c4cb47cbe32b" - ], - [ - { - "id": "test" - }, - "test.inner_distance_freq.txt:md5,3fc037501f5899b5da009c8ce02fc25e" - ], - [ - { - "id": "test" - }, - "test.inner_distance_mean.txt:md5,58398b7d5a29a5e564f9e3c50b55996c" - ], - [ - { - "id": "test" - }, - "test.inner_distance_plot.r:md5,5859fbd5b42046d47e8b9aa85077f4ea" - ] - ] - ], - "timestamp": "2023-12-08T14:37:45.734509133" - }, - "junction_saturation": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.junctionSaturation_plot.r:md5,caa6e63dcb477aabb169882b2f30dadd" - ] - ] - ], - "timestamp": "2023-12-08T14:37:45.825157699" - }, - "versions": { - "content": [ - [ - "versions.yml:md5,07b3ad789260bd746d872e7ff18153b2", - "versions.yml:md5,59d1ee2d13b29d10549187562d8fe1e0", - "versions.yml:md5,5eb5515f8009effdbb601170bb90ba29", - "versions.yml:md5,71818a5705b87b9d5c2532403a436bd8", - "versions.yml:md5,a09f406b0da71ca4291fd935e49d377d", - "versions.yml:md5,c9124387d6090cb4c94aaa9bf0e1c321", - "versions.yml:md5,e1e69eaa546288ace5e97285313e1420", - "versions.yml:md5,fe3bf0ac57c99687880ee62b28a4d4df" - ] - ], - "timestamp": "2023-12-08T14:37:45.942304603" - }, - "tin": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.paired_end.sorted.summary.txt:md5,9d98447e178b89a89f6f5aba7a772fe6" - ] - ] - ], - "timestamp": "2023-12-08T14:37:45.935155313" - }, - "bamstat": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.bam_stat.txt:md5,2675857864c1d1139b2a19d25dc36b09" - ] - ] - ], - "timestamp": "2023-12-08T14:37:45.671792186" - }, - "inferexperiment": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.infer_experiment.txt:md5,f9d0bfc239df637cd8aeda40ade3c59a" - ] - ] - ], - "timestamp": "2023-12-08T14:37:45.747507043" - }, - "read_duplication": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.DupRate_plot.r:md5,3c0325095cee4835b921e57d61c23dca" - ], - [ - { - "id": "test" - }, - "test.pos.DupRate.xls:md5,a859bc2031d46bf1cc4336205847caa3" - ], - [ - { - "id": "test" - }, - "test.seq.DupRate.xls:md5,ee8783399eec5a18522a6f08bece338b" - ] - ] - ], - "timestamp": "2023-12-08T14:37:45.927253593" - }, - "junction_annotation": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.junction_annotation.log:md5,d75e0f5d62fada8aa9449991b209554c" - ] - ] - ], - "timestamp": "2023-12-08T14:37:45.757733033" - }, - "readdistribution": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.read_distribution.txt:md5,56893fdc0809d968629a363551a1655f" - ] - ] - ], - "timestamp": "2023-12-08T14:37:45.841855468" - } -} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_rseqc/tests/tags.yml b/subworkflows/nf-core/bam_rseqc/tests/tags.yml deleted file mode 100644 index c8dfce3a9..000000000 --- a/subworkflows/nf-core/bam_rseqc/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/bam_rseqc: - - subworkflows/nf-core/bam_rseqc/** diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml b/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml index e01f9ccf6..69c16be41 100644 --- a/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml +++ b/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml @@ -65,6 +65,3 @@ output: authors: - "@drpatelh" - "@ewels" -maintainers: - - "@drpatelh" - - "@ewels" diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test deleted file mode 100644 index 59b749d8f..000000000 --- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test +++ /dev/null @@ -1,78 +0,0 @@ -nextflow_workflow { - - name "Test Workflow BAM_SORT_STATS_SAMTOOLS" - script "../main.nf" - workflow "BAM_SORT_STATS_SAMTOOLS" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "subworkflows/bam_sort_stats_samtools" - tag "bam_sort_stats_samtools" - tag "subworkflows/bam_stats_samtools" - tag "bam_stats_samtools" - tag "samtools" - tag "samtools/index" - tag "samtools/sort" - tag "samtools/stats" - tag "samtools/idxstats" - tag "samtools/flagstat" - - test("test_bam_sort_stats_samtools_single_end") { - - when { - params { - outdir = "$outputDir" - } - workflow { - """ - input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_single_end_bam'], checkIfExists: true) - ] - input[1] = [ [ id:'genome' ], - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert workflow.success}, - { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, - { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, - { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_single_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_single_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_single_end_idxstats") } - ) - } - } - - test("test_bam_sort_stats_samtools_paired_end") { - - when { - params { - outdir = "$outputDir" - } - workflow { - """ - input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) - ] - input[1] = [ [ id:'genome' ], - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert workflow.success}, - { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, - { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, - { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_paired_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_paired_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_paired_end_idxstats") } - ) - } - } -} diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap deleted file mode 100644 index 77afbf176..000000000 --- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap +++ /dev/null @@ -1,86 +0,0 @@ -{ - "test_bam_sort_stats_samtools_paired_end_flagstats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" - ] - ] - ], - "timestamp": "2023-10-22T20:25:03.687121177" - }, - "test_bam_sort_stats_samtools_paired_end_idxstats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" - ] - ] - ], - "timestamp": "2023-10-22T20:25:03.709648916" - }, - "test_bam_sort_stats_samtools_single_end_stats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.stats:md5,f281507081517414eb1a04b2d9c855b2" - ] - ] - ], - "timestamp": "2023-12-04T11:06:50.951881479" - }, - "test_bam_sort_stats_samtools_paired_end_stats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.stats:md5,e32e7e49dce1fbe327a89e0fb7bc01b1" - ] - ] - ], - "timestamp": "2023-12-04T11:06:59.253905951" - }, - "test_bam_sort_stats_samtools_single_end_idxstats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" - ] - ] - ], - "timestamp": "2023-10-22T20:25:58.451364604" - }, - "test_bam_sort_stats_samtools_single_end_flagstats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" - ] - ] - ], - "timestamp": "2023-10-22T20:25:58.416859285" - } -} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml b/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml deleted file mode 100644 index 30b69d6a4..000000000 --- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/bam_sort_stats_samtools: - - subworkflows/nf-core/bam_sort_stats_samtools/** diff --git a/subworkflows/nf-core/bam_stats_samtools/meta.yml b/subworkflows/nf-core/bam_stats_samtools/meta.yml index 809bf736b..87863b11b 100644 --- a/subworkflows/nf-core/bam_stats_samtools/meta.yml +++ b/subworkflows/nf-core/bam_stats_samtools/meta.yml @@ -39,5 +39,3 @@ output: Structure: [ path(versions.yml) ] authors: - "@drpatelh" -maintainers: - - "@drpatelh" diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test deleted file mode 100644 index 972108905..000000000 --- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test +++ /dev/null @@ -1,102 +0,0 @@ -nextflow_workflow { - - name "Test Workflow BAM_STATS_SAMTOOLS" - script "../main.nf" - workflow "BAM_STATS_SAMTOOLS" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "bam_stats_samtools" - tag "subworkflows/bam_stats_samtools" - tag "samtools" - tag "samtools/flagstat" - tag "samtools/idxstats" - tag "samtools/stats" - - test("test_bam_stats_samtools_single_end") { - - when { - params { - outdir = "$outputDir" - } - workflow { - """ - input[0] = [ [ id:'test', single_end:true ], // meta map - file(params.test_data['sarscov2']['illumina']['test_single_end_sorted_bam'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_single_end_sorted_bam_bai'], checkIfExists: true) - ] - input[1] = [ [ id:'genome' ], - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert workflow.success}, - { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_single_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_single_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_single_end_idxstats") } - ) - } - } - - test("test_bam_stats_samtools_paired_end") { - - when { - params { - outdir = "$outputDir" - } - workflow { - """ - input[0] = [ [ id:'test', single_end:true ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) - ] - input[1] = [ [ id:'genome' ], - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_idxstats") } - ) - } - } - - test("test_bam_stats_samtools_paired_end_cram") { - - when { - params { - outdir = "$outputDir" - } - workflow { - """ - input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), - file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) - ] - input[1] = [ [ id:'genome' ], - file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert workflow.success}, - { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_cram_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_cram_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_cram_idxstats") } - ) - } - } - -} diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap deleted file mode 100644 index d3af13769..000000000 --- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap +++ /dev/null @@ -1,128 +0,0 @@ -{ - "test_bam_stats_samtools_paired_end_cram_flagstats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781" - ] - ] - ], - "timestamp": "2023-11-06T09:31:26.194017574" - }, - "test_bam_stats_samtools_paired_end_stats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.stats:md5,49e2b43344ff92bc4c02463a58f7ba4a" - ] - ] - ], - "timestamp": "2023-12-04T11:07:13.965061942" - }, - "test_bam_stats_samtools_paired_end_flagstats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" - ] - ] - ], - "timestamp": "2023-11-06T09:31:11.668517251" - }, - "test_bam_stats_samtools_single_end_flagstats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" - ] - ] - ], - "timestamp": "2023-11-06T09:26:10.340046381" - }, - "test_bam_stats_samtools_paired_end_cram_idxstats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15" - ] - ] - ], - "timestamp": "2023-11-06T09:31:26.207052003" - }, - "test_bam_stats_samtools_single_end_stats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.stats:md5,5a6667d97806e5002731e9cf23674fad" - ] - ] - ], - "timestamp": "2023-12-04T11:07:06.676820877" - }, - "test_bam_stats_samtools_paired_end_idxstats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" - ] - ] - ], - "timestamp": "2023-11-06T09:31:11.68246157" - }, - "test_bam_stats_samtools_single_end_idxstats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" - ] - ] - ], - "timestamp": "2023-11-06T09:26:10.349439801" - }, - "test_bam_stats_samtools_paired_end_cram_stats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.stats:md5,2cf2fe93596ee3d74f946097b204a629" - ] - ] - ], - "timestamp": "2023-12-04T11:07:22.30295557" - } -} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml b/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml deleted file mode 100644 index ec2f2d68f..000000000 --- a/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/bam_stats_samtools: - - subworkflows/nf-core/bam_stats_samtools/** diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml index 220e8db1c..f76b40261 100644 --- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml +++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml @@ -69,10 +69,8 @@ output: - reads: type: file description: > - Extracted FASTQ files. | For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. | - - - + Extracted FASTQ files. | + For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. | For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz. pattern: "*.{fastq.gz}" - fastqc_html: @@ -124,5 +122,3 @@ output: pattern: "versions.yml" authors: - "@robsyme" -maintainers: - - "@robsyme" diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test deleted file mode 100644 index cdd73984c..000000000 --- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test +++ /dev/null @@ -1,60 +0,0 @@ -nextflow_workflow { - - name "Test Workflow FASTQ_FASTQC_UMITOOLS_FASTP" - script "../main.nf" - workflow "FASTQ_FASTQC_UMITOOLS_FASTP" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "subworkflows/fastq_fastqc_umitools_fastp" - tag "fastq_fastqc_umitools_fastp" - tag "fastqc" - tag "umitools/extract" - tag "fastp" - - - test("sarscov2 paired-end [fastq]") { - - when { - workflow { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) - ] - ] - input[1] = false // skip_fastqc - input[2] = false // with_umi - input[3] = false // skip_umi_extract - input[4] = 1 // umi_discard_read - input[5] = false // skip_trimming - input[6] = [] // adapter_fasta - input[7] = false // save_trimmed_fail - input[8] = false // save_merged - input[9] = 1 // min_trimmed_reads - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert snapshot(workflow.out.reads).match("reads") }, - { assert snapshot(workflow.out.umi_log).match("umi_log") }, - { assert snapshot(workflow.out.trim_json).match("trim_json") }, - { assert snapshot(workflow.out.trim_reads_fail).match("trim_reads_fail") }, - { assert snapshot(workflow.out.trim_reads_merged).match("trim_reads_merged") }, - { assert snapshot(workflow.out.trim_read_count).match("trim_read_count") }, - { assert snapshot(workflow.out.versions).match("versions") }, - - { assert workflow.out.fastqc_raw_html }, - { assert workflow.out.fastqc_raw_zip }, - { assert workflow.out.trim_html }, - { assert workflow.out.trim_log }, - { assert workflow.out.fastqc_trim_html }, - { assert workflow.out.fastqc_trim_zip } - ) - } - } -} diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap deleted file mode 100644 index 38a65aebe..000000000 --- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap +++ /dev/null @@ -1,81 +0,0 @@ -{ - "trim_reads_merged": { - "content": [ - [ - - ] - ], - "timestamp": "2023-11-26T02:28:26.26920982" - }, - "trim_reads_fail": { - "content": [ - [ - - ] - ], - "timestamp": "2023-11-26T02:28:26.25861515" - }, - "versions": { - "content": [ - [ - "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", - "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", - "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" - ] - ], - "timestamp": "2023-11-26T02:28:26.30891403" - }, - "trim_json": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" - ] - ] - ], - "timestamp": "2023-11-26T02:28:26.24768259" - }, - "reads": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", - "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" - ] - ] - ] - ], - "timestamp": "2023-12-04T11:30:32.061644815" - }, - "umi_log": { - "content": [ - [ - - ] - ], - "timestamp": "2023-11-26T02:28:26.238536" - }, - "trim_read_count": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - 198 - ] - ] - ], - "timestamp": "2023-11-26T02:28:26.27984169" - } -} \ No newline at end of file diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml deleted file mode 100644 index 84a4b5676..000000000 --- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/fastq_fastqc_umitools_fastp: - - subworkflows/nf-core/fastq_fastqc_umitools_fastp/** diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/meta.yml b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/meta.yml index a7df97f77..e32e90f43 100644 --- a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/meta.yml +++ b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/meta.yml @@ -47,14 +47,13 @@ input: type: integer description: | Inputs with fewer than this reads will be filtered out of the "reads" output channel + output: - reads: type: file description: > - Extracted FASTQ files. | For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. | - - - + Extracted FASTQ files. | + For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. | For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz. pattern: "*.{fastq.gz}" - fastqc_html: @@ -96,6 +95,3 @@ output: authors: - "@drpatelh" - "@KamilMaliszArdigen" -maintainers: - - "@drpatelh" - - "@KamilMaliszArdigen" diff --git a/workflows/rnaseq.nf b/workflows/rnaseq.nf index 5827b753a..f8def2d10 100755 --- a/workflows/rnaseq.nf +++ b/workflows/rnaseq.nf @@ -40,15 +40,15 @@ if (!params.skip_alignment) { prepareToolIndices << params.aligner } if (!params.skip_pseudo_alignment && params.pseudo_aligner) { prepareToolIndices << params.pseudo_aligner } // Determine whether to filter the GTF or not -def filterGtf = +def filterGtf = (( // Condition 1: Alignment is required and aligner is set !params.skip_alignment && params.aligner - ) || + ) || ( // Condition 2: Pseudoalignment is required and pseudoaligner is set !params.skip_pseudo_alignment && params.pseudo_aligner - ) || + ) || ( // Condition 3: Transcript FASTA file is not provided !params.transcript_fasta @@ -774,14 +774,14 @@ workflow RNASEQ { PREPARE_GENOME.out.gene_bed, rseqc_modules ) - ch_bamstat_multiqc = BAM_RSEQC.out.ch_bamstat - ch_inferexperiment_multiqc = BAM_RSEQC.out.ch_inferexperiment - ch_innerdistance_multiqc = BAM_RSEQC.out.ch_innerdistance_freq - ch_junctionannotation_multiqc = BAM_RSEQC.out.ch_junctionannotation_log - ch_junctionsaturation_multiqc = BAM_RSEQC.out.ch_junctionsaturation_rscript - ch_readdistribution_multiqc = BAM_RSEQC.out.ch_readdistribution - ch_readduplication_multiqc = BAM_RSEQC.out.ch_readduplication_pos_xls - ch_tin_multiqc = BAM_RSEQC.out.ch_tin + ch_bamstat_multiqc = BAM_RSEQC.out.bamstat_txt + ch_inferexperiment_multiqc = BAM_RSEQC.out.inferexperiment_txt + ch_innerdistance_multiqc = BAM_RSEQC.out.innerdistance_freq + ch_junctionannotation_multiqc = BAM_RSEQC.out.junctionannotation_log + ch_junctionsaturation_multiqc = BAM_RSEQC.out.junctionsaturation_rscript + ch_readdistribution_multiqc = BAM_RSEQC.out.readdistribution_txt + ch_readduplication_multiqc = BAM_RSEQC.out.readduplication_pos_xls + ch_tin_multiqc = BAM_RSEQC.out.tin_txt ch_versions = ch_versions.mix(BAM_RSEQC.out.versions) ch_inferexperiment_multiqc @@ -816,7 +816,7 @@ workflow RNASEQ { // ch_pseudo_multiqc = Channel.empty() ch_pseudoaligner_pca_multiqc = Channel.empty() - ch_pseudoaligner_clustering_multiqc = Channel.empty() + ch_pseudoaligner_clustering_multiqc = Channel.empty() if (!params.skip_pseudo_alignment && params.pseudo_aligner) { if (params.pseudo_aligner == 'salmon') { @@ -851,7 +851,7 @@ workflow RNASEQ { ch_versions = ch_versions.mix(DESEQ2_QC_PSEUDO.out.versions) } } - + // // MODULE: Pipeline reporting // @@ -922,7 +922,7 @@ workflow.onComplete { if (params.email || params.email_on_fail) { NfcoreTemplate.email(workflow, params, summary_params, projectDir, log, multiqc_report, pass_mapped_reads, pass_trimmed_reads, pass_strand_check) } - + NfcoreTemplate.dump_parameters(workflow, params) NfcoreTemplate.summary(workflow, params, log, pass_mapped_reads, pass_trimmed_reads, pass_strand_check)