From c78108089c96508135b397a94da0d9f6dfc0878f Mon Sep 17 00:00:00 2001
From: Adam Talbot <12817534+adamrtalbot@users.noreply.github.com>
Date: Wed, 3 Jan 2024 14:14:22 +0000
Subject: [PATCH] Revert "Update FastQC and UMItools modules"
---
CHANGELOG.md | 15 -
modules.json | 64 +--
modules/nf-core/fastp/environment.yml | 7 -
modules/nf-core/fastp/main.nf | 8 +-
modules/nf-core/fastp/meta.yml | 4 +-
modules/nf-core/fastp/tests/main.nf.test | 485 ------------------
modules/nf-core/fastp/tests/main.nf.test.snap | 52 --
modules/nf-core/fastp/tests/nextflow.config | 6 -
modules/nf-core/fastp/tests/tags.yml | 2 -
modules/nf-core/fastqc/environment.yml | 7 -
modules/nf-core/fastqc/main.nf | 6 +-
modules/nf-core/fastqc/meta.yml | 5 -
modules/nf-core/fastqc/tests/main.nf.test | 73 +--
modules/nf-core/fastqc/tests/tags.yml | 2 -
.../picard/markduplicates/environment.yml | 7 -
modules/nf-core/picard/markduplicates/main.nf | 6 +-
.../nf-core/picard/markduplicates/meta.yml | 4 -
.../picard/markduplicates/tests/main.nf.test | 111 ----
.../markduplicates/tests/main.nf.test.snap | 44 --
.../markduplicates/tests/nextflow.config | 6 -
.../picard/markduplicates/tests/tags.yml | 2 -
modules/nf-core/rseqc/bamstat/environment.yml | 8 -
modules/nf-core/rseqc/bamstat/main.nf | 2 +-
modules/nf-core/rseqc/bamstat/meta.yml | 3 -
.../nf-core/rseqc/bamstat/tests/main.nf.test | 38 --
.../rseqc/bamstat/tests/main.nf.test.snap | 31 --
.../rseqc/bamstat/tests/nextflow.config | 5 -
modules/nf-core/rseqc/bamstat/tests/tags.yml | 2 -
.../rseqc/inferexperiment/environment.yml | 8 -
modules/nf-core/rseqc/inferexperiment/main.nf | 2 +-
.../nf-core/rseqc/inferexperiment/meta.yml | 4 -
.../rseqc/inferexperiment/tests/main.nf.test | 34 --
.../inferexperiment/tests/main.nf.test.snap | 31 --
.../inferexperiment/tests/nextflow.config | 5 -
.../rseqc/inferexperiment/tests/tags.yml | 2 -
.../rseqc/innerdistance/environment.yml | 8 -
modules/nf-core/rseqc/innerdistance/main.nf | 2 +-
modules/nf-core/rseqc/innerdistance/meta.yml | 4 -
.../rseqc/innerdistance/tests/main.nf.test | 41 --
.../innerdistance/tests/main.nf.test.snap | 68 ---
.../rseqc/innerdistance/tests/nextflow.config | 5 -
.../rseqc/innerdistance/tests/tags.yml | 2 -
.../rseqc/junctionannotation/environment.yml | 8 -
.../nf-core/rseqc/junctionannotation/main.nf | 4 +-
.../nf-core/rseqc/junctionannotation/meta.yml | 3 -
.../junctionannotation/tests/main.nf.test | 37 --
.../tests/main.nf.test.snap | 24 -
.../rseqc/junctionannotation/tests/tags.yml | 2 -
.../rseqc/junctionsaturation/environment.yml | 8 -
.../nf-core/rseqc/junctionsaturation/main.nf | 2 +-
.../nf-core/rseqc/junctionsaturation/meta.yml | 3 -
.../junctionsaturation/tests/main.nf.test | 36 --
.../tests/main.nf.test.snap | 30 --
.../rseqc/junctionsaturation/tests/tags.yml | 2 -
.../rseqc/readdistribution/environment.yml | 8 -
.../nf-core/rseqc/readdistribution/main.nf | 2 +-
.../nf-core/rseqc/readdistribution/meta.yml | 3 -
.../rseqc/readdistribution/tests/main.nf.test | 33 --
.../readdistribution/tests/main.nf.test.snap | 33 --
.../rseqc/readdistribution/tests/tags.yml | 2 -
.../rseqc/readduplication/environment.yml | 8 -
modules/nf-core/rseqc/readduplication/main.nf | 2 +-
.../nf-core/rseqc/readduplication/meta.yml | 5 -
.../rseqc/readduplication/tests/main.nf.test | 36 --
.../readduplication/tests/main.nf.test.snap | 58 ---
.../rseqc/readduplication/tests/tags.yml | 2 -
modules/nf-core/rseqc/tin/environment.yml | 8 -
modules/nf-core/rseqc/tin/main.nf | 2 +-
modules/nf-core/rseqc/tin/meta.yml | 2 -
modules/nf-core/rseqc/tin/tests/main.nf.test | 35 --
.../nf-core/rseqc/tin/tests/main.nf.test.snap | 47 --
modules/nf-core/rseqc/tin/tests/tags.yml | 2 -
.../nf-core/samtools/flagstat/environment.yml | 7 -
modules/nf-core/samtools/flagstat/main.nf | 6 +-
modules/nf-core/samtools/flagstat/meta.yml | 2 -
.../samtools/flagstat/tests/main.nf.test | 36 --
.../samtools/flagstat/tests/main.nf.test.snap | 16 -
.../nf-core/samtools/flagstat/tests/tags.yml | 2 -
.../nf-core/samtools/idxstats/environment.yml | 7 -
modules/nf-core/samtools/idxstats/main.nf | 6 +-
modules/nf-core/samtools/idxstats/meta.yml | 2 -
.../samtools/idxstats/tests/main.nf.test | 36 --
.../samtools/idxstats/tests/main.nf.test.snap | 16 -
.../nf-core/samtools/idxstats/tests/tags.yml | 2 -
.../nf-core/samtools/index/environment.yml | 7 -
modules/nf-core/samtools/index/main.nf | 6 +-
modules/nf-core/samtools/index/meta.yml | 4 -
.../samtools/index/tests/csi.nextflow.config | 7 -
.../nf-core/samtools/index/tests/main.nf.test | 87 ----
.../samtools/index/tests/main.nf.test.snap | 28 -
modules/nf-core/samtools/index/tests/tags.yml | 2 -
modules/nf-core/samtools/sort/environment.yml | 7 -
modules/nf-core/samtools/sort/main.nf | 6 +-
modules/nf-core/samtools/sort/meta.yml | 3 -
.../nf-core/samtools/sort/tests/main.nf.test | 73 ---
.../samtools/sort/tests/main.nf.test.snap | 48 --
.../samtools/sort/tests/nextflow.config | 7 -
modules/nf-core/samtools/sort/tests/tags.yml | 3 -
.../nf-core/samtools/stats/environment.yml | 7 -
modules/nf-core/samtools/stats/main.nf | 6 +-
modules/nf-core/samtools/stats/meta.yml | 4 -
.../nf-core/samtools/stats/tests/main.nf.test | 78 ---
.../samtools/stats/tests/main.nf.test.snap | 64 ---
modules/nf-core/samtools/stats/tests/tags.yml | 2 -
modules/nf-core/trimgalore/environment.yml | 7 -
modules/nf-core/trimgalore/main.nf | 2 +-
modules/nf-core/trimgalore/meta.yml | 4 -
modules/nf-core/trimgalore/tests/main.nf.test | 105 ----
.../trimgalore/tests/main.nf.test.snap | 148 ------
modules/nf-core/trimgalore/tests/tags.yml | 2 -
.../nf-core/umitools/dedup/environment.yml | 7 -
modules/nf-core/umitools/dedup/main.nf | 6 +-
modules/nf-core/umitools/dedup/meta.yml | 9 +-
.../nf-core/umitools/extract/environment.yml | 7 -
modules/nf-core/umitools/extract/main.nf | 6 +-
modules/nf-core/umitools/extract/meta.yml | 17 +-
.../umitools/extract/tests/main.nf.test | 35 --
.../umitools/extract/tests/main.nf.test.snap | 10 -
.../umitools/extract/tests/nextflow.config | 9 -
.../nf-core/umitools/extract/tests/tags.yml | 2 -
.../meta.yml | 4 +-
.../tests/main.nf.test | 51 --
.../tests/main.nf.test.snap | 41 --
.../tests/tags.yml | 2 -
.../bam_markduplicates_picard/meta.yml | 5 +-
subworkflows/nf-core/bam_rseqc/main.nf | 158 +++---
subworkflows/nf-core/bam_rseqc/meta.yml | 73 +--
.../nf-core/bam_rseqc/tests/main.nf.test | 96 ----
.../nf-core/bam_rseqc/tests/main.nf.test.snap | 151 ------
subworkflows/nf-core/bam_rseqc/tests/tags.yml | 2 -
.../nf-core/bam_sort_stats_samtools/meta.yml | 3 -
.../tests/main.nf.test | 78 ---
.../tests/main.nf.test.snap | 86 ----
.../bam_sort_stats_samtools/tests/tags.yml | 2 -
.../nf-core/bam_stats_samtools/meta.yml | 2 -
.../bam_stats_samtools/tests/main.nf.test | 102 ----
.../tests/main.nf.test.snap | 128 -----
.../nf-core/bam_stats_samtools/tests/tags.yml | 2 -
.../fastq_fastqc_umitools_fastp/meta.yml | 8 +-
.../tests/main.nf.test | 60 ---
.../tests/main.nf.test.snap | 81 ---
.../tests/tags.yml | 2 -
.../fastq_fastqc_umitools_trimgalore/meta.yml | 10 +-
workflows/rnaseq.nf | 28 +-
144 files changed, 205 insertions(+), 3601 deletions(-)
delete mode 100644 modules/nf-core/fastp/environment.yml
delete mode 100644 modules/nf-core/fastp/tests/main.nf.test
delete mode 100644 modules/nf-core/fastp/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/fastp/tests/nextflow.config
delete mode 100644 modules/nf-core/fastp/tests/tags.yml
delete mode 100644 modules/nf-core/fastqc/environment.yml
delete mode 100644 modules/nf-core/fastqc/tests/tags.yml
delete mode 100644 modules/nf-core/picard/markduplicates/environment.yml
delete mode 100644 modules/nf-core/picard/markduplicates/tests/main.nf.test
delete mode 100644 modules/nf-core/picard/markduplicates/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/picard/markduplicates/tests/nextflow.config
delete mode 100644 modules/nf-core/picard/markduplicates/tests/tags.yml
delete mode 100644 modules/nf-core/rseqc/bamstat/environment.yml
delete mode 100644 modules/nf-core/rseqc/bamstat/tests/main.nf.test
delete mode 100644 modules/nf-core/rseqc/bamstat/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/rseqc/bamstat/tests/nextflow.config
delete mode 100644 modules/nf-core/rseqc/bamstat/tests/tags.yml
delete mode 100644 modules/nf-core/rseqc/inferexperiment/environment.yml
delete mode 100644 modules/nf-core/rseqc/inferexperiment/tests/main.nf.test
delete mode 100644 modules/nf-core/rseqc/inferexperiment/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/rseqc/inferexperiment/tests/nextflow.config
delete mode 100644 modules/nf-core/rseqc/inferexperiment/tests/tags.yml
delete mode 100644 modules/nf-core/rseqc/innerdistance/environment.yml
delete mode 100644 modules/nf-core/rseqc/innerdistance/tests/main.nf.test
delete mode 100644 modules/nf-core/rseqc/innerdistance/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/rseqc/innerdistance/tests/nextflow.config
delete mode 100644 modules/nf-core/rseqc/innerdistance/tests/tags.yml
delete mode 100644 modules/nf-core/rseqc/junctionannotation/environment.yml
delete mode 100644 modules/nf-core/rseqc/junctionannotation/tests/main.nf.test
delete mode 100644 modules/nf-core/rseqc/junctionannotation/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/rseqc/junctionannotation/tests/tags.yml
delete mode 100644 modules/nf-core/rseqc/junctionsaturation/environment.yml
delete mode 100644 modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test
delete mode 100644 modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/rseqc/junctionsaturation/tests/tags.yml
delete mode 100644 modules/nf-core/rseqc/readdistribution/environment.yml
delete mode 100644 modules/nf-core/rseqc/readdistribution/tests/main.nf.test
delete mode 100644 modules/nf-core/rseqc/readdistribution/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/rseqc/readdistribution/tests/tags.yml
delete mode 100644 modules/nf-core/rseqc/readduplication/environment.yml
delete mode 100644 modules/nf-core/rseqc/readduplication/tests/main.nf.test
delete mode 100644 modules/nf-core/rseqc/readduplication/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/rseqc/readduplication/tests/tags.yml
delete mode 100644 modules/nf-core/rseqc/tin/environment.yml
delete mode 100644 modules/nf-core/rseqc/tin/tests/main.nf.test
delete mode 100644 modules/nf-core/rseqc/tin/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/rseqc/tin/tests/tags.yml
delete mode 100644 modules/nf-core/samtools/flagstat/environment.yml
delete mode 100644 modules/nf-core/samtools/flagstat/tests/main.nf.test
delete mode 100644 modules/nf-core/samtools/flagstat/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/samtools/flagstat/tests/tags.yml
delete mode 100644 modules/nf-core/samtools/idxstats/environment.yml
delete mode 100644 modules/nf-core/samtools/idxstats/tests/main.nf.test
delete mode 100644 modules/nf-core/samtools/idxstats/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/samtools/idxstats/tests/tags.yml
delete mode 100644 modules/nf-core/samtools/index/environment.yml
delete mode 100644 modules/nf-core/samtools/index/tests/csi.nextflow.config
delete mode 100644 modules/nf-core/samtools/index/tests/main.nf.test
delete mode 100644 modules/nf-core/samtools/index/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/samtools/index/tests/tags.yml
delete mode 100644 modules/nf-core/samtools/sort/environment.yml
delete mode 100644 modules/nf-core/samtools/sort/tests/main.nf.test
delete mode 100644 modules/nf-core/samtools/sort/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/samtools/sort/tests/nextflow.config
delete mode 100644 modules/nf-core/samtools/sort/tests/tags.yml
delete mode 100644 modules/nf-core/samtools/stats/environment.yml
delete mode 100644 modules/nf-core/samtools/stats/tests/main.nf.test
delete mode 100644 modules/nf-core/samtools/stats/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/samtools/stats/tests/tags.yml
delete mode 100644 modules/nf-core/trimgalore/environment.yml
delete mode 100644 modules/nf-core/trimgalore/tests/main.nf.test
delete mode 100644 modules/nf-core/trimgalore/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/trimgalore/tests/tags.yml
delete mode 100644 modules/nf-core/umitools/dedup/environment.yml
delete mode 100644 modules/nf-core/umitools/extract/environment.yml
delete mode 100644 modules/nf-core/umitools/extract/tests/main.nf.test
delete mode 100644 modules/nf-core/umitools/extract/tests/main.nf.test.snap
delete mode 100644 modules/nf-core/umitools/extract/tests/nextflow.config
delete mode 100644 modules/nf-core/umitools/extract/tests/tags.yml
delete mode 100644 subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test
delete mode 100644 subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap
delete mode 100644 subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml
delete mode 100644 subworkflows/nf-core/bam_rseqc/tests/main.nf.test
delete mode 100644 subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap
delete mode 100644 subworkflows/nf-core/bam_rseqc/tests/tags.yml
delete mode 100644 subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test
delete mode 100644 subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap
delete mode 100644 subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml
delete mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test
delete mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap
delete mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/tags.yml
delete mode 100644 subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
delete mode 100644 subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
delete mode 100644 subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml
diff --git a/CHANGELOG.md b/CHANGELOG.md
index ba6701c2f..d6544378a 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -10,26 +10,11 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
### Enhancements & fixes
- [PR #1135](https://github.com/nf-core/rnaseq/pull/1135) - Update [action-tower-launch](https://github.com/marketplace/actions/action-tower-launch) to v2 which supports more variable handling.
-- [PR #1138](https://github.com/nf-core/rnaseq/pull/1138) - Updates FASTQC and UMITOOLS modules and their dependencies which have had their version string extraction commands updated ([#1103](https://github.com/nf-core/rnaseq/issues/1103))
-- Update Rseqc and Fastp modules to print STDERR to screen and file.
### Software dependencies
-| Dependency | Old version | New version |
-| ---------- | ----------- | ----------- |
-| `picard` | 3.0.0 | 3.1.1 |
-| `samtools` | 1.17 | 1.18 |
-
-> **NB:** Dependency has been **updated** if both old and new version information is present.
->
-> **NB:** Dependency has been **added** if just the new version information is present.
->
-> **NB:** Dependency has been **removed** if new version information isn't present.
-
### Modules / Subworkflows
-- BAM_RSEQC subworkflow updated with new channel names.
-
## [[3.13.2](https://github.com/nf-core/rnaseq/releases/tag/3.13.2)] - 2023-11-21
### Credits
diff --git a/modules.json b/modules.json
index 7cc90d6d3..e78ca060c 100644
--- a/modules.json
+++ b/modules.json
@@ -27,12 +27,12 @@
},
"fastp": {
"branch": "master",
- "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde",
- "installed_by": ["modules", "fastq_fastqc_umitools_fastp"]
+ "git_sha": "d497a4868ace3302016ea8ed4b395072d5e833cd",
+ "installed_by": ["fastq_fastqc_umitools_fastp", "modules"]
},
"fastqc": {
"branch": "master",
- "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53",
+ "git_sha": "102cc9b709a6da9f7cee2373563ab1464fca9c0a",
"installed_by": ["fastq_fastqc_umitools_trimgalore", "fastq_fastqc_umitools_fastp"]
},
"fq/subsample": {
@@ -77,7 +77,7 @@
},
"picard/markduplicates": {
"branch": "master",
- "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447",
+ "git_sha": "2ee934606f1fdf7fc1cb05d6e8abc13bec8ab448",
"installed_by": ["bam_markduplicates_picard"]
},
"preseq/lcextrap": {
@@ -102,42 +102,42 @@
},
"rseqc/bamstat": {
"branch": "master",
- "git_sha": "65acf692457e8c466e104c6a3e5ac392e98fe688",
+ "git_sha": "911696ea0b62df80e900ef244d7867d177971f73",
"installed_by": ["bam_rseqc"]
},
"rseqc/inferexperiment": {
"branch": "master",
- "git_sha": "f2a3328fde9a2b4185285057f8d3727f39dd2aef",
+ "git_sha": "911696ea0b62df80e900ef244d7867d177971f73",
"installed_by": ["bam_rseqc"]
},
"rseqc/innerdistance": {
"branch": "master",
- "git_sha": "3e839096a1be5da4f68d1de1066e4d0bc13f5d6d",
+ "git_sha": "911696ea0b62df80e900ef244d7867d177971f73",
"installed_by": ["bam_rseqc"]
},
"rseqc/junctionannotation": {
"branch": "master",
- "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde",
+ "git_sha": "911696ea0b62df80e900ef244d7867d177971f73",
"installed_by": ["bam_rseqc"]
},
"rseqc/junctionsaturation": {
"branch": "master",
- "git_sha": "9dfed3180f80f599c91daf5112d73a5e59367c24",
+ "git_sha": "911696ea0b62df80e900ef244d7867d177971f73",
"installed_by": ["bam_rseqc"]
},
"rseqc/readdistribution": {
"branch": "master",
- "git_sha": "7bb1b295a359bcbf0a0ea03d19d40a00916805ee",
+ "git_sha": "911696ea0b62df80e900ef244d7867d177971f73",
"installed_by": ["bam_rseqc"]
},
"rseqc/readduplication": {
"branch": "master",
- "git_sha": "db02573fdd89210d09ce9e2ac06857902a7fffec",
+ "git_sha": "911696ea0b62df80e900ef244d7867d177971f73",
"installed_by": ["bam_rseqc"]
},
"rseqc/tin": {
"branch": "master",
- "git_sha": "4acfdd20843d5b6d63f9181721a6856447cb7bec",
+ "git_sha": "911696ea0b62df80e900ef244d7867d177971f73",
"installed_by": ["bam_rseqc"]
},
"salmon/index": {
@@ -152,31 +152,31 @@
},
"samtools/flagstat": {
"branch": "master",
- "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
+ "git_sha": "570ec5bcfe19c49e16c9ca35a7a116563af6cc1c",
"installed_by": ["bam_stats_samtools"]
},
"samtools/idxstats": {
"branch": "master",
- "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
+ "git_sha": "e662ab16e0c11f1e62983e21de9871f59371a639",
"installed_by": ["bam_stats_samtools"]
},
"samtools/index": {
"branch": "master",
- "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
+ "git_sha": "911696ea0b62df80e900ef244d7867d177971f73",
"installed_by": [
- "bam_dedup_stats_samtools_umitools",
"bam_markduplicates_picard",
- "bam_sort_stats_samtools"
+ "bam_sort_stats_samtools",
+ "bam_dedup_stats_samtools_umitools"
]
},
"samtools/sort": {
"branch": "master",
- "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
+ "git_sha": "a0f7be95788366c1923171e358da7d049eb440f9",
"installed_by": ["bam_sort_stats_samtools"]
},
"samtools/stats": {
"branch": "master",
- "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
+ "git_sha": "735e1e04e7e01751d2d6e97055bbdb6f70683cc1",
"installed_by": ["bam_stats_samtools"]
},
"sortmerna": {
@@ -206,7 +206,7 @@
},
"trimgalore": {
"branch": "master",
- "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
+ "git_sha": "911696ea0b62df80e900ef244d7867d177971f73",
"installed_by": ["fastq_fastqc_umitools_trimgalore"]
},
"ucsc/bedclip": {
@@ -221,13 +221,13 @@
},
"umitools/dedup": {
"branch": "master",
- "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53",
+ "git_sha": "7297204bf49273300a3dbfa4b7a4027c8683f1bd",
"installed_by": ["bam_dedup_stats_samtools_umitools"]
},
"umitools/extract": {
"branch": "master",
- "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53",
- "installed_by": ["fastq_fastqc_umitools_trimgalore", "fastq_fastqc_umitools_fastp"]
+ "git_sha": "911696ea0b62df80e900ef244d7867d177971f73",
+ "installed_by": ["fastq_fastqc_umitools_fastp", "fastq_fastqc_umitools_trimgalore"]
},
"untar": {
"branch": "master",
@@ -240,31 +240,31 @@
"nf-core": {
"bam_dedup_stats_samtools_umitools": {
"branch": "master",
- "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
+ "git_sha": "dedc0e31087f3306101c38835d051bf49789445a",
"installed_by": ["subworkflows"]
},
"bam_markduplicates_picard": {
"branch": "master",
- "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f",
+ "git_sha": "dedc0e31087f3306101c38835d051bf49789445a",
"installed_by": ["subworkflows"]
},
"bam_rseqc": {
"branch": "master",
- "git_sha": "92793c143c93acd9129f15f35f25d3aab2b23c0e",
+ "git_sha": "a9784afdd5dcda23b84e64db75dc591065d64653",
"installed_by": ["subworkflows"]
},
"bam_sort_stats_samtools": {
"branch": "master",
- "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
+ "git_sha": "dedc0e31087f3306101c38835d051bf49789445a",
"installed_by": ["fastq_align_hisat2"]
},
"bam_stats_samtools": {
"branch": "master",
- "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
+ "git_sha": "dedc0e31087f3306101c38835d051bf49789445a",
"installed_by": [
- "bam_dedup_stats_samtools_umitools",
+ "bam_sort_stats_samtools",
"bam_markduplicates_picard",
- "bam_sort_stats_samtools"
+ "bam_dedup_stats_samtools_umitools"
]
},
"bedgraph_bedclip_bedgraphtobigwig": {
@@ -279,12 +279,12 @@
},
"fastq_fastqc_umitools_fastp": {
"branch": "master",
- "git_sha": "3e8b0c1144ccf60b7848efbdc2be285ff20b49ee",
+ "git_sha": "dedc0e31087f3306101c38835d051bf49789445a",
"installed_by": ["subworkflows"]
},
"fastq_fastqc_umitools_trimgalore": {
"branch": "master",
- "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f",
+ "git_sha": "dedc0e31087f3306101c38835d051bf49789445a",
"installed_by": ["subworkflows"]
},
"fastq_subsample_fq_salmon": {
diff --git a/modules/nf-core/fastp/environment.yml b/modules/nf-core/fastp/environment.yml
deleted file mode 100644
index 70389e664..000000000
--- a/modules/nf-core/fastp/environment.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-name: fastp
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::fastp=0.23.4
diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf
index 5fac3c1ad..831b7f128 100644
--- a/modules/nf-core/fastp/main.nf
+++ b/modules/nf-core/fastp/main.nf
@@ -2,7 +2,7 @@ process FASTP {
tag "$meta.id"
label 'process_medium'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::fastp=0.23.4"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/fastp:0.23.4--h5f740d0_0' :
'biocontainers/fastp:0.23.4--h5f740d0_0' }"
@@ -45,7 +45,7 @@ process FASTP {
$adapter_list \\
$fail_fastq \\
$args \\
- 2> >(tee ${prefix}.fastp.log >&2) \\
+ 2> ${prefix}.fastp.log \\
| gzip -c > ${prefix}.fastp.fastq.gz
cat <<-END_VERSIONS > versions.yml
@@ -66,7 +66,7 @@ process FASTP {
$adapter_list \\
$fail_fastq \\
$args \\
- 2> >(tee ${prefix}.fastp.log >&2)
+ 2> ${prefix}.fastp.log
cat <<-END_VERSIONS > versions.yml
"${task.process}":
@@ -91,7 +91,7 @@ process FASTP {
--thread $task.cpus \\
--detect_adapter_for_pe \\
$args \\
- 2> >(tee ${prefix}.fastp.log >&2)
+ 2> ${prefix}.fastp.log
cat <<-END_VERSIONS > versions.yml
"${task.process}":
diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml
index c22a16abd..197ea7ca6 100644
--- a/modules/nf-core/fastp/meta.yml
+++ b/modules/nf-core/fastp/meta.yml
@@ -33,6 +33,7 @@ input:
- save_merged:
type: boolean
description: Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz`
+
output:
- meta:
type: map
@@ -70,6 +71,3 @@ output:
authors:
- "@drpatelh"
- "@kevinmenden"
-maintainers:
- - "@drpatelh"
- - "@kevinmenden"
diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test
deleted file mode 100644
index f610b735e..000000000
--- a/modules/nf-core/fastp/tests/main.nf.test
+++ /dev/null
@@ -1,485 +0,0 @@
-nextflow_process {
-
- name "Test Process FASTP"
- script "../main.nf"
- process "FASTP"
- tag "modules"
- tag "modules_nfcore"
- tag "fastp"
-
- test("test_fastp_single_end") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = false
-
- input[0] = [
- [ id:'test', single_end:true ],
- [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ]
- ]
-
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ "Q20 bases:
12.922000 K (92.984097%)",
- "single end (151 cycles)" ]
- def log_text = [ "Q20 bases: 12922(92.9841%)",
- "reads passed filter: 99" ]
- def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { assert snapshot(process.out.json).match("test_fastp_single_end_json") },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- { assert snapshot(process.out.versions).match("versions") }
- )
- }
- }
-
- test("test_fastp_paired_end") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = false
-
- input[0] = [
- [ id:'test', single_end:false ], // meta map
- [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
- ]
-
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ "Q20 bases: | 25.719000 K (93.033098%)",
- "The input has little adapter percentage (~0.000000%), probably it's trimmed before."]
- def log_text = [ "No adapter detected for read1",
- "Q30 bases: 12281(88.3716%)"]
- def json_text = ['"passed_filter_reads": 198']
- def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
- }
- },
- { read2_lines.each { read2_line ->
- { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { json_text.each { json_part ->
- { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
- }
- },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- { assert snapshot(process.out.versions).match("versions") }
- )
- }
- }
-
- test("fastp test_fastp_interleaved") {
- config './nextflow.config'
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = false
-
- input[0] = [ [ id:'test', single_end:true ], // meta map
- [ file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) ]
- ]
-
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ "Q20 bases: | 25.719000 K (93.033098%)",
- "paired end (151 cycles + 151 cycles)"]
- def log_text = [ "Q20 bases: 12922(92.9841%)",
- "reads passed filter: 198"]
- def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- { assert snapshot(process.out.versions).match("versions") }
- )
- }
- }
-
- test("test_fastp_single_end_trim_fail") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = true
- save_merged = false
-
- input[0] = [ [ id:'test', single_end:true ], // meta map
- [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ]
- ]
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ "Q20 bases: | 12.922000 K (92.984097%)",
- "single end (151 cycles)"]
- def log_text = [ "Q20 bases: 12922(92.9841%)",
- "reads passed filter: 99" ]
- def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
- }
- },
- { failed_read_lines.each { failed_read_line ->
- { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- { assert snapshot(process.out.versions).match("versions") }
- )
- }
- }
-
- test("test_fastp_paired_end_trim_fail") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = true
- save_merged = false
-
- input[0] = [
- [ id:'test', single_end:false ], // meta map
- [
- file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
- ]
- ]
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ "Q20 bases: | 25.719000 K (93.033098%)",
- "The input has little adapter percentage (~0.000000%), probably it's trimmed before."]
- def log_text = [ "No adapter detected for read1",
- "Q30 bases: 12281(88.3716%)"]
- def json_text = ['"passed_filter_reads": 198']
- def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
- }
- },
- { read2_lines.each { read2_line ->
- { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
- }
- },
- { failed_read2_lines.each { failed_read2_line ->
- { assert path(process.out.reads_fail.get(0).get(1).get(1)).linesGzip.contains(failed_read2_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { json_text.each { json_part ->
- { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
- }
- },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- { assert snapshot(process.out.versions).match("versions") }
- )
- }
- }
-
- test("test_fastp_paired_end_merged") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = true
-
- input[0] = [ [ id:'test', single_end:false ], // meta map
- [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
- ]
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ ""]
- def log_text = [ "Merged and filtered:",
- "total reads: 75",
- "total bases: 13683"]
- def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683']
- def read1_lines = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1",
- "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC",
- "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE
- { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
- }
- },
- { read2_lines.each { read2_line ->
- { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
- }
- },
- { read_merged_lines.each { read_merged_line ->
- { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { json_text.each { json_part ->
- { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
- }
- },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- { assert snapshot(process.out.versions).match("versions") }
- )
- }
- }
-
- test("test_fastp_paired_end_merged_adapterlist") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = file("https://github.com/nf-core/test-datasets/raw/modules/data/delete_me/fastp/adapters.fasta", checkIfExists: true)
- save_trimmed_fail = false
- save_merged = true
-
- input[0] = [ [ id:'test', single_end:false ], // meta map
- [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
- ]
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ ""]
- def log_text = [ "Merged and filtered:",
- "total reads: 75",
- "total bases: 13683"]
- def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"]
- def read1_lines = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1",
- "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC",
- "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE
- { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
- }
- },
- { read2_lines.each { read2_line ->
- { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
- }
- },
- { read_merged_lines.each { read_merged_line ->
- { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { json_text.each { json_part ->
- { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
- }
- },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- { assert snapshot(process.out.versions).match("versions") }
- )
- }
- }
-}
diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap
deleted file mode 100644
index 0fa68c7d7..000000000
--- a/modules/nf-core/fastp/tests/main.nf.test.snap
+++ /dev/null
@@ -1,52 +0,0 @@
-{
- "fastp test_fastp_interleaved_json": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastp.json:md5,168f516f7bd4b7b6c32da7cba87299a4"
- ]
- ]
- ],
- "timestamp": "2023-10-17T11:04:45.794175881"
- },
- "test_fastp_single_end_json": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc"
- ]
- ]
- ],
- "timestamp": "2023-10-17T11:04:10.566343705"
- },
- "versions": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "timestamp": "2023-10-17T11:04:10.582076024"
- },
- "test_fastp_single_end_trim_fail_json": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5"
- ]
- ]
- ],
- "timestamp": "2023-10-17T11:05:00.379878948"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/fastp/tests/nextflow.config b/modules/nf-core/fastp/tests/nextflow.config
deleted file mode 100644
index 0f7849ad9..000000000
--- a/modules/nf-core/fastp/tests/nextflow.config
+++ /dev/null
@@ -1,6 +0,0 @@
-process {
-
- withName: FASTP {
- ext.args = "--interleaved_in"
- }
-}
diff --git a/modules/nf-core/fastp/tests/tags.yml b/modules/nf-core/fastp/tests/tags.yml
deleted file mode 100644
index c1afcce75..000000000
--- a/modules/nf-core/fastp/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-fastp:
- - modules/nf-core/fastp/**
diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml
deleted file mode 100644
index 1787b38a9..000000000
--- a/modules/nf-core/fastqc/environment.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-name: fastqc
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::fastqc=0.12.1
diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf
index 9e19a74c5..67209f793 100644
--- a/modules/nf-core/fastqc/main.nf
+++ b/modules/nf-core/fastqc/main.nf
@@ -2,7 +2,7 @@ process FASTQC {
tag "$meta.id"
label 'process_medium'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::fastqc=0.12.1"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' :
'biocontainers/fastqc:0.12.1--hdfd78af_0' }"
@@ -37,7 +37,7 @@ process FASTQC {
cat <<-END_VERSIONS > versions.yml
"${task.process}":
- fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' )
+ fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" )
END_VERSIONS
"""
@@ -49,7 +49,7 @@ process FASTQC {
cat <<-END_VERSIONS > versions.yml
"${task.process}":
- fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' )
+ fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" )
END_VERSIONS
"""
}
diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml
index ee5507e06..4da5bb5a0 100644
--- a/modules/nf-core/fastqc/meta.yml
+++ b/modules/nf-core/fastqc/meta.yml
@@ -50,8 +50,3 @@ authors:
- "@grst"
- "@ewels"
- "@FelixKrueger"
-maintainers:
- - "@drpatelh"
- - "@grst"
- - "@ewels"
- - "@FelixKrueger"
diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test
index b9e8f926e..badb67161 100644
--- a/modules/nf-core/fastqc/tests/main.nf.test
+++ b/modules/nf-core/fastqc/tests/main.nf.test
@@ -1,11 +1,10 @@
nextflow_process {
name "Test Process FASTQC"
- script "../main.nf"
+ script "modules/nf-core/fastqc/main.nf"
process "FASTQC"
- tag "modules"
- tag "modules_nfcore"
tag "fastqc"
+ tag "modules_nfcore"
test("Single-Read") {
@@ -38,72 +37,4 @@ nextflow_process {
)
}
}
-// TODO
-// //
-// // Test with paired-end data
-// //
-// workflow test_fastqc_paired_end {
-// input = [
-// [id: 'test', single_end: false], // meta map
-// [
-// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
-// file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
-// ]
-// ]
-
-// FASTQC ( input )
-// }
-
-// //
-// // Test with interleaved data
-// //
-// workflow test_fastqc_interleaved {
-// input = [
-// [id: 'test', single_end: false], // meta map
-// file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true)
-// ]
-
-// FASTQC ( input )
-// }
-
-// //
-// // Test with bam data
-// //
-// workflow test_fastqc_bam {
-// input = [
-// [id: 'test', single_end: false], // meta map
-// file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
-// ]
-
-// FASTQC ( input )
-// }
-
-// //
-// // Test with multiple samples
-// //
-// workflow test_fastqc_multiple {
-// input = [
-// [id: 'test', single_end: false], // meta map
-// [
-// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
-// file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true),
-// file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true),
-// file(params.test_data['sarscov2']['illumina']['test2_2_fastq_gz'], checkIfExists: true)
-// ]
-// ]
-
-// FASTQC ( input )
-// }
-
-// //
-// // Test with custom prefix
-// //
-// workflow test_fastqc_custom_prefix {
-// input = [
-// [ id:'mysample', single_end:true ], // meta map
-// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
-// ]
-
-// FASTQC ( input )
-// }
}
diff --git a/modules/nf-core/fastqc/tests/tags.yml b/modules/nf-core/fastqc/tests/tags.yml
deleted file mode 100644
index 7834294ba..000000000
--- a/modules/nf-core/fastqc/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-fastqc:
- - modules/nf-core/fastqc/**
diff --git a/modules/nf-core/picard/markduplicates/environment.yml b/modules/nf-core/picard/markduplicates/environment.yml
deleted file mode 100644
index 58b795f54..000000000
--- a/modules/nf-core/picard/markduplicates/environment.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-name: picard_markduplicates
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::picard=3.1.1
diff --git a/modules/nf-core/picard/markduplicates/main.nf b/modules/nf-core/picard/markduplicates/main.nf
index 80930cc41..ebfa0864d 100644
--- a/modules/nf-core/picard/markduplicates/main.nf
+++ b/modules/nf-core/picard/markduplicates/main.nf
@@ -2,10 +2,10 @@ process PICARD_MARKDUPLICATES {
tag "$meta.id"
label 'process_medium'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::picard=3.0.0"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/picard:3.1.1--hdfd78af_0' :
- 'biocontainers/picard:3.1.1--hdfd78af_0' }"
+ 'https://depot.galaxyproject.org/singularity/picard:3.0.0--hdfd78af_1' :
+ 'biocontainers/picard:3.0.0--hdfd78af_1' }"
input:
tuple val(meta), path(bam)
diff --git a/modules/nf-core/picard/markduplicates/meta.yml b/modules/nf-core/picard/markduplicates/meta.yml
index 1ab90c075..f7693d2f0 100644
--- a/modules/nf-core/picard/markduplicates/meta.yml
+++ b/modules/nf-core/picard/markduplicates/meta.yml
@@ -69,7 +69,3 @@ authors:
- "@drpatelh"
- "@projectoriented"
- "@ramprasadn"
-maintainers:
- - "@drpatelh"
- - "@projectoriented"
- - "@ramprasadn"
diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test b/modules/nf-core/picard/markduplicates/tests/main.nf.test
deleted file mode 100644
index b2bba094f..000000000
--- a/modules/nf-core/picard/markduplicates/tests/main.nf.test
+++ /dev/null
@@ -1,111 +0,0 @@
-nextflow_process {
-
- name "Test Process PICARD_MARKDUPLICATES"
- script "../main.nf"
- process "PICARD_MARKDUPLICATES"
- config "./nextflow.config"
- tag "modules"
- tag "modules_nfcore"
- tag "picard"
- tag "picard/markduplicates"
-
- test("sarscov2 - bam, fasta, fai - sorted bam") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test', single_end:false ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
- ]
- input[1] = [
- [ id:'genome' ],
- file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
- ]
- input[2] = [
- [ id:'genome' ],
- file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(
- file(process.out.bam[0][1]).name,
- path(process.out.metrics.get(0).get(1)).readLines()[0..2],
- process.out.versions
- ).match() }
- )
- }
- }
-
- test("sarscov2 - bam, fasta, fai - unsorted bam") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test', single_end:false ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true)
- ]
- input[1] = [
- [ id:'genome' ],
- file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
- ]
- input[2] = [
- [ id:'genome' ],
- file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(
- file(process.out.bam[0][1]).name,
- path(process.out.metrics.get(0).get(1)).readLines()[0..2],
- process.out.versions
- ).match() }
- )
- }
- }
-
- test("homo_sapiens - cram, fasta, fai") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test', single_end:false ], // meta map
- file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true)
- ]
- input[1] = [
- [ id:'genome' ],
- file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
- ]
- input[2] = [
- [ id:'genome' ],
- file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(
- file(process.out.bam[0][1]).name,
- path(process.out.metrics.get(0).get(1)).readLines()[0..2],
- process.out.versions
- ).match() }
- )
- }
- }
-
-}
diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap
deleted file mode 100644
index cd788a4d6..000000000
--- a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap
+++ /dev/null
@@ -1,44 +0,0 @@
-{
- "sarscov2 - bam, fasta, fai - unsorted bam": {
- "content": [
- "test.marked.bam",
- [
- "## htsjdk.samtools.metrics.StringHeader",
- "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
- "## htsjdk.samtools.metrics.StringHeader"
- ],
- [
- "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
- ]
- ],
- "timestamp": "2023-11-28T10:50:37.735339781"
- },
- "homo_sapiens - cram, fasta, fai": {
- "content": [
- "test.marked.bam",
- [
- "## htsjdk.samtools.metrics.StringHeader",
- "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
- "## htsjdk.samtools.metrics.StringHeader"
- ],
- [
- "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
- ]
- ],
- "timestamp": "2023-11-28T10:50:48.897954543"
- },
- "sarscov2 - bam, fasta, fai - sorted bam": {
- "content": [
- "test.marked.bam",
- [
- "## htsjdk.samtools.metrics.StringHeader",
- "# MarkDuplicates --INPUT test.paired_end.sorted.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
- "## htsjdk.samtools.metrics.StringHeader"
- ],
- [
- "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
- ]
- ],
- "timestamp": "2023-11-28T10:50:26.591387512"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/picard/markduplicates/tests/nextflow.config b/modules/nf-core/picard/markduplicates/tests/nextflow.config
deleted file mode 100644
index 02818dd6e..000000000
--- a/modules/nf-core/picard/markduplicates/tests/nextflow.config
+++ /dev/null
@@ -1,6 +0,0 @@
-process {
- withName: PICARD_MARKDUPLICATES {
- ext.prefix = { "${meta.id}.marked" }
- ext.args = '--ASSUME_SORT_ORDER queryname'
- }
-}
diff --git a/modules/nf-core/picard/markduplicates/tests/tags.yml b/modules/nf-core/picard/markduplicates/tests/tags.yml
deleted file mode 100644
index 4f213d620..000000000
--- a/modules/nf-core/picard/markduplicates/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-picard/markduplicates:
- - modules/nf-core/picard/markduplicates/**
diff --git a/modules/nf-core/rseqc/bamstat/environment.yml b/modules/nf-core/rseqc/bamstat/environment.yml
deleted file mode 100644
index bf0bf0829..000000000
--- a/modules/nf-core/rseqc/bamstat/environment.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-name: rseqc_bamstat
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::rseqc=3.0.1
- - conda-forge::r-base>=3.5
diff --git a/modules/nf-core/rseqc/bamstat/main.nf b/modules/nf-core/rseqc/bamstat/main.nf
index 33e6959e7..04c1eefd0 100644
--- a/modules/nf-core/rseqc/bamstat/main.nf
+++ b/modules/nf-core/rseqc/bamstat/main.nf
@@ -2,7 +2,7 @@ process RSEQC_BAMSTAT {
tag "$meta.id"
label 'process_medium'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' :
'biocontainers/rseqc:3.0.1--py37h516909a_1' }"
diff --git a/modules/nf-core/rseqc/bamstat/meta.yml b/modules/nf-core/rseqc/bamstat/meta.yml
index 72745310c..2d7fa7996 100644
--- a/modules/nf-core/rseqc/bamstat/meta.yml
+++ b/modules/nf-core/rseqc/bamstat/meta.yml
@@ -35,6 +35,3 @@ output:
authors:
- "@drpatelh"
- "@kevinmenden"
-maintainers:
- - "@drpatelh"
- - "@kevinmenden"
diff --git a/modules/nf-core/rseqc/bamstat/tests/main.nf.test b/modules/nf-core/rseqc/bamstat/tests/main.nf.test
deleted file mode 100644
index 1facabea0..000000000
--- a/modules/nf-core/rseqc/bamstat/tests/main.nf.test
+++ /dev/null
@@ -1,38 +0,0 @@
-nextflow_process {
-
- name "Test Process RSEQC_BAMSTAT"
- script "../main.nf"
- process "RSEQC_BAMSTAT"
-
- tag "modules"
- tag "modules_nfcore"
- tag "rseqc"
- tag "rseqc/bamstat"
-
- config "./nextflow.config"
-
- test("sarscov2 - [meta] - bam") {
-
- when {
- params {
- // define parameters here. Example:
- // outdir = "tests/results"
- }
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assert process.success
- assert snapshot(process.out).match()
- }
-
- }
-
-}
diff --git a/modules/nf-core/rseqc/bamstat/tests/main.nf.test.snap b/modules/nf-core/rseqc/bamstat/tests/main.nf.test.snap
deleted file mode 100644
index b3cc3f55f..000000000
--- a/modules/nf-core/rseqc/bamstat/tests/main.nf.test.snap
+++ /dev/null
@@ -1,31 +0,0 @@
-{
- "sarscov2 - [meta] - bam": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "test.bam_stat.txt:md5,2675857864c1d1139b2a19d25dc36b09"
- ]
- ],
- "1": [
- "versions.yml:md5,300e8a9b6f8213d3621e53af09a9c728"
- ],
- "txt": [
- [
- {
- "id": "test"
- },
- "test.bam_stat.txt:md5,2675857864c1d1139b2a19d25dc36b09"
- ]
- ],
- "versions": [
- "versions.yml:md5,300e8a9b6f8213d3621e53af09a9c728"
- ]
- }
- ],
- "timestamp": "2023-11-23T11:26:51.281041171"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/rseqc/bamstat/tests/nextflow.config b/modules/nf-core/rseqc/bamstat/tests/nextflow.config
deleted file mode 100644
index 8730f1c4b..000000000
--- a/modules/nf-core/rseqc/bamstat/tests/nextflow.config
+++ /dev/null
@@ -1,5 +0,0 @@
-process {
-
- publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
-
-}
diff --git a/modules/nf-core/rseqc/bamstat/tests/tags.yml b/modules/nf-core/rseqc/bamstat/tests/tags.yml
deleted file mode 100644
index ed9a41fa9..000000000
--- a/modules/nf-core/rseqc/bamstat/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-rseqc/bamstat:
- - modules/nf-core/rseqc/bamstat/**
diff --git a/modules/nf-core/rseqc/inferexperiment/environment.yml b/modules/nf-core/rseqc/inferexperiment/environment.yml
deleted file mode 100644
index 1d3936f4e..000000000
--- a/modules/nf-core/rseqc/inferexperiment/environment.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-name: rseqc_inferexperiment
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::rseqc=3.0.1
- - conda-forge::r-base>=3.5
diff --git a/modules/nf-core/rseqc/inferexperiment/main.nf b/modules/nf-core/rseqc/inferexperiment/main.nf
index db6163387..5f9f4b111 100644
--- a/modules/nf-core/rseqc/inferexperiment/main.nf
+++ b/modules/nf-core/rseqc/inferexperiment/main.nf
@@ -2,7 +2,7 @@ process RSEQC_INFEREXPERIMENT {
tag "$meta.id"
label 'process_medium'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' :
'biocontainers/rseqc:3.0.1--py37h516909a_1' }"
diff --git a/modules/nf-core/rseqc/inferexperiment/meta.yml b/modules/nf-core/rseqc/inferexperiment/meta.yml
index d9b9ff63e..b4162059d 100644
--- a/modules/nf-core/rseqc/inferexperiment/meta.yml
+++ b/modules/nf-core/rseqc/inferexperiment/meta.yml
@@ -2,7 +2,6 @@ name: rseqc_inferexperiment
description: Infer strandedness from sequencing reads
keywords:
- rnaseq
- - strandedness
- experiment
tools:
- rseqc:
@@ -39,6 +38,3 @@ output:
authors:
- "@drpatelh"
- "@kevinmenden"
-maintainers:
- - "@drpatelh"
- - "@kevinmenden"
diff --git a/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test b/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test
deleted file mode 100644
index 97cd2cb9a..000000000
--- a/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test
+++ /dev/null
@@ -1,34 +0,0 @@
-nextflow_process {
-
- name "Test Process RSEQC_INFEREXPERIMENT"
- script "../main.nf"
- process "RSEQC_INFEREXPERIMENT"
- config "./nextflow.config"
-
- tag "modules"
- tag "modules_nfcore"
- tag "rseqc"
- tag "rseqc/inferexperiment"
-
- test("sarscov2 - [[meta] - bam] - bed") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
- ]
- input[1] = file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true)
- """
- }
- }
-
- then {
- assert process.success
- assert snapshot(process.out).match()
- }
-
- }
-
-}
diff --git a/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test.snap b/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test.snap
deleted file mode 100644
index ca4faba2d..000000000
--- a/modules/nf-core/rseqc/inferexperiment/tests/main.nf.test.snap
+++ /dev/null
@@ -1,31 +0,0 @@
-{
- "sarscov2 - [[meta] - bam] - bed": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "test.infer_experiment.txt:md5,f9d0bfc239df637cd8aeda40ade3c59a"
- ]
- ],
- "1": [
- "versions.yml:md5,c0d7ecdb2e1fbf7a2ba0c28dae49e428"
- ],
- "txt": [
- [
- {
- "id": "test"
- },
- "test.infer_experiment.txt:md5,f9d0bfc239df637cd8aeda40ade3c59a"
- ]
- ],
- "versions": [
- "versions.yml:md5,c0d7ecdb2e1fbf7a2ba0c28dae49e428"
- ]
- }
- ],
- "timestamp": "2023-11-23T16:21:55.713158354"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/rseqc/inferexperiment/tests/nextflow.config b/modules/nf-core/rseqc/inferexperiment/tests/nextflow.config
deleted file mode 100644
index 8730f1c4b..000000000
--- a/modules/nf-core/rseqc/inferexperiment/tests/nextflow.config
+++ /dev/null
@@ -1,5 +0,0 @@
-process {
-
- publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
-
-}
diff --git a/modules/nf-core/rseqc/inferexperiment/tests/tags.yml b/modules/nf-core/rseqc/inferexperiment/tests/tags.yml
deleted file mode 100644
index f9ba7e26a..000000000
--- a/modules/nf-core/rseqc/inferexperiment/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-rseqc/inferexperiment:
- - modules/nf-core/rseqc/inferexperiment/**
diff --git a/modules/nf-core/rseqc/innerdistance/environment.yml b/modules/nf-core/rseqc/innerdistance/environment.yml
deleted file mode 100644
index bb61cce24..000000000
--- a/modules/nf-core/rseqc/innerdistance/environment.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-name: rseqc_innerdistance
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::rseqc=3.0.1
- - conda-forge::r-base>=3.5
diff --git a/modules/nf-core/rseqc/innerdistance/main.nf b/modules/nf-core/rseqc/innerdistance/main.nf
index a87399a98..a63a2bf03 100644
--- a/modules/nf-core/rseqc/innerdistance/main.nf
+++ b/modules/nf-core/rseqc/innerdistance/main.nf
@@ -2,7 +2,7 @@ process RSEQC_INNERDISTANCE {
tag "$meta.id"
label 'process_medium'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' :
'biocontainers/rseqc:3.0.1--py37h516909a_1' }"
diff --git a/modules/nf-core/rseqc/innerdistance/meta.yml b/modules/nf-core/rseqc/innerdistance/meta.yml
index d0a5bf181..d10a4c445 100644
--- a/modules/nf-core/rseqc/innerdistance/meta.yml
+++ b/modules/nf-core/rseqc/innerdistance/meta.yml
@@ -1,7 +1,6 @@
name: rseqc_innerdistance
description: Calculate inner distance between read pairs.
keywords:
- - read_pairs
- fragment_size
- inner_distance
tools:
@@ -55,6 +54,3 @@ output:
authors:
- "@drpatelh"
- "@kevinmenden"
-maintainers:
- - "@drpatelh"
- - "@kevinmenden"
diff --git a/modules/nf-core/rseqc/innerdistance/tests/main.nf.test b/modules/nf-core/rseqc/innerdistance/tests/main.nf.test
deleted file mode 100644
index ee8901422..000000000
--- a/modules/nf-core/rseqc/innerdistance/tests/main.nf.test
+++ /dev/null
@@ -1,41 +0,0 @@
-nextflow_process {
-
- name "Test Process RSEQC_INNERDISTANCE"
- script "../main.nf"
- process "RSEQC_INNERDISTANCE"
- config "./nextflow.config"
-
- tag "modules"
- tag "modules_nfcore"
- tag "rseqc"
- tag "rseqc/innerdistance"
-
- test("sarscov2 - [[meta] - bam] - bed") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
- ]
- input[1] = file(params.test_data['sarscov2']['genome']['test_bed12'], checkIfExists: true)
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out.distance).match("pe_distance") },
- { assert snapshot(process.out.freq).match("freq") },
- { assert snapshot(process.out.mean).match("mean") },
- { assert snapshot(process.out.freq).match("rscript") },
- { assert snapshot(process.out.versions).match("pe_versions") },
- { assert snapshot(file(process.out.pdf[0][1]).name).match("pdf") }
- )
- }
-
- }
-
-}
diff --git a/modules/nf-core/rseqc/innerdistance/tests/main.nf.test.snap b/modules/nf-core/rseqc/innerdistance/tests/main.nf.test.snap
deleted file mode 100644
index 9743d1bd6..000000000
--- a/modules/nf-core/rseqc/innerdistance/tests/main.nf.test.snap
+++ /dev/null
@@ -1,68 +0,0 @@
-{
- "pe_distance": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.inner_distance.txt:md5,a1acc9def0f64a5500d4c4cb47cbe32b"
- ]
- ]
- ],
- "timestamp": "2023-11-23T16:59:21.812491711"
- },
- "rscript": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.inner_distance_freq.txt:md5,3fc037501f5899b5da009c8ce02fc25e"
- ]
- ]
- ],
- "timestamp": "2023-11-23T16:59:21.847527889"
- },
- "pdf": {
- "content": [
- "test.inner_distance_plot.pdf"
- ],
- "timestamp": "2023-11-23T17:23:20.046679629"
- },
- "mean": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.inner_distance_mean.txt:md5,58398b7d5a29a5e564f9e3c50b55996c"
- ]
- ]
- ],
- "timestamp": "2023-11-23T16:59:21.839422659"
- },
- "freq": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.inner_distance_freq.txt:md5,3fc037501f5899b5da009c8ce02fc25e"
- ]
- ]
- ],
- "timestamp": "2023-11-23T16:59:21.83183025"
- },
- "pe_versions": {
- "content": [
- [
- "versions.yml:md5,c2a05298a9c55bd61cc6e07396815a27"
- ]
- ],
- "timestamp": "2023-11-23T16:59:21.854738078"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/rseqc/innerdistance/tests/nextflow.config b/modules/nf-core/rseqc/innerdistance/tests/nextflow.config
deleted file mode 100644
index 8730f1c4b..000000000
--- a/modules/nf-core/rseqc/innerdistance/tests/nextflow.config
+++ /dev/null
@@ -1,5 +0,0 @@
-process {
-
- publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
-
-}
diff --git a/modules/nf-core/rseqc/innerdistance/tests/tags.yml b/modules/nf-core/rseqc/innerdistance/tests/tags.yml
deleted file mode 100644
index 4a9d0acf9..000000000
--- a/modules/nf-core/rseqc/innerdistance/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-rseqc/innerdistance:
- - modules/nf-core/rseqc/innerdistance/**
diff --git a/modules/nf-core/rseqc/junctionannotation/environment.yml b/modules/nf-core/rseqc/junctionannotation/environment.yml
deleted file mode 100644
index 105ea25ea..000000000
--- a/modules/nf-core/rseqc/junctionannotation/environment.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-name: rseqc_junctionannotation
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::rseqc=3.0.1
- - conda-forge::r-base>=3.5
diff --git a/modules/nf-core/rseqc/junctionannotation/main.nf b/modules/nf-core/rseqc/junctionannotation/main.nf
index 58574a278..4029ac765 100644
--- a/modules/nf-core/rseqc/junctionannotation/main.nf
+++ b/modules/nf-core/rseqc/junctionannotation/main.nf
@@ -2,7 +2,7 @@ process RSEQC_JUNCTIONANNOTATION {
tag "$meta.id"
label 'process_medium'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' :
'biocontainers/rseqc:3.0.1--py37h516909a_1' }"
@@ -33,7 +33,7 @@ process RSEQC_JUNCTIONANNOTATION {
-r $bed \\
-o $prefix \\
$args \\
- 2> >(tee ${prefix}.junction_annotation.log >&2)
+ 2> ${prefix}.junction_annotation.log
cat <<-END_VERSIONS > versions.yml
"${task.process}":
diff --git a/modules/nf-core/rseqc/junctionannotation/meta.yml b/modules/nf-core/rseqc/junctionannotation/meta.yml
index a88aa2db3..48c43260e 100644
--- a/modules/nf-core/rseqc/junctionannotation/meta.yml
+++ b/modules/nf-core/rseqc/junctionannotation/meta.yml
@@ -63,6 +63,3 @@ output:
authors:
- "@drpatelh"
- "@kevinmenden"
-maintainers:
- - "@drpatelh"
- - "@kevinmenden"
diff --git a/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test b/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test
deleted file mode 100644
index ed2c27558..000000000
--- a/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test
+++ /dev/null
@@ -1,37 +0,0 @@
-nextflow_process {
-
- name "Test Process RSEQC_JUNCTIONANNOTATION"
- script "../main.nf"
- process "RSEQC_JUNCTIONANNOTATION"
- tag "modules"
- tag "modules_nfcore"
- tag "rseqc"
- tag "rseqc/junctionannotation"
-
- test("sarscov2 - paired end [bam]") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test', single_end: false ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
- ]
- input[1] = file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true)
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out.log).match("log") },
- { assert snapshot(process.out.versions).match("versions") },
- { assert process.out.xls.get(0).get(1) ==~ ".*/test.junction.xls" },
- { assert process.out.rscript.get(0).get(1) ==~ ".*/test.junction_plot.r" }
- )
- }
-
- }
-
-}
diff --git a/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test.snap b/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test.snap
deleted file mode 100644
index a9fc2cbb7..000000000
--- a/modules/nf-core/rseqc/junctionannotation/tests/main.nf.test.snap
+++ /dev/null
@@ -1,24 +0,0 @@
-{
- "log": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.junction_annotation.log:md5,ef37d06d169a1adbeec23fddf82aee2b"
- ]
- ]
- ],
- "timestamp": "2023-11-23T21:11:28.772327081"
- },
- "versions": {
- "content": [
- [
- "versions.yml:md5,78807fd7b5d9df98730e6c66641b48a0"
- ]
- ],
- "timestamp": "2023-11-23T21:11:28.7811548"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/rseqc/junctionannotation/tests/tags.yml b/modules/nf-core/rseqc/junctionannotation/tests/tags.yml
deleted file mode 100644
index 5f719fb8d..000000000
--- a/modules/nf-core/rseqc/junctionannotation/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-rseqc/junctionannotation:
- - modules/nf-core/rseqc/junctionannotation/**
diff --git a/modules/nf-core/rseqc/junctionsaturation/environment.yml b/modules/nf-core/rseqc/junctionsaturation/environment.yml
deleted file mode 100644
index 78ffd06ad..000000000
--- a/modules/nf-core/rseqc/junctionsaturation/environment.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-name: rseqc_junctionsaturation
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::rseqc=3.0.1
- - conda-forge::r-base>=3.5
diff --git a/modules/nf-core/rseqc/junctionsaturation/main.nf b/modules/nf-core/rseqc/junctionsaturation/main.nf
index 552865bbf..93cc61b23 100644
--- a/modules/nf-core/rseqc/junctionsaturation/main.nf
+++ b/modules/nf-core/rseqc/junctionsaturation/main.nf
@@ -2,7 +2,7 @@ process RSEQC_JUNCTIONSATURATION {
tag "$meta.id"
label 'process_medium'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' :
'biocontainers/rseqc:3.0.1--py37h516909a_1' }"
diff --git a/modules/nf-core/rseqc/junctionsaturation/meta.yml b/modules/nf-core/rseqc/junctionsaturation/meta.yml
index 19ae3f52d..340fec0d0 100644
--- a/modules/nf-core/rseqc/junctionsaturation/meta.yml
+++ b/modules/nf-core/rseqc/junctionsaturation/meta.yml
@@ -43,6 +43,3 @@ output:
authors:
- "@drpatelh"
- "@kevinmenden"
-maintainers:
- - "@drpatelh"
- - "@kevinmenden"
diff --git a/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test b/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test
deleted file mode 100644
index 347b5fccd..000000000
--- a/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test
+++ /dev/null
@@ -1,36 +0,0 @@
-nextflow_process {
-
- name "Test Process RSEQC_JUNCTIONSATURATION"
- script "../main.nf"
- process "RSEQC_JUNCTIONSATURATION"
- tag "modules"
- tag "modules_nfcore"
- tag "rseqc"
- tag "rseqc/junctionsaturation"
-
- test("sarscov2 paired-end [bam]") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test', single_end: false ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
- ]
- input[1] = file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true)
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out.rscript).match("rscript") },
- { assert snapshot(process.out.versions).match("versions") },
- { assert snapshot(file(process.out.pdf[0][1]).name).match("pdf") }
- )
- }
-
- }
-
-}
diff --git a/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test.snap b/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test.snap
deleted file mode 100644
index 708782da6..000000000
--- a/modules/nf-core/rseqc/junctionsaturation/tests/main.nf.test.snap
+++ /dev/null
@@ -1,30 +0,0 @@
-{
- "rscript": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.junctionSaturation_plot.r:md5,caa6e63dcb477aabb169882b2f30dadd"
- ]
- ]
- ],
- "timestamp": "2023-11-24T00:15:43.655261555"
- },
- "pdf": {
- "content": [
- "test.junctionSaturation_plot.pdf"
- ],
- "timestamp": "2023-11-24T00:15:43.682673802"
- },
- "versions": {
- "content": [
- [
- "versions.yml:md5,2a187a15edb3a5ba114ab3d9f003a8bc"
- ]
- ],
- "timestamp": "2023-11-24T00:15:43.667463564"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/rseqc/junctionsaturation/tests/tags.yml b/modules/nf-core/rseqc/junctionsaturation/tests/tags.yml
deleted file mode 100644
index 7022b59ad..000000000
--- a/modules/nf-core/rseqc/junctionsaturation/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-rseqc/junctionsaturation:
- - modules/nf-core/rseqc/junctionsaturation/**
diff --git a/modules/nf-core/rseqc/readdistribution/environment.yml b/modules/nf-core/rseqc/readdistribution/environment.yml
deleted file mode 100644
index a20fef74e..000000000
--- a/modules/nf-core/rseqc/readdistribution/environment.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-name: rseqc_readdistribution
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::rseqc=3.0.1
- - conda-forge::r-base>=3.5
diff --git a/modules/nf-core/rseqc/readdistribution/main.nf b/modules/nf-core/rseqc/readdistribution/main.nf
index 901b364c0..f3e588d69 100644
--- a/modules/nf-core/rseqc/readdistribution/main.nf
+++ b/modules/nf-core/rseqc/readdistribution/main.nf
@@ -2,7 +2,7 @@ process RSEQC_READDISTRIBUTION {
tag "$meta.id"
label 'process_medium'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' :
'biocontainers/rseqc:3.0.1--py37h516909a_1' }"
diff --git a/modules/nf-core/rseqc/readdistribution/meta.yml b/modules/nf-core/rseqc/readdistribution/meta.yml
index 989792faa..94c647120 100644
--- a/modules/nf-core/rseqc/readdistribution/meta.yml
+++ b/modules/nf-core/rseqc/readdistribution/meta.yml
@@ -39,6 +39,3 @@ output:
authors:
- "@drpatelh"
- "@kevinmenden"
-maintainers:
- - "@drpatelh"
- - "@kevinmenden"
diff --git a/modules/nf-core/rseqc/readdistribution/tests/main.nf.test b/modules/nf-core/rseqc/readdistribution/tests/main.nf.test
deleted file mode 100644
index 4da721ab6..000000000
--- a/modules/nf-core/rseqc/readdistribution/tests/main.nf.test
+++ /dev/null
@@ -1,33 +0,0 @@
-nextflow_process {
-
- name "Test Process RSEQC_READDISTRIBUTION"
- script "../main.nf"
- process "RSEQC_READDISTRIBUTION"
- tag "modules"
- tag "modules_nfcore"
- tag "rseqc"
- tag "rseqc/readdistribution"
-
- test("sarscov2 paired-end [bam]") {
-
- when {
- process {
- """
- input[0] = [ [ id:'test', single_end: false ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
- ]
- input[1] = file(params.test_data['sarscov2']['genome']['test_bed12'], checkIfExists: true)
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
-}
diff --git a/modules/nf-core/rseqc/readdistribution/tests/main.nf.test.snap b/modules/nf-core/rseqc/readdistribution/tests/main.nf.test.snap
deleted file mode 100644
index 90cf8b029..000000000
--- a/modules/nf-core/rseqc/readdistribution/tests/main.nf.test.snap
+++ /dev/null
@@ -1,33 +0,0 @@
-{
- "sarscov2 paired-end [bam]": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.read_distribution.txt:md5,56893fdc0809d968629a363551a1655f"
- ]
- ],
- "1": [
- "versions.yml:md5,15fd23aafd4d3aeabc4fede518d1b3a4"
- ],
- "txt": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.read_distribution.txt:md5,56893fdc0809d968629a363551a1655f"
- ]
- ],
- "versions": [
- "versions.yml:md5,15fd23aafd4d3aeabc4fede518d1b3a4"
- ]
- }
- ],
- "timestamp": "2023-11-24T00:35:28.404023432"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/rseqc/readdistribution/tests/tags.yml b/modules/nf-core/rseqc/readdistribution/tests/tags.yml
deleted file mode 100644
index c0c477b6d..000000000
--- a/modules/nf-core/rseqc/readdistribution/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-rseqc/readdistribution:
- - modules/nf-core/rseqc/readdistribution/**
diff --git a/modules/nf-core/rseqc/readduplication/environment.yml b/modules/nf-core/rseqc/readduplication/environment.yml
deleted file mode 100644
index bba52d8fa..000000000
--- a/modules/nf-core/rseqc/readduplication/environment.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-name: rseqc_readduplication
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::rseqc=3.0.1
- - conda-forge::r-base>=3.5
diff --git a/modules/nf-core/rseqc/readduplication/main.nf b/modules/nf-core/rseqc/readduplication/main.nf
index 68c1296ea..023118536 100644
--- a/modules/nf-core/rseqc/readduplication/main.nf
+++ b/modules/nf-core/rseqc/readduplication/main.nf
@@ -2,7 +2,7 @@ process RSEQC_READDUPLICATION {
tag "$meta.id"
label 'process_medium'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' :
'biocontainers/rseqc:3.0.1--py37h516909a_1' }"
diff --git a/modules/nf-core/rseqc/readduplication/meta.yml b/modules/nf-core/rseqc/readduplication/meta.yml
index 4b24d3032..5a8666435 100644
--- a/modules/nf-core/rseqc/readduplication/meta.yml
+++ b/modules/nf-core/rseqc/readduplication/meta.yml
@@ -3,8 +3,6 @@ description: Calculate read duplication rate
keywords:
- rnaseq
- duplication
- - sequence-based
- - mapping-based
tools:
- rseqc:
description: |
@@ -52,6 +50,3 @@ output:
authors:
- "@drpatelh"
- "@kevinmenden"
-maintainers:
- - "@drpatelh"
- - "@kevinmenden"
diff --git a/modules/nf-core/rseqc/readduplication/tests/main.nf.test b/modules/nf-core/rseqc/readduplication/tests/main.nf.test
deleted file mode 100644
index 93d0cccd6..000000000
--- a/modules/nf-core/rseqc/readduplication/tests/main.nf.test
+++ /dev/null
@@ -1,36 +0,0 @@
-nextflow_process {
-
- name "Test Process RSEQC_READDUPLICATION"
- script "../main.nf"
- process "RSEQC_READDUPLICATION"
- tag "modules"
- tag "modules_nfcore"
- tag "rseqc"
- tag "rseqc/readduplication"
-
- test("sarscov2 paired-end [bam]") {
-
- when {
- process {
- """
- input[0] = [ [ id:'test', single_end: false ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out.seq_xls).match("seq_xls") },
- { assert snapshot(process.out.pos_xls).match("pos_xls") },
- { assert snapshot(process.out.rscript).match("rscript") },
- { assert snapshot(process.out.versions).match("versions") },
- { assert snapshot(file(process.out.pdf[0][1]).name).match("pdf") }
- )
- }
-
- }
-
-}
diff --git a/modules/nf-core/rseqc/readduplication/tests/main.nf.test.snap b/modules/nf-core/rseqc/readduplication/tests/main.nf.test.snap
deleted file mode 100644
index e3e4ec3fd..000000000
--- a/modules/nf-core/rseqc/readduplication/tests/main.nf.test.snap
+++ /dev/null
@@ -1,58 +0,0 @@
-{
- "pos_xls": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.pos.DupRate.xls:md5,a859bc2031d46bf1cc4336205847caa3"
- ]
- ]
- ],
- "timestamp": "2023-11-24T00:52:45.27809706"
- },
- "rscript": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.DupRate_plot.r:md5,3c0325095cee4835b921e57d61c23dca"
- ]
- ]
- ],
- "timestamp": "2023-11-24T00:52:45.285457599"
- },
- "pdf": {
- "content": [
- "test.DupRate_plot.pdf"
- ],
- "timestamp": "2023-11-24T00:52:45.304152477"
- },
- "seq_xls": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.seq.DupRate.xls:md5,ee8783399eec5a18522a6f08bece338b"
- ]
- ]
- ],
- "timestamp": "2023-11-24T00:52:45.262656562"
- },
- "versions": {
- "content": [
- [
- "versions.yml:md5,06a70ece474de57fc1dc7585e7cfd5a0"
- ]
- ],
- "timestamp": "2023-11-24T00:52:45.292599738"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/rseqc/readduplication/tests/tags.yml b/modules/nf-core/rseqc/readduplication/tests/tags.yml
deleted file mode 100644
index fce3d35d4..000000000
--- a/modules/nf-core/rseqc/readduplication/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-rseqc/readduplication:
- - modules/nf-core/rseqc/readduplication/**
diff --git a/modules/nf-core/rseqc/tin/environment.yml b/modules/nf-core/rseqc/tin/environment.yml
deleted file mode 100644
index 48b7efa53..000000000
--- a/modules/nf-core/rseqc/tin/environment.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-name: rseqc_tin
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::rseqc=3.0.1
- - conda-forge::r-base>=3.5
diff --git a/modules/nf-core/rseqc/tin/main.nf b/modules/nf-core/rseqc/tin/main.nf
index 718aabb89..872938b62 100644
--- a/modules/nf-core/rseqc/tin/main.nf
+++ b/modules/nf-core/rseqc/tin/main.nf
@@ -2,7 +2,7 @@ process RSEQC_TIN {
tag "$meta.id"
label 'process_high'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::rseqc=3.0.1 'conda-forge::r-base>=3.5'"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/rseqc:3.0.1--py37h516909a_1' :
'biocontainers/rseqc:3.0.1--py37h516909a_1' }"
diff --git a/modules/nf-core/rseqc/tin/meta.yml b/modules/nf-core/rseqc/tin/meta.yml
index f760bb2f4..381edfde0 100644
--- a/modules/nf-core/rseqc/tin/meta.yml
+++ b/modules/nf-core/rseqc/tin/meta.yml
@@ -46,5 +46,3 @@ output:
pattern: "versions.yml"
authors:
- "@drpatelh"
-maintainers:
- - "@drpatelh"
diff --git a/modules/nf-core/rseqc/tin/tests/main.nf.test b/modules/nf-core/rseqc/tin/tests/main.nf.test
deleted file mode 100644
index c339d343a..000000000
--- a/modules/nf-core/rseqc/tin/tests/main.nf.test
+++ /dev/null
@@ -1,35 +0,0 @@
-nextflow_process {
-
- name "Test Process RSEQC_TIN"
- script "../main.nf"
- process "RSEQC_TIN"
- tag "modules"
- tag "modules_nfcore"
- tag "rseqc"
- tag "rseqc/tin"
-
- test("sarscov2 paired-end [bam]") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
- ]
- input[1] = file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true)
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
-}
diff --git a/modules/nf-core/rseqc/tin/tests/main.nf.test.snap b/modules/nf-core/rseqc/tin/tests/main.nf.test.snap
deleted file mode 100644
index 4bed8ac9b..000000000
--- a/modules/nf-core/rseqc/tin/tests/main.nf.test.snap
+++ /dev/null
@@ -1,47 +0,0 @@
-{
- "sarscov2 paired-end [bam]": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "test.paired_end.sorted.summary.txt:md5,9d98447e178b89a89f6f5aba7a772fe6"
- ]
- ],
- "1": [
- [
- {
- "id": "test"
- },
- "test.paired_end.sorted.tin.xls:md5,6b1b1b0dc1dc265342ba8c3f27fa60e6"
- ]
- ],
- "2": [
- "versions.yml:md5,77a0664abb6e486d1a0dd2078d4916d2"
- ],
- "txt": [
- [
- {
- "id": "test"
- },
- "test.paired_end.sorted.summary.txt:md5,9d98447e178b89a89f6f5aba7a772fe6"
- ]
- ],
- "versions": [
- "versions.yml:md5,77a0664abb6e486d1a0dd2078d4916d2"
- ],
- "xls": [
- [
- {
- "id": "test"
- },
- "test.paired_end.sorted.tin.xls:md5,6b1b1b0dc1dc265342ba8c3f27fa60e6"
- ]
- ]
- }
- ],
- "timestamp": "2023-11-24T02:30:03.446989864"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/rseqc/tin/tests/tags.yml b/modules/nf-core/rseqc/tin/tests/tags.yml
deleted file mode 100644
index 741bbd0c0..000000000
--- a/modules/nf-core/rseqc/tin/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-rseqc/tin:
- - modules/nf-core/rseqc/tin/**
diff --git a/modules/nf-core/samtools/flagstat/environment.yml b/modules/nf-core/samtools/flagstat/environment.yml
deleted file mode 100644
index 5efae053f..000000000
--- a/modules/nf-core/samtools/flagstat/environment.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-name: samtools_flagstat
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::samtools=1.18
diff --git a/modules/nf-core/samtools/flagstat/main.nf b/modules/nf-core/samtools/flagstat/main.nf
index f1893d7cc..b75707eca 100644
--- a/modules/nf-core/samtools/flagstat/main.nf
+++ b/modules/nf-core/samtools/flagstat/main.nf
@@ -2,10 +2,10 @@ process SAMTOOLS_FLAGSTAT {
tag "$meta.id"
label 'process_single'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::samtools=1.17"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' :
- 'biocontainers/samtools:1.18--h50ea8bc_1' }"
+ 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' :
+ 'biocontainers/samtools:1.17--h00cdaf9_0' }"
input:
tuple val(meta), path(bam), path(bai)
diff --git a/modules/nf-core/samtools/flagstat/meta.yml b/modules/nf-core/samtools/flagstat/meta.yml
index 97991358e..954225dfc 100644
--- a/modules/nf-core/samtools/flagstat/meta.yml
+++ b/modules/nf-core/samtools/flagstat/meta.yml
@@ -47,5 +47,3 @@ output:
pattern: "versions.yml"
authors:
- "@drpatelh"
-maintainers:
- - "@drpatelh"
diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test b/modules/nf-core/samtools/flagstat/tests/main.nf.test
deleted file mode 100644
index c8dd8dc9f..000000000
--- a/modules/nf-core/samtools/flagstat/tests/main.nf.test
+++ /dev/null
@@ -1,36 +0,0 @@
-nextflow_process {
-
- name "Test Process SAMTOOLS_FLAGSTAT"
- script "../main.nf"
- process "SAMTOOLS_FLAGSTAT"
- tag "modules"
- tag "modules_nfcore"
- tag "samtools"
- tag "samtools/flagstat"
-
- test("BAM") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- input[0] = [
- [ id:'test', single_end:false ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out.flagstat).match() },
- { assert path(process.out.versions.get(0)).getText().contains("samtools") }
- )
- }
- }
-}
diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap
deleted file mode 100644
index 880019f2f..000000000
--- a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap
+++ /dev/null
@@ -1,16 +0,0 @@
-{
- "BAM": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
- ]
- ]
- ],
- "timestamp": "2023-11-14T15:49:22.577133"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/flagstat/tests/tags.yml b/modules/nf-core/samtools/flagstat/tests/tags.yml
deleted file mode 100644
index 2d2b7255e..000000000
--- a/modules/nf-core/samtools/flagstat/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-samtools/flagstat:
- - modules/nf-core/samtools/flagstat/**
diff --git a/modules/nf-core/samtools/idxstats/environment.yml b/modules/nf-core/samtools/idxstats/environment.yml
deleted file mode 100644
index 2401db0f1..000000000
--- a/modules/nf-core/samtools/idxstats/environment.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-name: samtools_idxstats
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::samtools=1.18
diff --git a/modules/nf-core/samtools/idxstats/main.nf b/modules/nf-core/samtools/idxstats/main.nf
index 00d916bbf..83c7c34b9 100644
--- a/modules/nf-core/samtools/idxstats/main.nf
+++ b/modules/nf-core/samtools/idxstats/main.nf
@@ -2,10 +2,10 @@ process SAMTOOLS_IDXSTATS {
tag "$meta.id"
label 'process_single'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::samtools=1.17"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' :
- 'biocontainers/samtools:1.18--h50ea8bc_1' }"
+ 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' :
+ 'biocontainers/samtools:1.17--h00cdaf9_0' }"
input:
tuple val(meta), path(bam), path(bai)
diff --git a/modules/nf-core/samtools/idxstats/meta.yml b/modules/nf-core/samtools/idxstats/meta.yml
index 344e92a3f..dda87e1ee 100644
--- a/modules/nf-core/samtools/idxstats/meta.yml
+++ b/modules/nf-core/samtools/idxstats/meta.yml
@@ -48,5 +48,3 @@ output:
pattern: "versions.yml"
authors:
- "@drpatelh"
-maintainers:
- - "@drpatelh"
diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test b/modules/nf-core/samtools/idxstats/tests/main.nf.test
deleted file mode 100644
index f6c92150c..000000000
--- a/modules/nf-core/samtools/idxstats/tests/main.nf.test
+++ /dev/null
@@ -1,36 +0,0 @@
-nextflow_process {
-
- name "Test Process SAMTOOLS_IDXSTATS"
- script "../main.nf"
- process "SAMTOOLS_IDXSTATS"
- tag "modules"
- tag "modules_nfcore"
- tag "samtools"
- tag "samtools/idxstats"
-
- test("BAM") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- input[0] = [
- [ id:'test', single_end:false ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out.idxstats).match() },
- { assert path(process.out.versions.get(0)).getText().contains("samtools") }
- )
- }
- }
-}
diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap
deleted file mode 100644
index 4c6c12bd5..000000000
--- a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap
+++ /dev/null
@@ -1,16 +0,0 @@
-{
- "BAM": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
- ]
- ]
- ],
- "timestamp": "2023-11-14T15:52:19.875194"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/idxstats/tests/tags.yml b/modules/nf-core/samtools/idxstats/tests/tags.yml
deleted file mode 100644
index d3057c61f..000000000
--- a/modules/nf-core/samtools/idxstats/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-samtools/idxstats:
- - modules/nf-core/samtools/idxstats/**
diff --git a/modules/nf-core/samtools/index/environment.yml b/modules/nf-core/samtools/index/environment.yml
deleted file mode 100644
index 296ed99e5..000000000
--- a/modules/nf-core/samtools/index/environment.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-name: samtools_index
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::samtools=1.18
diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf
index 8ad18fdc2..0b20aa4bb 100644
--- a/modules/nf-core/samtools/index/main.nf
+++ b/modules/nf-core/samtools/index/main.nf
@@ -2,10 +2,10 @@ process SAMTOOLS_INDEX {
tag "$meta.id"
label 'process_low'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::samtools=1.17"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' :
- 'biocontainers/samtools:1.18--h50ea8bc_1' }"
+ 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' :
+ 'biocontainers/samtools:1.17--h00cdaf9_0' }"
input:
tuple val(meta), path(input)
diff --git a/modules/nf-core/samtools/index/meta.yml b/modules/nf-core/samtools/index/meta.yml
index 01a4ee03e..8bd2fa6fb 100644
--- a/modules/nf-core/samtools/index/meta.yml
+++ b/modules/nf-core/samtools/index/meta.yml
@@ -51,7 +51,3 @@ authors:
- "@drpatelh"
- "@ewels"
- "@maxulysse"
-maintainers:
- - "@drpatelh"
- - "@ewels"
- - "@maxulysse"
diff --git a/modules/nf-core/samtools/index/tests/csi.nextflow.config b/modules/nf-core/samtools/index/tests/csi.nextflow.config
deleted file mode 100644
index 0ed260efa..000000000
--- a/modules/nf-core/samtools/index/tests/csi.nextflow.config
+++ /dev/null
@@ -1,7 +0,0 @@
-process {
-
- withName: SAMTOOLS_INDEX {
- ext.args = '-c'
- }
-
-}
diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test
deleted file mode 100644
index c76a9169f..000000000
--- a/modules/nf-core/samtools/index/tests/main.nf.test
+++ /dev/null
@@ -1,87 +0,0 @@
-nextflow_process {
-
- name "Test Process SAMTOOLS_INDEX"
- script "../main.nf"
- process "SAMTOOLS_INDEX"
- tag "modules"
- tag "modules_nfcore"
- tag "samtools"
- tag "samtools/index"
-
- test("sarscov2 [BAI]") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out.bai).match("bai") },
- { assert path(process.out.versions.get(0)).getText().contains("samtools") }
- )
- }
- }
-
- test("homo_sapiens [CRAI]") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out.crai).match("crai") },
- { assert path(process.out.versions.get(0)).getText().contains("samtools") }
- )
- }
- }
-
- test("homo_sapiens [CSI]") {
-
- config "./csi.nextflow.config"
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert path(process.out.csi.get(0).get(1)).exists() },
- { assert path(process.out.versions.get(0)).getText().contains("samtools") }
- )
- }
- }
-}
diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap
deleted file mode 100644
index b3baee7fb..000000000
--- a/modules/nf-core/samtools/index/tests/main.nf.test.snap
+++ /dev/null
@@ -1,28 +0,0 @@
-{
- "crai": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029"
- ]
- ]
- ],
- "timestamp": "2023-11-15T15:17:37.30801"
- },
- "bai": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4"
- ]
- ]
- ],
- "timestamp": "2023-11-15T15:17:30.869234"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/index/tests/tags.yml b/modules/nf-core/samtools/index/tests/tags.yml
deleted file mode 100644
index e0f58a7a3..000000000
--- a/modules/nf-core/samtools/index/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-samtools/index:
- - modules/nf-core/samtools/index/**
diff --git a/modules/nf-core/samtools/sort/environment.yml b/modules/nf-core/samtools/sort/environment.yml
deleted file mode 100644
index cd50868c5..000000000
--- a/modules/nf-core/samtools/sort/environment.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-name: samtools_sort
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::samtools=1.18
diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf
index 4a666d42e..2b7753fd8 100644
--- a/modules/nf-core/samtools/sort/main.nf
+++ b/modules/nf-core/samtools/sort/main.nf
@@ -2,10 +2,10 @@ process SAMTOOLS_SORT {
tag "$meta.id"
label 'process_medium'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::samtools=1.17"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' :
- 'biocontainers/samtools:1.18--h50ea8bc_1' }"
+ 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' :
+ 'biocontainers/samtools:1.17--h00cdaf9_0' }"
input:
tuple val(meta), path(bam)
diff --git a/modules/nf-core/samtools/sort/meta.yml b/modules/nf-core/samtools/sort/meta.yml
index 2200de72f..073284316 100644
--- a/modules/nf-core/samtools/sort/meta.yml
+++ b/modules/nf-core/samtools/sort/meta.yml
@@ -46,6 +46,3 @@ output:
authors:
- "@drpatelh"
- "@ewels"
-maintainers:
- - "@drpatelh"
- - "@ewels"
diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test
deleted file mode 100644
index abb80978e..000000000
--- a/modules/nf-core/samtools/sort/tests/main.nf.test
+++ /dev/null
@@ -1,73 +0,0 @@
-nextflow_process {
-
- name "Test Process SAMTOOLS_SORT"
- script "../main.nf"
- process "SAMTOOLS_SORT"
- tag "modules"
- tag "modules_nfcore"
- tag "samtools"
- tag "samtools/sort"
-
- test("test_samtools_sort") {
-
- config "./nextflow.config"
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- input[0] = [
- [ id:'test', single_end:false ],
- [
- file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true)
- ]
- ]
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
- test("test_samtools_sort_stub") {
-
- config "./nextflow.config"
- options "-stub-run"
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- input[0] = [
- [ id:'test', single_end:false ],
- [
- file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true)
- ]
- ]
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(
- file(process.out.bam[0][1]).name,
- process.out.versions
- ).match() }
- )
- }
-
- }
-
-}
diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap
deleted file mode 100644
index ff7222597..000000000
--- a/modules/nf-core/samtools/sort/tests/main.nf.test.snap
+++ /dev/null
@@ -1,48 +0,0 @@
-{
- "test_samtools_sort": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam:md5,ea6a0fef94eb534e901f107a05a33a06"
- ]
- ],
- "1": [
-
- ],
- "2": [
- "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80"
- ],
- "bam": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam:md5,ea6a0fef94eb534e901f107a05a33a06"
- ]
- ],
- "csi": [
-
- ],
- "versions": [
- "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80"
- ]
- }
- ],
- "timestamp": "2023-12-04T11:11:22.005628301"
- },
- "test_samtools_sort_stub": {
- "content": [
- "test.sorted.bam",
- [
- "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80"
- ]
- ],
- "timestamp": "2023-12-04T17:47:22.314445935"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/sort/tests/nextflow.config b/modules/nf-core/samtools/sort/tests/nextflow.config
deleted file mode 100644
index d0f350868..000000000
--- a/modules/nf-core/samtools/sort/tests/nextflow.config
+++ /dev/null
@@ -1,7 +0,0 @@
-process {
-
- withName: SAMTOOLS_SORT {
- ext.prefix = { "${meta.id}.sorted" }
- }
-
-}
diff --git a/modules/nf-core/samtools/sort/tests/tags.yml b/modules/nf-core/samtools/sort/tests/tags.yml
deleted file mode 100644
index cd63ea208..000000000
--- a/modules/nf-core/samtools/sort/tests/tags.yml
+++ /dev/null
@@ -1,3 +0,0 @@
-samtools/sort:
- - modules/nf-core/samtools/sort/**
- - tests/modules/nf-core/samtools/sort/**
diff --git a/modules/nf-core/samtools/stats/environment.yml b/modules/nf-core/samtools/stats/environment.yml
deleted file mode 100644
index b89ce6475..000000000
--- a/modules/nf-core/samtools/stats/environment.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-name: samtools_stats
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::samtools=1.18
diff --git a/modules/nf-core/samtools/stats/main.nf b/modules/nf-core/samtools/stats/main.nf
index 7539140ab..4a2607ded 100644
--- a/modules/nf-core/samtools/stats/main.nf
+++ b/modules/nf-core/samtools/stats/main.nf
@@ -2,10 +2,10 @@ process SAMTOOLS_STATS {
tag "$meta.id"
label 'process_single'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::samtools=1.17"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' :
- 'biocontainers/samtools:1.18--h50ea8bc_1' }"
+ 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' :
+ 'biocontainers/samtools:1.17--h00cdaf9_0' }"
input:
tuple val(meta), path(input), path(input_index)
diff --git a/modules/nf-core/samtools/stats/meta.yml b/modules/nf-core/samtools/stats/meta.yml
index 735ff8122..90e6345f5 100644
--- a/modules/nf-core/samtools/stats/meta.yml
+++ b/modules/nf-core/samtools/stats/meta.yml
@@ -57,7 +57,3 @@ authors:
- "@drpatelh"
- "@FriederikeHanssen"
- "@ramprasadn"
-maintainers:
- - "@drpatelh"
- - "@FriederikeHanssen"
- - "@ramprasadn"
diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test b/modules/nf-core/samtools/stats/tests/main.nf.test
deleted file mode 100644
index 20c3efe12..000000000
--- a/modules/nf-core/samtools/stats/tests/main.nf.test
+++ /dev/null
@@ -1,78 +0,0 @@
-nextflow_process {
-
- name "Test Process SAMTOOLS_STATS"
- script "../main.nf"
- process "SAMTOOLS_STATS"
- tag "modules"
- tag "modules_nfcore"
- tag "samtools"
- tag "samtools/stats"
-
- test("SAMTOOLS STATS Should run without failures") {
-
- when {
- params {
-
- outdir = "$outputDir"
- }
- process {
- """
- // define inputs of the process here.
- input[0] = [
- [ id:'test', single_end:false ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
-
- ]
- input[1] = [[],[]]
- """
-
- }
- }
-
- then {
- assertAll(
- {assert process.success},
- {assert snapshot(process.out).match()}
- )
- }
-
- }
-
- test("SAMTOOLS CRAM Should run without failures") {
-
- when {
- params {
-
- outdir = "$outputDir"
- }
- process {
- """
- // define inputs of the process here
- input[0] = [
- [ id:'test', single_end:false ], // meta map
- file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram'], checkIfExists: true),
- file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram_crai'], checkIfExists: true)
-
- ]
- input[1] = [
- [ id:'genome' ],
- file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
- ]
- """
- }
-
-
- }
-
- then {
- assertAll(
- {assert process.success},
- {assert snapshot(process.out).match()}
- )
- }
-
- }
-
-
-}
diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test.snap b/modules/nf-core/samtools/stats/tests/main.nf.test.snap
deleted file mode 100644
index 025c83a55..000000000
--- a/modules/nf-core/samtools/stats/tests/main.nf.test.snap
+++ /dev/null
@@ -1,64 +0,0 @@
-{
- "SAMTOOLS STATS Should run without failures": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.stats:md5,045a48208b1c6f5b8af4347fe31f4def"
- ]
- ],
- "1": [
- "versions.yml:md5,650a365c6635001436008350ae83337c"
- ],
- "stats": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.stats:md5,045a48208b1c6f5b8af4347fe31f4def"
- ]
- ],
- "versions": [
- "versions.yml:md5,650a365c6635001436008350ae83337c"
- ]
- }
- ],
- "timestamp": "2023-12-04T11:07:28.26821485"
- },
- "SAMTOOLS CRAM Should run without failures": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.stats:md5,dfbfa130d4a6925ddd1931dcd8354a43"
- ]
- ],
- "1": [
- "versions.yml:md5,650a365c6635001436008350ae83337c"
- ],
- "stats": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.stats:md5,dfbfa130d4a6925ddd1931dcd8354a43"
- ]
- ],
- "versions": [
- "versions.yml:md5,650a365c6635001436008350ae83337c"
- ]
- }
- ],
- "timestamp": "2023-12-04T11:07:50.356233402"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/stats/tests/tags.yml b/modules/nf-core/samtools/stats/tests/tags.yml
deleted file mode 100644
index 7c28e30f3..000000000
--- a/modules/nf-core/samtools/stats/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-samtools/stats:
- - modules/nf-core/samtools/stats/**
diff --git a/modules/nf-core/trimgalore/environment.yml b/modules/nf-core/trimgalore/environment.yml
deleted file mode 100644
index 6cd0f51b3..000000000
--- a/modules/nf-core/trimgalore/environment.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-name: trimgalore
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::trim-galore=0.6.7
diff --git a/modules/nf-core/trimgalore/main.nf b/modules/nf-core/trimgalore/main.nf
index 24ead8714..dcb77ae7b 100644
--- a/modules/nf-core/trimgalore/main.nf
+++ b/modules/nf-core/trimgalore/main.nf
@@ -2,7 +2,7 @@ process TRIMGALORE {
tag "$meta.id"
label 'process_high'
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::trim-galore=0.6.7"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/trim-galore:0.6.7--hdfd78af_0' :
'biocontainers/trim-galore:0.6.7--hdfd78af_0' }"
diff --git a/modules/nf-core/trimgalore/meta.yml b/modules/nf-core/trimgalore/meta.yml
index e649088ce..f84c4d771 100644
--- a/modules/nf-core/trimgalore/meta.yml
+++ b/modules/nf-core/trimgalore/meta.yml
@@ -62,7 +62,3 @@ authors:
- "@drpatelh"
- "@ewels"
- "@FelixKrueger"
-maintainers:
- - "@drpatelh"
- - "@ewels"
- - "@FelixKrueger"
diff --git a/modules/nf-core/trimgalore/tests/main.nf.test b/modules/nf-core/trimgalore/tests/main.nf.test
deleted file mode 100644
index bc6812ccd..000000000
--- a/modules/nf-core/trimgalore/tests/main.nf.test
+++ /dev/null
@@ -1,105 +0,0 @@
-nextflow_process {
-
- name "Test Process TRIMGALORE"
- script "../main.nf"
- process "TRIMGALORE"
- tag "modules"
- tag "modules_nfcore"
- tag "trimgalore"
-
- test("test_trimgalore_single_end") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- input[0] = [ [ id:'test', single_end:true ], // meta map
- [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ]
- ]
- """
- }
- }
-
- then {
- def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
- }
- },
- { report1_lines.each { report1_line ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(report1_line) }
- }
- }
- )
- }
- }
-
- test("test_trimgalore_paired_end") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- input[0] = [ [ id:'test', single_end:false ], // meta map
- [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
- ]
- """
- }
- }
-
- then {
- def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
- }
- },
- { read2_lines.each { read2_line ->
- { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
- }
- },
- { report1_lines.each { report1_line ->
- { assert path(process.out.log.get(0).get(1).get(0)).getText().contains(report1_line) }
- }
- },
- { report2_lines.each { report2_line ->
- { assert path(process.out.log.get(0).get(1).get(1)).getText().contains(report2_line) }
- }
- }
- )
- }
- }
-}
diff --git a/modules/nf-core/trimgalore/tests/main.nf.test.snap b/modules/nf-core/trimgalore/tests/main.nf.test.snap
deleted file mode 100644
index 84feacca2..000000000
--- a/modules/nf-core/trimgalore/tests/main.nf.test.snap
+++ /dev/null
@@ -1,148 +0,0 @@
-{
- "test_trimgalore_single_end": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test_trimmed.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4"
- ]
- ],
- "1": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastq.gz_trimming_report.txt:md5,a1ab3958205f1ddf48af623242b5b429"
- ]
- ],
- "2": [
-
- ],
- "3": [
-
- ],
- "4": [
-
- ],
- "5": [
- "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7"
- ],
- "html": [
-
- ],
- "log": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastq.gz_trimming_report.txt:md5,a1ab3958205f1ddf48af623242b5b429"
- ]
- ],
- "reads": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test_trimmed.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4"
- ]
- ],
- "unpaired": [
-
- ],
- "versions": [
- "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7"
- ],
- "zip": [
-
- ]
- }
- ],
- "timestamp": "2023-10-17T15:24:57.782141441"
- },
- "test_trimgalore_paired_end": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1_val_1.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4",
- "test_2_val_2.fq.gz:md5,f3d61189e6d10202da7b8686f1dbb71b"
- ]
- ]
- ],
- "1": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1.fastq.gz_trimming_report.txt:md5,315d40465412f9909bbaabf52269274d",
- "test_2.fastq.gz_trimming_report.txt:md5,34436303da1c78811103427a2fb57f7b"
- ]
- ]
- ],
- "2": [
-
- ],
- "3": [
-
- ],
- "4": [
-
- ],
- "5": [
- "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7"
- ],
- "html": [
-
- ],
- "log": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1.fastq.gz_trimming_report.txt:md5,315d40465412f9909bbaabf52269274d",
- "test_2.fastq.gz_trimming_report.txt:md5,34436303da1c78811103427a2fb57f7b"
- ]
- ]
- ],
- "reads": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1_val_1.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4",
- "test_2_val_2.fq.gz:md5,f3d61189e6d10202da7b8686f1dbb71b"
- ]
- ]
- ],
- "unpaired": [
-
- ],
- "versions": [
- "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7"
- ],
- "zip": [
-
- ]
- }
- ],
- "timestamp": "2023-10-17T15:25:08.513589909"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/trimgalore/tests/tags.yml b/modules/nf-core/trimgalore/tests/tags.yml
deleted file mode 100644
index e9937691a..000000000
--- a/modules/nf-core/trimgalore/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-trimgalore:
- - modules/nf-core/trimgalore/**
diff --git a/modules/nf-core/umitools/dedup/environment.yml b/modules/nf-core/umitools/dedup/environment.yml
deleted file mode 100644
index f443735f4..000000000
--- a/modules/nf-core/umitools/dedup/environment.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-name: umitools_dedup
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::umi_tools=1.1.4
diff --git a/modules/nf-core/umitools/dedup/main.nf b/modules/nf-core/umitools/dedup/main.nf
index 64ab8f98e..56ea04691 100644
--- a/modules/nf-core/umitools/dedup/main.nf
+++ b/modules/nf-core/umitools/dedup/main.nf
@@ -2,7 +2,7 @@ process UMITOOLS_DEDUP {
tag "$meta.id"
label "process_medium"
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::umi_tools=1.1.4"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/umi_tools:1.1.4--py38hbff2b2d_1' :
'biocontainers/umi_tools:1.1.4--py38hbff2b2d_1' }"
@@ -42,7 +42,7 @@ process UMITOOLS_DEDUP {
cat <<-END_VERSIONS > versions.yml
"${task.process}":
- umitools: \$( umi_tools --version | sed '/version:/!d; s/.*: //' )
+ umitools: \$(umi_tools --version 2>&1 | sed 's/^.*UMI-tools version://; s/ *\$//')
END_VERSIONS
"""
@@ -56,7 +56,7 @@ process UMITOOLS_DEDUP {
cat <<-END_VERSIONS > versions.yml
"${task.process}":
- umitools: \$( umi_tools --version | sed '/version:/!d; s/.*: //' )
+ umitools: \$(umi_tools --version 2>&1 | sed 's/^.*UMI-tools version://; s/ *\$//')
END_VERSIONS
"""
}
diff --git a/modules/nf-core/umitools/dedup/meta.yml b/modules/nf-core/umitools/dedup/meta.yml
index 38d3fd465..534d4c6b0 100644
--- a/modules/nf-core/umitools/dedup/meta.yml
+++ b/modules/nf-core/umitools/dedup/meta.yml
@@ -7,8 +7,8 @@ keywords:
tools:
- umi_tools:
description: >
- UMI-tools contains tools for dealing with Unique Molecular Identifiers (UMIs)/Random Molecular Tags (RMTs) and single cell RNA-Seq cell barcodes
-
+ UMI-tools contains tools for dealing with Unique Molecular Identifiers (UMIs)/Random Molecular Tags (RMTs)
+ and single cell RNA-Seq cell barcodes
documentation: https://umi-tools.readthedocs.io/en/latest/
license: ["MIT"]
input:
@@ -61,11 +61,8 @@ output:
type: file
description: File containing software versions
pattern: "versions.yml"
+
authors:
- "@drpatelh"
- "@grst"
- "@klkeys"
-maintainers:
- - "@drpatelh"
- - "@grst"
- - "@klkeys"
diff --git a/modules/nf-core/umitools/extract/environment.yml b/modules/nf-core/umitools/extract/environment.yml
deleted file mode 100644
index 7d08ac0ec..000000000
--- a/modules/nf-core/umitools/extract/environment.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-name: umitools_extract
-channels:
- - conda-forge
- - bioconda
- - defaults
-dependencies:
- - bioconda::umi_tools=1.1.4
diff --git a/modules/nf-core/umitools/extract/main.nf b/modules/nf-core/umitools/extract/main.nf
index 4bd79e79f..2f94fa93e 100644
--- a/modules/nf-core/umitools/extract/main.nf
+++ b/modules/nf-core/umitools/extract/main.nf
@@ -3,7 +3,7 @@ process UMITOOLS_EXTRACT {
label "process_single"
label "process_long"
- conda "${moduleDir}/environment.yml"
+ conda "bioconda::umi_tools=1.1.4"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/umi_tools:1.1.4--py38hbff2b2d_1' :
'biocontainers/umi_tools:1.1.4--py38hbff2b2d_1' }"
@@ -33,7 +33,7 @@ process UMITOOLS_EXTRACT {
cat <<-END_VERSIONS > versions.yml
"${task.process}":
- umitools: \$( umi_tools --version | sed '/version:/!d; s/.*: //' )
+ umitools: \$(umi_tools --version 2>&1 | sed 's/^.*UMI-tools version://; s/ *\$//')
END_VERSIONS
"""
} else {
@@ -49,7 +49,7 @@ process UMITOOLS_EXTRACT {
cat <<-END_VERSIONS > versions.yml
"${task.process}":
- umitools: \$( umi_tools --version | sed '/version:/!d; s/.*: //' )
+ umitools: \$(umi_tools --version 2>&1 | sed 's/^.*UMI-tools version://; s/ *\$//')
END_VERSIONS
"""
}
diff --git a/modules/nf-core/umitools/extract/meta.yml b/modules/nf-core/umitools/extract/meta.yml
index 7695b2717..db64a0f88 100644
--- a/modules/nf-core/umitools/extract/meta.yml
+++ b/modules/nf-core/umitools/extract/meta.yml
@@ -1,16 +1,15 @@
name: umitools_extract
description: Extracts UMI barcode from a read and add it to the read name, leaving any sample barcode in place
keywords:
- - UMI
- - barcode
- - extract
- umitools
+ - extract
tools:
- umi_tools:
description: >
- UMI-tools contains tools for dealing with Unique Molecular Identifiers (UMIs)/Random Molecular Tags (RMTs) and single cell RNA-Seq cell barcodes
+ UMI-tools contains tools for dealing with Unique Molecular Identifiers (UMIs)/Random Molecular Tags (RMTs)
+ and single cell RNA-Seq cell barcodes
documentation: https://umi-tools.readthedocs.io/en/latest/
- license: "MIT"
+ license: ["MIT"]
input:
- meta:
type: map
@@ -30,7 +29,9 @@ output:
- reads:
type: file
description: >
- Extracted FASTQ files. | For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. | For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz.
+ Extracted FASTQ files. |
+ For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. |
+ For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz.
pattern: "*.{fastq.gz}"
- log:
type: file
@@ -40,9 +41,7 @@ output:
type: file
description: File containing software versions
pattern: "versions.yml"
+
authors:
- "@drpatelh"
- "@grst"
-maintainers:
- - "@drpatelh"
- - "@grst"
diff --git a/modules/nf-core/umitools/extract/tests/main.nf.test b/modules/nf-core/umitools/extract/tests/main.nf.test
deleted file mode 100644
index 22242d1df..000000000
--- a/modules/nf-core/umitools/extract/tests/main.nf.test
+++ /dev/null
@@ -1,35 +0,0 @@
-nextflow_process {
-
- name "Test Process UMITOOLS_EXTRACT"
- script "../main.nf"
- process "UMITOOLS_EXTRACT"
- config "./nextflow.config"
- tag "modules_nfcore"
- tag "modules"
- tag "umitools"
- tag "umitools/extract"
-
- test("Should run without failures") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- input[0] = [ [ id:'test', single_end:true ], // meta map
- [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ]
- ]
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out.versions).match("versions") }
- )
- }
-
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/umitools/extract/tests/main.nf.test.snap b/modules/nf-core/umitools/extract/tests/main.nf.test.snap
deleted file mode 100644
index 6d5944f1d..000000000
--- a/modules/nf-core/umitools/extract/tests/main.nf.test.snap
+++ /dev/null
@@ -1,10 +0,0 @@
-{
- "versions": {
- "content": [
- [
- "versions.yml:md5,5a18da2d3a5a4de15e7aaae9082d7abb"
- ]
- ],
- "timestamp": "2023-12-08T09:41:43.540658352"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/umitools/extract/tests/nextflow.config b/modules/nf-core/umitools/extract/tests/nextflow.config
deleted file mode 100644
index c866f5a00..000000000
--- a/modules/nf-core/umitools/extract/tests/nextflow.config
+++ /dev/null
@@ -1,9 +0,0 @@
-process {
-
- publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
-
- withName: UMITOOLS_EXTRACT {
- ext.args = '--bc-pattern="NNNN"'
- }
-
-}
diff --git a/modules/nf-core/umitools/extract/tests/tags.yml b/modules/nf-core/umitools/extract/tests/tags.yml
deleted file mode 100644
index c3fb23de4..000000000
--- a/modules/nf-core/umitools/extract/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-umitools/extract:
- - modules/nf-core/umitools/extract/**
diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/meta.yml b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/meta.yml
index e655484e7..f11e7ab6f 100644
--- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/meta.yml
+++ b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/meta.yml
@@ -53,9 +53,7 @@ output:
description: |
Files containing software versions
Structure: [ path(versions.yml) ]
+
authors:
- "@drpatelh"
- "@KamilMaliszArdigen"
-maintainers:
- - "@drpatelh"
- - "@KamilMaliszArdigen"
diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test
deleted file mode 100644
index e3214d4f2..000000000
--- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test
+++ /dev/null
@@ -1,51 +0,0 @@
-nextflow_workflow {
-
- name "Test Workflow BAM_DEDUP_STATS_SAMTOOLS_UMITOOLS"
- script "../main.nf"
- workflow "BAM_DEDUP_STATS_SAMTOOLS_UMITOOLS"
- tag "subworkflows"
- tag "subworkflows_nfcore"
- tag "subworkflows/bam_dedup_stats_samtools_umitools"
- tag "subworkflows/bam_stats_samtools"
- tag "bam_dedup_stats_samtools_umitools"
- tag "bam_stats_samtools"
- tag "samtools"
- tag "samtools/index"
- tag "samtools/stats"
- tag "samtools/idxstats"
- tag "samtools/flagstat"
- tag "umitools"
- tag "umitools/dedup"
-
- test("sarscov2_bam_bai") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- workflow {
- """
- input[0] = [
- [ id:'test'], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
- ]
- input[1] = false
- """
- }
- }
-
- then {
- assertAll(
- { assert workflow.success},
- { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"},
- { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"},
- { assert snapshot(workflow.out.stats).match("test_bam_dedup_stats_samtools_umitools_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_dedup_stats_samtools_umitools_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_dedup_stats_samtools_umitools_idxstats") }
- )
- }
-
- }
-
-}
diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap
deleted file mode 100644
index 036a63bbe..000000000
--- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap
+++ /dev/null
@@ -1,41 +0,0 @@
-{
- "test_bam_dedup_stats_samtools_umitools_idxstats": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.idxstats:md5,1adb27b52d4d64b826f48b59d61dcd4d"
- ]
- ]
- ],
- "timestamp": "2023-11-06T09:58:40.394333937"
- },
- "test_bam_dedup_stats_samtools_umitools_flagstats": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.flagstat:md5,0bb716e40fae381b97484b58e0b16efe"
- ]
- ]
- ],
- "timestamp": "2023-11-06T09:58:40.385185447"
- },
- "test_bam_dedup_stats_samtools_umitools_stats": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.stats:md5,6c296bce3659651fb5a08c31db314d91"
- ]
- ]
- ],
- "timestamp": "2023-12-04T11:06:41.700472756"
- }
-}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml
deleted file mode 100644
index bfd5e023e..000000000
--- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-subworkflows/bam_dedup_stats_samtools_umitools:
- - subworkflows/nf-core/bam_dedup_stats_samtools_umitools/**
diff --git a/subworkflows/nf-core/bam_markduplicates_picard/meta.yml b/subworkflows/nf-core/bam_markduplicates_picard/meta.yml
index fe63068e6..b924596d8 100644
--- a/subworkflows/nf-core/bam_markduplicates_picard/meta.yml
+++ b/subworkflows/nf-core/bam_markduplicates_picard/meta.yml
@@ -6,6 +6,7 @@ keywords:
- bam
- sam
- cram
+
components:
- picard/markduplicates
- samtools/index
@@ -13,6 +14,7 @@ components:
- samtools/idxstats
- samtools/flagstat
- bam_stats_samtools
+
input:
- ch_bam:
description: |
@@ -58,6 +60,3 @@ output:
authors:
- "@dmarron"
- "@drpatelh"
-maintainers:
- - "@dmarron"
- - "@drpatelh"
diff --git a/subworkflows/nf-core/bam_rseqc/main.nf b/subworkflows/nf-core/bam_rseqc/main.nf
index bf530f09d..a698b30ab 100644
--- a/subworkflows/nf-core/bam_rseqc/main.nf
+++ b/subworkflows/nf-core/bam_rseqc/main.nf
@@ -28,153 +28,141 @@ workflow BAM_RSEQC {
//
// Run RSeQC bam_stat.py
//
- ch_bamstat = Channel.empty()
+ bamstat_txt = Channel.empty()
if ('bam_stat' in rseqc_modules) {
RSEQC_BAMSTAT ( ch_bam )
- ch_bamstat = RSEQC_BAMSTAT.out.txt
+ bamstat_txt = RSEQC_BAMSTAT.out.txt
ch_versions = ch_versions.mix(RSEQC_BAMSTAT.out.versions.first())
}
//
// Run RSeQC inner_distance.py
//
- ch_innerdistance = Channel.empty()
- ch_innerdistance_distance = Channel.empty()
- ch_innerdistance_freq = Channel.empty()
- ch_innerdistance_mean = Channel.empty()
- ch_innerdistance_pdf = Channel.empty()
- ch_innerdistance_rscript = Channel.empty()
+ innerdistance_distance = Channel.empty()
+ innerdistance_freq = Channel.empty()
+ innerdistance_mean = Channel.empty()
+ innerdistance_pdf = Channel.empty()
+ innerdistance_rscript = Channel.empty()
if ('inner_distance' in rseqc_modules) {
RSEQC_INNERDISTANCE ( ch_bam, ch_bed )
- ch_innerdistance_distance = RSEQC_INNERDISTANCE.out.distance
- ch_innerdistance_freq = RSEQC_INNERDISTANCE.out.freq
- ch_innerdistance_mean = RSEQC_INNERDISTANCE.out.mean
- ch_innerdistance_pdf = RSEQC_INNERDISTANCE.out.pdf
- ch_innerdistance_rscript = RSEQC_INNERDISTANCE.out.rscript
- ch_innerdistance = ch_innerdistance_distance.mix(ch_innerdistance_freq, ch_innerdistance_mean, ch_innerdistance_pdf, ch_innerdistance_rscript)
- ch_versions = ch_versions.mix(RSEQC_INNERDISTANCE.out.versions.first())
+ innerdistance_distance = RSEQC_INNERDISTANCE.out.distance
+ innerdistance_freq = RSEQC_INNERDISTANCE.out.freq
+ innerdistance_mean = RSEQC_INNERDISTANCE.out.mean
+ innerdistance_pdf = RSEQC_INNERDISTANCE.out.pdf
+ innerdistance_rscript = RSEQC_INNERDISTANCE.out.rscript
+ ch_versions = ch_versions.mix(RSEQC_INNERDISTANCE.out.versions.first())
}
//
// Run RSeQC infer_experiment.py
//
- ch_inferexperiment = Channel.empty()
+ inferexperiment_txt = Channel.empty()
if ('infer_experiment' in rseqc_modules) {
RSEQC_INFEREXPERIMENT ( ch_bam, ch_bed )
- ch_inferexperiment = RSEQC_INFEREXPERIMENT.out.txt
- ch_versions = ch_versions.mix(RSEQC_INFEREXPERIMENT.out.versions.first())
+ inferexperiment_txt = RSEQC_INFEREXPERIMENT.out.txt
+ ch_versions = ch_versions.mix(RSEQC_INFEREXPERIMENT.out.versions.first())
}
//
// Run RSeQC junction_annotation.py
//
- ch_junctionannotation = Channel.empty()
- ch_junctionannotation_bed = Channel.empty()
- ch_junctionannotation_interact_bed = Channel.empty()
- ch_junctionannotation_xls = Channel.empty()
- ch_junctionannotation_pdf = Channel.empty()
- ch_junctionannotation_events_pdf = Channel.empty()
- ch_junctionannotation_rscript = Channel.empty()
- ch_junctionannotation_log = Channel.empty()
+ junctionannotation_bed = Channel.empty()
+ junctionannotation_interact_bed = Channel.empty()
+ junctionannotation_xls = Channel.empty()
+ junctionannotation_pdf = Channel.empty()
+ junctionannotation_events_pdf = Channel.empty()
+ junctionannotation_rscript = Channel.empty()
+ junctionannotation_log = Channel.empty()
if ('junction_annotation' in rseqc_modules) {
RSEQC_JUNCTIONANNOTATION ( ch_bam, ch_bed )
- ch_junctionannotation_bed = RSEQC_JUNCTIONANNOTATION.out.bed
- ch_junctionannotation_interact_bed = RSEQC_JUNCTIONANNOTATION.out.interact_bed
- ch_junctionannotation_xls = RSEQC_JUNCTIONANNOTATION.out.xls
- ch_junctionannotation_pdf = RSEQC_JUNCTIONANNOTATION.out.pdf
- ch_junctionannotation_events_pdf = RSEQC_JUNCTIONANNOTATION.out.events_pdf
- ch_junctionannotation_rscript = RSEQC_JUNCTIONANNOTATION.out.rscript
- ch_junctionannotation_log = RSEQC_JUNCTIONANNOTATION.out.log
- ch_junctionannotation = ch_junctionannotation_bed.mix(ch_junctionannotation_interact_bed, ch_junctionannotation_xls, ch_junctionannotation_pdf, ch_junctionannotation_events_pdf, ch_junctionannotation_rscript, ch_junctionannotation_log)
- ch_versions = ch_versions.mix(RSEQC_JUNCTIONANNOTATION.out.versions.first())
+ junctionannotation_bed = RSEQC_JUNCTIONANNOTATION.out.bed
+ junctionannotation_interact_bed = RSEQC_JUNCTIONANNOTATION.out.interact_bed
+ junctionannotation_xls = RSEQC_JUNCTIONANNOTATION.out.xls
+ junctionannotation_pdf = RSEQC_JUNCTIONANNOTATION.out.pdf
+ junctionannotation_events_pdf = RSEQC_JUNCTIONANNOTATION.out.events_pdf
+ junctionannotation_rscript = RSEQC_JUNCTIONANNOTATION.out.rscript
+ junctionannotation_log = RSEQC_JUNCTIONANNOTATION.out.log
+ ch_versions = ch_versions.mix(RSEQC_JUNCTIONANNOTATION.out.versions.first())
}
//
// Run RSeQC junction_saturation.py
//
- ch_junctionsaturation = Channel.empty()
- ch_junctionsaturation_pdf = Channel.empty()
- ch_junctionsaturation_rscript = Channel.empty()
+ junctionsaturation_pdf = Channel.empty()
+ junctionsaturation_rscript = Channel.empty()
if ('junction_saturation' in rseqc_modules) {
RSEQC_JUNCTIONSATURATION ( ch_bam, ch_bed )
- ch_junctionsaturation_pdf = RSEQC_JUNCTIONSATURATION.out.pdf
- ch_junctionsaturation_rscript = RSEQC_JUNCTIONSATURATION.out.rscript
- ch_junctionsaturation = ch_junctionsaturation_pdf.mix(ch_junctionsaturation_rscript)
- ch_versions = ch_versions.mix(RSEQC_JUNCTIONSATURATION.out.versions.first())
+ junctionsaturation_pdf = RSEQC_JUNCTIONSATURATION.out.pdf
+ junctionsaturation_rscript = RSEQC_JUNCTIONSATURATION.out.rscript
+ ch_versions = ch_versions.mix(RSEQC_JUNCTIONSATURATION.out.versions.first())
}
//
// Run RSeQC read_distribution.py
//
- ch_readdistribution = Channel.empty()
+ readdistribution_txt = Channel.empty()
if ('read_distribution' in rseqc_modules) {
RSEQC_READDISTRIBUTION ( ch_bam, ch_bed )
- ch_readdistribution = RSEQC_READDISTRIBUTION.out.txt
- ch_versions = ch_versions.mix(RSEQC_READDISTRIBUTION.out.versions.first())
+ readdistribution_txt = RSEQC_READDISTRIBUTION.out.txt
+ ch_versions = ch_versions.mix(RSEQC_READDISTRIBUTION.out.versions.first())
}
//
// Run RSeQC read_duplication.py
//
- ch_readduplication = Channel.empty()
- ch_readduplication_seq_xls = Channel.empty()
- ch_readduplication_pos_xls = Channel.empty()
- ch_readduplication_pdf = Channel.empty()
- ch_readduplication_rscript = Channel.empty()
+ readduplication_seq_xls = Channel.empty()
+ readduplication_pos_xls = Channel.empty()
+ readduplication_pdf = Channel.empty()
+ readduplication_rscript = Channel.empty()
if ('read_duplication' in rseqc_modules) {
RSEQC_READDUPLICATION ( ch_bam )
- ch_readduplication_seq_xls = RSEQC_READDUPLICATION.out.seq_xls
- ch_readduplication_pos_xls = RSEQC_READDUPLICATION.out.pos_xls
- ch_readduplication_pdf = RSEQC_READDUPLICATION.out.pdf
- ch_readduplication_rscript = RSEQC_READDUPLICATION.out.rscript
- ch_readduplication = ch_readduplication_seq_xls.mix(ch_readduplication_pos_xls, ch_readduplication_pdf, ch_readduplication_rscript)
- ch_versions = ch_versions.mix(RSEQC_READDUPLICATION.out.versions.first())
+ readduplication_seq_xls = RSEQC_READDUPLICATION.out.seq_xls
+ readduplication_pos_xls = RSEQC_READDUPLICATION.out.pos_xls
+ readduplication_pdf = RSEQC_READDUPLICATION.out.pdf
+ readduplication_rscript = RSEQC_READDUPLICATION.out.rscript
+ ch_versions = ch_versions.mix(RSEQC_READDUPLICATION.out.versions.first())
}
//
// Run RSeQC tin.py
//
- ch_tin = Channel.empty()
+ tin_txt = Channel.empty()
if ('tin' in rseqc_modules) {
RSEQC_TIN ( ch_bam_bai, ch_bed )
- ch_tin = RSEQC_TIN.out.txt
+ tin_txt = RSEQC_TIN.out.txt
ch_versions = ch_versions.mix(RSEQC_TIN.out.versions.first())
}
emit:
- ch_bamstat // channel: [ val(meta), txt ]
+ bamstat_txt // channel: [ val(meta), txt ]
- ch_innerdistance
- ch_innerdistance_distance // channel: [ val(meta), txt ]
- ch_innerdistance_freq // channel: [ val(meta), txt ]
- ch_innerdistance_mean // channel: [ val(meta), txt ]
- ch_innerdistance_pdf // channel: [ val(meta), pdf ]
- ch_innerdistance_rscript // channel: [ val(meta), r ]
+ innerdistance_distance // channel: [ val(meta), txt ]
+ innerdistance_freq // channel: [ val(meta), txt ]
+ innerdistance_mean // channel: [ val(meta), txt ]
+ innerdistance_pdf // channel: [ val(meta), pdf ]
+ innerdistance_rscript // channel: [ val(meta), r ]
- ch_inferexperiment // channel: [ val(meta), txt ]
+ inferexperiment_txt // channel: [ val(meta), txt ]
- ch_junctionannotation
- ch_junctionannotation_bed // channel: [ val(meta), bed ]
- ch_junctionannotation_interact_bed // channel: [ val(meta), bed ]
- ch_junctionannotation_xls // channel: [ val(meta), xls ]
- ch_junctionannotation_pdf // channel: [ val(meta), pdf ]
- ch_junctionannotation_events_pdf // channel: [ val(meta), pdf ]
- ch_junctionannotation_rscript // channel: [ val(meta), r ]
- ch_junctionannotation_log // channel: [ val(meta), log ]
+ junctionannotation_bed // channel: [ val(meta), bed ]
+ junctionannotation_interact_bed // channel: [ val(meta), bed ]
+ junctionannotation_xls // channel: [ val(meta), xls ]
+ junctionannotation_pdf // channel: [ val(meta), pdf ]
+ junctionannotation_events_pdf // channel: [ val(meta), pdf ]
+ junctionannotation_rscript // channel: [ val(meta), r ]
+ junctionannotation_log // channel: [ val(meta), log ]
- ch_junctionsaturation
- ch_junctionsaturation_pdf // channel: [ val(meta), pdf ]
- ch_junctionsaturation_rscript // channel: [ val(meta), r ]
+ junctionsaturation_pdf // channel: [ val(meta), pdf ]
+ junctionsaturation_rscript // channel: [ val(meta), r ]
- ch_readdistribution // channel: [ val(meta), txt ]
+ readdistribution_txt // channel: [ val(meta), txt ]
- ch_readduplication
- ch_readduplication_seq_xls // channel: [ val(meta), xls ]
- ch_readduplication_pos_xls // channel: [ val(meta), xls ]
- ch_readduplication_pdf // channel: [ val(meta), pdf ]
- ch_readduplication_rscript // channel: [ val(meta), r ]
+ readduplication_seq_xls // channel: [ val(meta), xls ]
+ readduplication_pos_xls // channel: [ val(meta), xls ]
+ readduplication_pdf // channel: [ val(meta), pdf ]
+ readduplication_rscript // channel: [ val(meta), r ]
- ch_tin // channel: [ val(meta), txt ]
+ tin_txt // channel: [ val(meta), txt ]
- versions = ch_versions // channel: [ versions.yml ]
+ versions = ch_versions // channel: [ versions.yml ]
}
diff --git a/subworkflows/nf-core/bam_rseqc/meta.yml b/subworkflows/nf-core/bam_rseqc/meta.yml
index 2fef88737..428b83e6d 100644
--- a/subworkflows/nf-core/bam_rseqc/meta.yml
+++ b/subworkflows/nf-core/bam_rseqc/meta.yml
@@ -12,16 +12,8 @@ keywords:
- readdistribution
- readduplication
- tin
-components:
+modules:
- rseqc
- - rseqc/tin
- - rseqc/readduplication
- - rseqc/readdistribution
- - rseqc/junctionsaturation
- - rseqc/junctionannotation
- - rseqc/innerdistance
- - rseqc/inferexperiment
- - rseqc/bamstat
input:
- meta:
type: map
@@ -46,107 +38,91 @@ input:
List of rseqc modules to run
e.g. [ 'bam_stat', 'infer_experiment' ]
output:
- - ch_bamstat:
+ - bamstat_txt:
type: file
description: bam statistics report
pattern: "*.bam_stat.txt"
- - ch_innerdistance:
- type: file
- description: All the output files from RSEQC_INNERDISTANCE
- pattern: "*.{txt,pdf,R}"
- - ch_innerdistance_distance:
+ - innerdistance_distance:
type: file
description: the inner distances
pattern: "*.inner_distance.txt"
- - ch_innerdistance_freq:
+ - innerdistance_freq:
type: file
description: frequencies of different insert sizes
pattern: "*.inner_distance_freq.txt"
- - ch_innerdistance_mean:
+ - innerdistance_mean:
type: file
description: mean/median values of inner distances
pattern: "*.inner_distance_mean.txt"
- - ch_innerdistance_pdf:
+ - innerdistance_pdf:
type: file
description: distribution plot of inner distances
pattern: "*.inner_distance_plot.pdf"
- - ch_innerdistance_rscript:
+ - innerdistance_rscript:
type: file
description: script to reproduce the plot
pattern: "*.inner_distance_plot.R"
- - ch_inferexperiment:
+ - inferexperiment_txt:
type: file
description: infer_experiment results report
pattern: "*.infer_experiment.txt"
- - ch_junctionannotation:
- type: file
- description: All the output files from RSEQC_JUNCTIONANNOTATION
- pattern: "*.{bed,xls,pdf,R,log}"
- - ch_junctionannotation_bed:
+ - junctionannotation_bed:
type: file
description: bed file of annotated junctions
pattern: "*.junction.bed"
- - ch_junctionannotation_interact_bed:
+ - junctionannotation_interact_bed:
type: file
description: Interact bed file
pattern: "*.Interact.bed"
- - ch_junctionannotation_xls:
+ - junctionannotation_xls:
type: file
description: xls file with junction information
pattern: "*.xls"
- - ch_junctionannotation_pdf:
+ - junctionannotation_pdf:
type: file
description: junction plot
pattern: "*.junction.pdf"
- - ch_junctionannotation_events_pdf:
+ - junctionannotation_events_pdf:
type: file
description: events plot
pattern: "*.events.pdf"
- - ch_junctionannotation_rscript:
+ - junctionannotation_rscript:
type: file
description: Rscript to reproduce the plots
pattern: "*.r"
- - ch_junctionannotation_log:
+ - junctionannotation_log:
type: file
description: Log file generated by tool
pattern: "*.log"
- - ch_junctionsaturation:
- type: file
- description: All the output files from RSEQC_JUNCTIONSATURATION
- pattern: "*.{pdf,R}"
- - ch_junctionsaturation_pdf:
+ - junctionsaturation_pdf:
type: file
description: Junction saturation report
pattern: "*.pdf"
- - ch_junctionsaturation_rscript:
+ - junctionsaturation_rscript:
type: file
description: Junction saturation R-script
pattern: "*.r"
- - ch_readdistribution:
+ - readdistribution_txt:
type: file
description: the read distribution report
pattern: "*.read_distribution.txt"
- - ch_readduplication:
- type: file
- description: All the output files from RSEQC_READDUPLICATION
- pattern: "*.{xls,pdf,R}"
- - ch_readduplication_seq_xls:
+ - readduplication_seq_xls:
type: file
description: Read duplication rate determined from mapping position of read
pattern: "*seq.DupRate.xls"
- - ch_readduplication_pos_xls:
+ - readduplication_pos_xls:
type: file
description: Read duplication rate determined from sequence of read
pattern: "*pos.DupRate.xls"
- - ch_readduplication_pdf:
+ - readduplication_pdf:
type: file
description: plot of duplication rate
pattern: "*.pdf"
- - ch_readduplication_rscript:
+ - readduplication_rscript:
type: file
description: script to reproduce the plot
pattern: "*.R"
- - ch_tin:
+ - tin_txt:
type: file
description: TXT file containing tin.py results summary
pattern: "*.txt"
@@ -157,6 +133,3 @@ output:
authors:
- "@drpatelh"
- "@kevinmenden"
-maintainers:
- - "@drpatelh"
- - "@kevinmenden"
diff --git a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test
deleted file mode 100644
index 171476a91..000000000
--- a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test
+++ /dev/null
@@ -1,96 +0,0 @@
-nextflow_workflow {
-
- name "Test Workflow BAM_RSEQC"
- script "../main.nf"
- workflow "BAM_RSEQC"
- tag "subworkflows"
- tag "subworkflows_nfcore"
- tag "subworkflows/bam_rseqc"
- tag "bam_rseqc"
- tag "rseqc"
- tag "rseqc/bamstat"
- tag "rseqc/inferexperiment"
- tag "rseqc/innerdistance"
- tag "rseqc/junctionannotation"
- tag "rseqc/junctionsaturation"
- tag "rseqc/readdistribution"
- tag "rseqc/readduplication"
- tag "rseqc/tin"
-
- test("sarscov2 paired-end [bam]") {
-
- when {
- workflow {
- """
- input[0] = Channel.of([
- [ id:'test' ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
- ])
- input[1] = file(params.test_data['sarscov2']['genome']['test_bed12'], checkIfExists: true)
- input[2] = ['bam_stat', 'inner_distance', 'infer_experiment', 'junction_annotation', 'junction_saturation', 'read_distribution', 'read_duplication', 'tin']
- """
- }
- }
-
- then {
- assertAll(
- { assert workflow.success},
- { assert snapshot(workflow.out.ch_bamstat).match("bamstat")},
-
- { assert snapshot(workflow.out.ch_innerdistance.findAll { it[1].endsWith('.pdf') == false }).match("inner_distance")},
- { assert workflow.out.ch_innerdistance.any { it[1].endsWith('.pdf') && file(it[1]).exists() } },
-
- { assert snapshot(workflow.out.ch_inferexperiment).match("inferexperiment")},
-
- { assert snapshot(workflow.out.ch_junctionannotation.findAll {
- it[1].endsWith('.xls') == false &&
- it[1].endsWith('.r') == false }).match("junction_annotation")},
-
- { assert snapshot(workflow.out.ch_junctionsaturation.findAll { it[1].endsWith('.pdf') == false }).match("junction_saturation")},
- { assert workflow.out.ch_junctionsaturation.any { it[1].endsWith('.pdf') && file(it[1]).exists() } },
-
- { assert snapshot(workflow.out.ch_readdistribution).match("readdistribution")},
-
- { assert snapshot(workflow.out.ch_readduplication.findAll { it[1].endsWith('.pdf') == false }).match("read_duplication")},
- { assert workflow.out.ch_readduplication.any { it[1].endsWith('.pdf') && file(it[1]).exists() } },
-
- { assert snapshot(workflow.out.ch_tin).match("tin")},
- { assert snapshot(workflow.out.versions).match("versions")},
- )
- }
- }
-
- test("sarscov2 paired-end [bam] no modules") {
-
- when {
- workflow {
- """
- input[0] = Channel.of([
- [ id:'test' ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
- ])
- input[1] = file(params.test_data['sarscov2']['genome']['test_bed12'], checkIfExists: true)
- input[2] = []
- """
- }
- }
-
- then {
- assertAll(
- { assert workflow.success },
- { assert workflow.out.ch_bamstat.size() == 0 },
- { assert workflow.out.ch_innerdistance.size() == 0 },
- { assert workflow.out.ch_inferexperiment.size() == 0 },
- { assert workflow.out.ch_junctionannotation.size() == 0 },
- { assert workflow.out.ch_junctionsaturation.size() == 0 },
- { assert workflow.out.ch_readdistribution.size() == 0 },
- { assert workflow.out.ch_readduplication.size() == 0 },
- { assert workflow.out.ch_tin.size() == 0 },
- { assert workflow.out.versions.size() == 0 },
- )
- }
- }
-
-}
diff --git a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap
deleted file mode 100644
index 13285ef06..000000000
--- a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap
+++ /dev/null
@@ -1,151 +0,0 @@
-{
- "inner_distance": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.inner_distance.txt:md5,a1acc9def0f64a5500d4c4cb47cbe32b"
- ],
- [
- {
- "id": "test"
- },
- "test.inner_distance_freq.txt:md5,3fc037501f5899b5da009c8ce02fc25e"
- ],
- [
- {
- "id": "test"
- },
- "test.inner_distance_mean.txt:md5,58398b7d5a29a5e564f9e3c50b55996c"
- ],
- [
- {
- "id": "test"
- },
- "test.inner_distance_plot.r:md5,5859fbd5b42046d47e8b9aa85077f4ea"
- ]
- ]
- ],
- "timestamp": "2023-12-08T14:37:45.734509133"
- },
- "junction_saturation": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.junctionSaturation_plot.r:md5,caa6e63dcb477aabb169882b2f30dadd"
- ]
- ]
- ],
- "timestamp": "2023-12-08T14:37:45.825157699"
- },
- "versions": {
- "content": [
- [
- "versions.yml:md5,07b3ad789260bd746d872e7ff18153b2",
- "versions.yml:md5,59d1ee2d13b29d10549187562d8fe1e0",
- "versions.yml:md5,5eb5515f8009effdbb601170bb90ba29",
- "versions.yml:md5,71818a5705b87b9d5c2532403a436bd8",
- "versions.yml:md5,a09f406b0da71ca4291fd935e49d377d",
- "versions.yml:md5,c9124387d6090cb4c94aaa9bf0e1c321",
- "versions.yml:md5,e1e69eaa546288ace5e97285313e1420",
- "versions.yml:md5,fe3bf0ac57c99687880ee62b28a4d4df"
- ]
- ],
- "timestamp": "2023-12-08T14:37:45.942304603"
- },
- "tin": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.paired_end.sorted.summary.txt:md5,9d98447e178b89a89f6f5aba7a772fe6"
- ]
- ]
- ],
- "timestamp": "2023-12-08T14:37:45.935155313"
- },
- "bamstat": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.bam_stat.txt:md5,2675857864c1d1139b2a19d25dc36b09"
- ]
- ]
- ],
- "timestamp": "2023-12-08T14:37:45.671792186"
- },
- "inferexperiment": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.infer_experiment.txt:md5,f9d0bfc239df637cd8aeda40ade3c59a"
- ]
- ]
- ],
- "timestamp": "2023-12-08T14:37:45.747507043"
- },
- "read_duplication": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.DupRate_plot.r:md5,3c0325095cee4835b921e57d61c23dca"
- ],
- [
- {
- "id": "test"
- },
- "test.pos.DupRate.xls:md5,a859bc2031d46bf1cc4336205847caa3"
- ],
- [
- {
- "id": "test"
- },
- "test.seq.DupRate.xls:md5,ee8783399eec5a18522a6f08bece338b"
- ]
- ]
- ],
- "timestamp": "2023-12-08T14:37:45.927253593"
- },
- "junction_annotation": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.junction_annotation.log:md5,d75e0f5d62fada8aa9449991b209554c"
- ]
- ]
- ],
- "timestamp": "2023-12-08T14:37:45.757733033"
- },
- "readdistribution": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.read_distribution.txt:md5,56893fdc0809d968629a363551a1655f"
- ]
- ]
- ],
- "timestamp": "2023-12-08T14:37:45.841855468"
- }
-}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_rseqc/tests/tags.yml b/subworkflows/nf-core/bam_rseqc/tests/tags.yml
deleted file mode 100644
index c8dfce3a9..000000000
--- a/subworkflows/nf-core/bam_rseqc/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-subworkflows/bam_rseqc:
- - subworkflows/nf-core/bam_rseqc/**
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml b/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml
index e01f9ccf6..69c16be41 100644
--- a/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml
+++ b/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml
@@ -65,6 +65,3 @@ output:
authors:
- "@drpatelh"
- "@ewels"
-maintainers:
- - "@drpatelh"
- - "@ewels"
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test
deleted file mode 100644
index 59b749d8f..000000000
--- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test
+++ /dev/null
@@ -1,78 +0,0 @@
-nextflow_workflow {
-
- name "Test Workflow BAM_SORT_STATS_SAMTOOLS"
- script "../main.nf"
- workflow "BAM_SORT_STATS_SAMTOOLS"
- tag "subworkflows"
- tag "subworkflows_nfcore"
- tag "subworkflows/bam_sort_stats_samtools"
- tag "bam_sort_stats_samtools"
- tag "subworkflows/bam_stats_samtools"
- tag "bam_stats_samtools"
- tag "samtools"
- tag "samtools/index"
- tag "samtools/sort"
- tag "samtools/stats"
- tag "samtools/idxstats"
- tag "samtools/flagstat"
-
- test("test_bam_sort_stats_samtools_single_end") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- workflow {
- """
- input[0] = [ [ id:'test', single_end:false ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_single_end_bam'], checkIfExists: true)
- ]
- input[1] = [ [ id:'genome' ],
- file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert workflow.success},
- { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"},
- { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"},
- { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_single_end_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_single_end_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_single_end_idxstats") }
- )
- }
- }
-
- test("test_bam_sort_stats_samtools_paired_end") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- workflow {
- """
- input[0] = [ [ id:'test', single_end:false ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true)
- ]
- input[1] = [ [ id:'genome' ],
- file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert workflow.success},
- { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"},
- { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"},
- { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_paired_end_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_paired_end_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_paired_end_idxstats") }
- )
- }
- }
-}
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap
deleted file mode 100644
index 77afbf176..000000000
--- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap
+++ /dev/null
@@ -1,86 +0,0 @@
-{
- "test_bam_sort_stats_samtools_paired_end_flagstats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
- ]
- ]
- ],
- "timestamp": "2023-10-22T20:25:03.687121177"
- },
- "test_bam_sort_stats_samtools_paired_end_idxstats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
- ]
- ]
- ],
- "timestamp": "2023-10-22T20:25:03.709648916"
- },
- "test_bam_sort_stats_samtools_single_end_stats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.stats:md5,f281507081517414eb1a04b2d9c855b2"
- ]
- ]
- ],
- "timestamp": "2023-12-04T11:06:50.951881479"
- },
- "test_bam_sort_stats_samtools_paired_end_stats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.stats:md5,e32e7e49dce1fbe327a89e0fb7bc01b1"
- ]
- ]
- ],
- "timestamp": "2023-12-04T11:06:59.253905951"
- },
- "test_bam_sort_stats_samtools_single_end_idxstats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20"
- ]
- ]
- ],
- "timestamp": "2023-10-22T20:25:58.451364604"
- },
- "test_bam_sort_stats_samtools_single_end_flagstats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53"
- ]
- ]
- ],
- "timestamp": "2023-10-22T20:25:58.416859285"
- }
-}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml b/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml
deleted file mode 100644
index 30b69d6a4..000000000
--- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-subworkflows/bam_sort_stats_samtools:
- - subworkflows/nf-core/bam_sort_stats_samtools/**
diff --git a/subworkflows/nf-core/bam_stats_samtools/meta.yml b/subworkflows/nf-core/bam_stats_samtools/meta.yml
index 809bf736b..87863b11b 100644
--- a/subworkflows/nf-core/bam_stats_samtools/meta.yml
+++ b/subworkflows/nf-core/bam_stats_samtools/meta.yml
@@ -39,5 +39,3 @@ output:
Structure: [ path(versions.yml) ]
authors:
- "@drpatelh"
-maintainers:
- - "@drpatelh"
diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test
deleted file mode 100644
index 972108905..000000000
--- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test
+++ /dev/null
@@ -1,102 +0,0 @@
-nextflow_workflow {
-
- name "Test Workflow BAM_STATS_SAMTOOLS"
- script "../main.nf"
- workflow "BAM_STATS_SAMTOOLS"
- tag "subworkflows"
- tag "subworkflows_nfcore"
- tag "bam_stats_samtools"
- tag "subworkflows/bam_stats_samtools"
- tag "samtools"
- tag "samtools/flagstat"
- tag "samtools/idxstats"
- tag "samtools/stats"
-
- test("test_bam_stats_samtools_single_end") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- workflow {
- """
- input[0] = [ [ id:'test', single_end:true ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_single_end_sorted_bam'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_single_end_sorted_bam_bai'], checkIfExists: true)
- ]
- input[1] = [ [ id:'genome' ],
- file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert workflow.success},
- { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_single_end_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_single_end_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_single_end_idxstats") }
- )
- }
- }
-
- test("test_bam_stats_samtools_paired_end") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- workflow {
- """
- input[0] = [ [ id:'test', single_end:true ], // meta map
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
- ]
- input[1] = [ [ id:'genome' ],
- file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert workflow.success },
- { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_idxstats") }
- )
- }
- }
-
- test("test_bam_stats_samtools_paired_end_cram") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- workflow {
- """
- input[0] = [ [ id:'test', single_end:false ], // meta map
- file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
- file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
- ]
- input[1] = [ [ id:'genome' ],
- file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert workflow.success},
- { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_cram_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_cram_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_cram_idxstats") }
- )
- }
- }
-
-}
diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap
deleted file mode 100644
index d3af13769..000000000
--- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap
+++ /dev/null
@@ -1,128 +0,0 @@
-{
- "test_bam_stats_samtools_paired_end_cram_flagstats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781"
- ]
- ]
- ],
- "timestamp": "2023-11-06T09:31:26.194017574"
- },
- "test_bam_stats_samtools_paired_end_stats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.stats:md5,49e2b43344ff92bc4c02463a58f7ba4a"
- ]
- ]
- ],
- "timestamp": "2023-12-04T11:07:13.965061942"
- },
- "test_bam_stats_samtools_paired_end_flagstats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
- ]
- ]
- ],
- "timestamp": "2023-11-06T09:31:11.668517251"
- },
- "test_bam_stats_samtools_single_end_flagstats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53"
- ]
- ]
- ],
- "timestamp": "2023-11-06T09:26:10.340046381"
- },
- "test_bam_stats_samtools_paired_end_cram_idxstats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15"
- ]
- ]
- ],
- "timestamp": "2023-11-06T09:31:26.207052003"
- },
- "test_bam_stats_samtools_single_end_stats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.stats:md5,5a6667d97806e5002731e9cf23674fad"
- ]
- ]
- ],
- "timestamp": "2023-12-04T11:07:06.676820877"
- },
- "test_bam_stats_samtools_paired_end_idxstats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
- ]
- ]
- ],
- "timestamp": "2023-11-06T09:31:11.68246157"
- },
- "test_bam_stats_samtools_single_end_idxstats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20"
- ]
- ]
- ],
- "timestamp": "2023-11-06T09:26:10.349439801"
- },
- "test_bam_stats_samtools_paired_end_cram_stats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.stats:md5,2cf2fe93596ee3d74f946097b204a629"
- ]
- ]
- ],
- "timestamp": "2023-12-04T11:07:22.30295557"
- }
-}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml b/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml
deleted file mode 100644
index ec2f2d68f..000000000
--- a/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-subworkflows/bam_stats_samtools:
- - subworkflows/nf-core/bam_stats_samtools/**
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml
index 220e8db1c..f76b40261 100644
--- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml
@@ -69,10 +69,8 @@ output:
- reads:
type: file
description: >
- Extracted FASTQ files. | For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. |
-
-
-
+ Extracted FASTQ files. |
+ For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. |
For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz.
pattern: "*.{fastq.gz}"
- fastqc_html:
@@ -124,5 +122,3 @@ output:
pattern: "versions.yml"
authors:
- "@robsyme"
-maintainers:
- - "@robsyme"
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
deleted file mode 100644
index cdd73984c..000000000
--- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
+++ /dev/null
@@ -1,60 +0,0 @@
-nextflow_workflow {
-
- name "Test Workflow FASTQ_FASTQC_UMITOOLS_FASTP"
- script "../main.nf"
- workflow "FASTQ_FASTQC_UMITOOLS_FASTP"
- tag "subworkflows"
- tag "subworkflows_nfcore"
- tag "subworkflows/fastq_fastqc_umitools_fastp"
- tag "fastq_fastqc_umitools_fastp"
- tag "fastqc"
- tag "umitools/extract"
- tag "fastp"
-
-
- test("sarscov2 paired-end [fastq]") {
-
- when {
- workflow {
- """
- input[0] = [
- [ id:'test', single_end:false ], // meta map
- [
- file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
- file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
- ]
- ]
- input[1] = false // skip_fastqc
- input[2] = false // with_umi
- input[3] = false // skip_umi_extract
- input[4] = 1 // umi_discard_read
- input[5] = false // skip_trimming
- input[6] = [] // adapter_fasta
- input[7] = false // save_trimmed_fail
- input[8] = false // save_merged
- input[9] = 1 // min_trimmed_reads
- """
- }
- }
-
- then {
- assertAll(
- { assert workflow.success },
- { assert snapshot(workflow.out.reads).match("reads") },
- { assert snapshot(workflow.out.umi_log).match("umi_log") },
- { assert snapshot(workflow.out.trim_json).match("trim_json") },
- { assert snapshot(workflow.out.trim_reads_fail).match("trim_reads_fail") },
- { assert snapshot(workflow.out.trim_reads_merged).match("trim_reads_merged") },
- { assert snapshot(workflow.out.trim_read_count).match("trim_read_count") },
- { assert snapshot(workflow.out.versions).match("versions") },
-
- { assert workflow.out.fastqc_raw_html },
- { assert workflow.out.fastqc_raw_zip },
- { assert workflow.out.trim_html },
- { assert workflow.out.trim_log },
- { assert workflow.out.fastqc_trim_html },
- { assert workflow.out.fastqc_trim_zip }
- )
- }
- }
-}
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
deleted file mode 100644
index 38a65aebe..000000000
--- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
+++ /dev/null
@@ -1,81 +0,0 @@
-{
- "trim_reads_merged": {
- "content": [
- [
-
- ]
- ],
- "timestamp": "2023-11-26T02:28:26.26920982"
- },
- "trim_reads_fail": {
- "content": [
- [
-
- ]
- ],
- "timestamp": "2023-11-26T02:28:26.25861515"
- },
- "versions": {
- "content": [
- [
- "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
- "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
- "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
- ]
- ],
- "timestamp": "2023-11-26T02:28:26.30891403"
- },
- "trim_json": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
- ]
- ]
- ],
- "timestamp": "2023-11-26T02:28:26.24768259"
- },
- "reads": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
- "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
- ]
- ]
- ]
- ],
- "timestamp": "2023-12-04T11:30:32.061644815"
- },
- "umi_log": {
- "content": [
- [
-
- ]
- ],
- "timestamp": "2023-11-26T02:28:26.238536"
- },
- "trim_read_count": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- 198
- ]
- ]
- ],
- "timestamp": "2023-11-26T02:28:26.27984169"
- }
-}
\ No newline at end of file
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml
deleted file mode 100644
index 84a4b5676..000000000
--- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-subworkflows/fastq_fastqc_umitools_fastp:
- - subworkflows/nf-core/fastq_fastqc_umitools_fastp/**
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/meta.yml b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/meta.yml
index a7df97f77..e32e90f43 100644
--- a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/meta.yml
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/meta.yml
@@ -47,14 +47,13 @@ input:
type: integer
description: |
Inputs with fewer than this reads will be filtered out of the "reads" output channel
+
output:
- reads:
type: file
description: >
- Extracted FASTQ files. | For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. |
-
-
-
+ Extracted FASTQ files. |
+ For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. |
For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz.
pattern: "*.{fastq.gz}"
- fastqc_html:
@@ -96,6 +95,3 @@ output:
authors:
- "@drpatelh"
- "@KamilMaliszArdigen"
-maintainers:
- - "@drpatelh"
- - "@KamilMaliszArdigen"
diff --git a/workflows/rnaseq.nf b/workflows/rnaseq.nf
index 5827b753a..f8def2d10 100755
--- a/workflows/rnaseq.nf
+++ b/workflows/rnaseq.nf
@@ -40,15 +40,15 @@ if (!params.skip_alignment) { prepareToolIndices << params.aligner }
if (!params.skip_pseudo_alignment && params.pseudo_aligner) { prepareToolIndices << params.pseudo_aligner }
// Determine whether to filter the GTF or not
-def filterGtf =
+def filterGtf =
((
// Condition 1: Alignment is required and aligner is set
!params.skip_alignment && params.aligner
- ) ||
+ ) ||
(
// Condition 2: Pseudoalignment is required and pseudoaligner is set
!params.skip_pseudo_alignment && params.pseudo_aligner
- ) ||
+ ) ||
(
// Condition 3: Transcript FASTA file is not provided
!params.transcript_fasta
@@ -774,14 +774,14 @@ workflow RNASEQ {
PREPARE_GENOME.out.gene_bed,
rseqc_modules
)
- ch_bamstat_multiqc = BAM_RSEQC.out.ch_bamstat
- ch_inferexperiment_multiqc = BAM_RSEQC.out.ch_inferexperiment
- ch_innerdistance_multiqc = BAM_RSEQC.out.ch_innerdistance_freq
- ch_junctionannotation_multiqc = BAM_RSEQC.out.ch_junctionannotation_log
- ch_junctionsaturation_multiqc = BAM_RSEQC.out.ch_junctionsaturation_rscript
- ch_readdistribution_multiqc = BAM_RSEQC.out.ch_readdistribution
- ch_readduplication_multiqc = BAM_RSEQC.out.ch_readduplication_pos_xls
- ch_tin_multiqc = BAM_RSEQC.out.ch_tin
+ ch_bamstat_multiqc = BAM_RSEQC.out.bamstat_txt
+ ch_inferexperiment_multiqc = BAM_RSEQC.out.inferexperiment_txt
+ ch_innerdistance_multiqc = BAM_RSEQC.out.innerdistance_freq
+ ch_junctionannotation_multiqc = BAM_RSEQC.out.junctionannotation_log
+ ch_junctionsaturation_multiqc = BAM_RSEQC.out.junctionsaturation_rscript
+ ch_readdistribution_multiqc = BAM_RSEQC.out.readdistribution_txt
+ ch_readduplication_multiqc = BAM_RSEQC.out.readduplication_pos_xls
+ ch_tin_multiqc = BAM_RSEQC.out.tin_txt
ch_versions = ch_versions.mix(BAM_RSEQC.out.versions)
ch_inferexperiment_multiqc
@@ -816,7 +816,7 @@ workflow RNASEQ {
//
ch_pseudo_multiqc = Channel.empty()
ch_pseudoaligner_pca_multiqc = Channel.empty()
- ch_pseudoaligner_clustering_multiqc = Channel.empty()
+ ch_pseudoaligner_clustering_multiqc = Channel.empty()
if (!params.skip_pseudo_alignment && params.pseudo_aligner) {
if (params.pseudo_aligner == 'salmon') {
@@ -851,7 +851,7 @@ workflow RNASEQ {
ch_versions = ch_versions.mix(DESEQ2_QC_PSEUDO.out.versions)
}
}
-
+
//
// MODULE: Pipeline reporting
//
@@ -922,7 +922,7 @@ workflow.onComplete {
if (params.email || params.email_on_fail) {
NfcoreTemplate.email(workflow, params, summary_params, projectDir, log, multiqc_report, pass_mapped_reads, pass_trimmed_reads, pass_strand_check)
}
-
+
NfcoreTemplate.dump_parameters(workflow, params)
NfcoreTemplate.summary(workflow, params, log, pass_mapped_reads, pass_trimmed_reads, pass_strand_check)
|