BS-Seeker2

Homepage | Published Paper | Source code | Galaxy Toolshed | UCLA Galaxy

BS Seeker 2 is a seamless and versatile pipeline for accurately and fast mapping the bisulfite-treated short reads.

Remarkable new features ============

Reduced index for RRBS, accelerating the mapping speed and increasing mappability
Allowing local/gapped alignment with Bowtie 2, increased the mappability
Option for removing reads suffering from bisulfite conversion failure

Supports ============

Supported library types
- Whole Genome-wide Bisulfite Sequencing (WGBS)
- Reduced Representative Bisulfite Sequencing (RRBS)
Supported formats for input file
- fasta
- fastq
- qseq
- pure sequence (one-line one-sequence)
Supported alignment tools
- bowtie : Single-seed, fast, (default)
- bowtie2 : Multiple-seed, gapped-alignment
  - local alignment (default for bowtie2)
  - end-to-end alignment
- soap
Supported formats for mapping results
- BAM
- SAM
- BS-seeker

System requirements ============

Linux/Unix or Mac OS platform
One of the following short read aligners

bowtie, bowtie2, soap
Python (Version 2.6 +)

It is normally pre-installed in Linux. Type " python -V" to see the installed version.
pysam package (Version 0.6.x).

Read "Questions & Answers" if you have problem when installing this package.

Modules' descriptions ============

(0) FilterReads.py

Optional and independent module. Some reads would be extremely amplified during the PCR. This script helps you get unique reads before doing the mapping. You can decide whether or not to filter reads before doing the mapping.

####Usage :

$ python FilterReads.py
Usage: FilterReads.py -i <input> -o <output> [-k]
Author : Guo, Weilong; 2012-11-10
Unique reads for qseq/fastq/fasta/sequencce, and filter
low quality file in qseq file.

Options:
  -h, --help  show this help message and exit
  -i FILE     Name of the input qseq/fastq/fasta/sequence file
  -o FILE     Name of the output file
  -k          Would not filter low quality reads if specified

####Tip :

This step is not suggested for RRBS library, as reads from RRBS library would more likely from the same location.

(1) bs_seeker2-build.py

Module to build the index for BS-Seeker2.

####Usage :

$ python bs_seeker2-build.py -h
Usage: bs_seeker2-build.py [options]

Options:
  -h, --help            show this help message and exit
  -f FILE, --file=FILE  Input your reference genome file (fasta)
  --aligner=ALIGNER     Aligner program to perform the analysis: bowtie,
                        bowtie2, soap, rmap [Default: bowtie]
  -p PATH, --path=PATH  Path to the aligner program. Detected:
                        bowtie: ~/install/bowtie
                        bowtie2: ~/install/bowtie2
                        rmap: ~/install/rmap_/bin
                        soap: ~/install/soap/
  -d DBPATH, --db=DBPATH
                        Path to the reference genome library (generated in
                        preprocessing genome) [Default: ~/install
                        /BSseeker2/bs_utils/reference_genomes]
  -v, --version         show version of BS-Seeker2

  Reduced Representation Bisulfite Sequencing Options:
    Use this options with conjuction of -r [--rrbs]

    -r, --rrbs          Build index specially for Reduced Representation
                        Bisulfite Sequencing experiments. Genome other than
                        certain fragments will be masked. [Default: False]
    -l LOW_BOUND, --low=LOW_BOUND
                        lower bound of fragment length (excluding recognition
                        sequence such as C-CGG) [Default: 20]
    -u UP_BOUND, --up=UP_BOUND
                        upper bound of fragment length (excluding recognition
                        sequence such as C-CGG ends) [Default: 500]
    -c CUT_FORMAT, --cut-site=CUT_FORMAT
                        Cut sites of restriction enzyme. Ex: MspI(C-CGG),
                        Mael:(C-TAG), double-enzyme MspI&Mael:(C-CGG,C-TAG).
                        [Default: C-CGG]

####Example

Build genome index for WGBS using bowtie, path of bowtie should be included in $PATH
```
  python bs_seeker2-build.py -f genome.fa --aligner=bowtie
```

Build genome index for RRBS with default parameters specifying the path for bowtie2

  python bs_seeker2-build.py -f genome.fa --aligner=bowtie2 -p ~/install/bowtie2-2.0.0-beta7/ -r

Build genome index for RRBS library using bowite2, with fragment lengths ranging [40bp, 400bp]
```
  python bs_seeker2-build.py -f genome.fa -r -l 40 -u 400 --aligner=bowtie2
```
Build genome index for RRBS library for double-enzyme : MspI (C-CGG) & ApeKI (G-CWGC, where W=A|T, see IUPAC code)
```
  python bs_seeker2-build.py -f genome.fa -r -c C-CGG,G-CWGC --aligner=bowtie
```

####Tips:

Index built for BS-Seeker2 is different from the index for BS-Seeker 1. For RRBS, you need to specify "-r" in the parameters. Also, you need to specify LOW_BOUND and UP_BOUND for the range of fragment lengths according your protocol.
The fragment length is different from read length. Fragments refers to the DNA fragments which you get by size-selection step (i.e. gel-cut oor AMPure beads). Lengths of fragments are supposed to be in a range, such as [50bp,250bp].
The indexes for RRBS and WGBS are different. Also, indexes for RRBS are specific for fragment length parameters (LOW_BOUND and UP_BOUND).

(2) bs_seeker2-align.py

Module to map reads on 3-letter converted genome.

####Usage :

$ python ~/install/BSseeker2/bs_seeker2-align.py -h
Usage: bs_seeker2-align.py {-i <single> | -1 <mate1> -2 <mate2>} -g <genome.fa> [options]

Options:
  -h, --help            show this help message and exit

  For single end reads:
    -i INFILE, --input=INFILE
                        Input read file (FORMAT: sequences, qseq, fasta,
                        fastq). Ex: read.fa or read.fa.gz

  For pair end reads:
    -1 FILE, --input_1=FILE
                        Input read file, mate 1 (FORMAT: sequences, qseq,
                        fasta, fastq)
    -2 FILE, --input_2=FILE
                        Input read file, mate 2 (FORMAT: sequences, qseq,
                        fasta, fastq)
    -I MIN_INSERT_SIZE, --minins=MIN_INSERT_SIZE
                        The minimum insert size for valid paired-end
                        alignments [Default: 0]
    -X MAX_INSERT_SIZE, --maxins=MAX_INSERT_SIZE
                        The maximum insert size for valid paired-end
                        alignments [Default: 500]

  Reduced Representation Bisulfite Sequencing Options:
    -r, --rrbs          Map reads to the Reduced Representation genome
    -c pattern, --cut-site=pattern
                        Cutting sites of restriction enzyme. Ex: MspI(C-CGG),
                        Mael:(C-TAG), double-enzyme MspI&Mael:(C-CGG,C-TAG).
                        [Default: C-CGG]
    -L RRBS_LOW_BOUND, --low=RRBS_LOW_BOUND
                        Lower bound of fragment length (excluding C-CGG ends)
                        [Default: 20]
    -U RRBS_UP_BOUND, --up=RRBS_UP_BOUND
                        Upper bound of fragment length (excluding C-CGG ends)
                        [Default: 500]

  General options:
    -t TAG, --tag=TAG   [Y]es for undirectional lib, [N]o for directional
                        [Default: N]
    -s CUTNUMBER1, --start_base=CUTNUMBER1
                        The first cycle of the read to be mapped [Default: 1]
    -e CUTNUMBER2, --end_base=CUTNUMBER2
                        The last cycle of the read to be mapped [Default: 200]
    -a FILE, --adapter=FILE
                        Input text file of your adaptor sequences (to be
                        trimmed from the 3'end of the reads, ). Input one seq
                        for dir. lib., twon seqs for undir. lib. One line per
                        sequence. Only the first 10bp will be used
    --am=ADAPTER_MISMATCH
                        Number of mismatches allowed in adapter [Default: 0]
    -g GENOME, --genome=GENOME
                        Name of the reference genome (should be the same as
                        "-f" in bs_seeker2-build.py ) [ex. chr21_hg18.fa]
    -m NO_MISMATCHES, --mismatches=NO_MISMATCHES
                        Number(>=1)/Percentage([0, 1)) of mismatches in one
                        read. Ex: 4 (allow 4 mismatches) or 0.04 (allow 4%
                        mismatches) [Default: 4]
    --aligner=ALIGNER   Aligner program for short reads mapping: bowtie,
                        bowtie2, soap, rmap [Default: bowtie]
    -p PATH, --path=PATH
                        Path to the aligner program. Detected:
                        bowtie: ~/install/bowtie
                        bowtie2: ~/install/bowtie2
                        rmap: ~/install/rmap/bin
                        soap: ~/install/soap/
    -d DBPATH, --db=DBPATH
                        Path to the reference genome library (generated in
                        preprocessing genome) [Default: ~/i
                        nstall/BSseeker2/bs_utils/reference_genomes]
    -l INT, --split_line=INT
                        Number of lines per split (the read file will be split
                        into small files for mapping. The result will be
                        merged. [Default: 4000000]
    -o OUTFILE, --output=OUTFILE
                        The name of output file [INFILE.bs(se|pe|rrbs)]
    -f FORMAT, --output-format=FORMAT
                        Output format: bam, sam, bs_seeker1 [Default: bam]
    --no-header         Suppress SAM header lines [Default: False]
    --temp_dir=PATH     The path to your temporary directory [Detected: /tmp]
    --XS=XS_FILTER      Filter definition for tag XS, format X,Y. X=0.8 and
                        y=5 indicate that for one read, if #(mCH sites)/#(all
                        CH sites)>0.8 and #(mCH sites)>5, then tag XS=1; or
                        else tag XS=0. [Default: 0.5,5]
    -M FileName, --multiple-hit=FileName
                        File to store reads with multiple-hits
    -u FileName, --unmapped=FileName
                        File to store unmapped reads
    -v, --version       show version of BS-Seeker2

  Aligner Options:
    You may specify any additional options for the aligner. You just have
    to prefix them with --bt- for bowtie, --bt2- for bowtie2, --soap- for
    soap, --rmap- for rmap, and BS-Seeker2 will pass them on. For example:
    --bt-p 4 will increase the number of threads for bowtie to 4, --bt--
    tryhard will instruct bowtie to try as hard as possible to find valid
    alignments when they exist, and so on.

####Examples :

WGBS library ; alignment mode, bowtie ; map to WGBS index

  python bs_seeker2-align.py -i WGBS.fa --aligner=bowtie -o WGBS.bam -f bam -g genome.fa

WGBS library ; alignment mode, bowtie2-local ; map to WGBS index

  python bs_seeker2-align.py -i WGBS.fa --aligner=bowtie2 -o WGBS.bam -f bam -g genome.fa

WGBS library ; alignment mode, bowtie2-end-to-end ; map to WGBS index

  python bs_seeker2-align.py -i WGBS.fa -m 3 --aligner=bowtie2 -o WGBS.bam -f bam -g genome.fa --bt2--end-to-end

RRBS library ; alignment mode, bowtie ; map to RR index

  python bs_seeker2-align.py -i RRBS.fa --aligner=bowtie -o RRBS.bam -g genome.fa -r -a adapter.txt

RRBS library ; alignment mode, bowtie ; map to WG index

  python bs_seeker2-align.py -i RRBS.fa --aligner=bowtie -o RRBS.bam -g genome.fa -a adapter.txt

RRBS library ; alignment mode, bowtie2-end-to-end ; map to WG index

  python bs_seeker2-align.py -i RRBS.fa --aligner=bowtie -o RRBS.bam -g genome.fa -a adapter.txt --bt2--end-to-end

Align from qseq format for RRBS with bowtie, specifying lengths of fragments ranging [40bp, 400bp]

  python bs_seeker2-align.py -i RRBS.qseq --aligner=bowtie -o RRBS.bam -f bam -g genome.fa -r --low=40 --up=400 -a adapter.txt

The parameters '--low' and '--up' should be the same with corresponding parameters when building the genome index

WGBS library ; alignment mode, bowtie ; map to WGBS index; use 8 threads for alignment

  python bs_seeker2-align.py -i WGBS.fa --aligner=bowtie -o WGBS.bam -f bam -g genome.fa --bt-p 4

BS-Seeker2 will run TWO bowtie instances in parallel.

####Input file:

Adapter.txt (example for single-end WGBS / RRBS) :
```
      AGATCGGAAGAGCACACGTC
```

Adapter.txt (example for paired-end WGBS) :

      <adapter for mate 1>
      <adapter for mate 2>

####Output format:

SAM format

Sample:

  10918   0       chr1    133859922       255     100M    *       0       0       TGGTTGTTTTTGTTATAGTTTTTTGTTGTAGAGTTTTTTTTGGAAAGTTGTGTTTATTTTTTTTTTTGTTTGGGTTTTGTTTGAAAGGGGTGGATGAGTT        *       XO:Z:+FW        XS:i:0  NM:i:3  XM:Z:x--yx-zzzy--y--y--zz-zyx-yx-y--------z------------x--------z--zzz----y----y--x-zyx--------y--------z   XG:Z:-C_CGGCCGCCCCTGCTGCAGCCTCCCGCCGCAGAGTTTTCTTTGGAAAGTTGCGTTTATTTCTTCCCTTGTCTGGGCTGCGCCCGAAAGGGGCAGATGAGTC_AC

Format descriptions:

  BS-Seeker2 specific tags:
  XO : orientation, from forward/reverted
  XS : 1 when read is recognized as not fully converted by bisulfite treatment, or else 0
  XM : number of sites for mismatch
          X: methylated CG
          x: un-methylated CG
          Y: methylated CHG
          y: un-methylated CHG
          Z: methylated CHH
          z: un-methylated CHH
  XG : genome sequences, with 2bp extended on both ends, from 5' to 3'
  YR : tag only for RRBS, serial id of mapped fragment
  YS : tag only for RRBS, start position of mapped fragment
  YE : tag only for RRBS, end position of mapped fragment

  Note:
      For reads mapped on Watson(minus) strand, the 10th colum in SAM file is not the original reads but the revered sequences.

BS_Seeker format

Sample:

  read10	 1	+FW	chr1+0000169137	TC_CGGGGGTTATATGAGTGTGACGGCTGTAGCGTTAGGTGACGATGTCATCTCCGCGTTCCAAGCGTTATGTGCGCACTGAGGGACACATCCACGTTCCCGG_GG	CGGGGGTTATATGAGTGTGATGGTTGTAGCGTTAGGTGATGATGTTATTTTTGCGTTTTAAGCGTTATGTGCGTATTGAGGGATATATTTACGTTTTTGA	X-------------------x--y-----X---------x-----z--z-yx-X---zz---X--------X-z-y-------z-z--zz-X---zyx--	0	77	169135	169235
  read102	 1	+FW	chr1+0000169137	TC_CGGGGGTTATATGAGTGTGACGGCTGTAGCGTTAGGTGACGATGTCATCTCCGCGTTCCAAGCGTTATGTGCGCACTGAGGGACACATCCACGTTCCCGG_GG	CGGGGGTTATATGAGTGTGATGGTTGTAGCGTTAGGTGATGATGTTATTTTTGCGTTTTAAGCGTTATGTGCGTATTGAGGGATATATTTACGTTTTTGA	X-------------------x--y-----X---------x-----z--z-yx-X---zz---X--------X-z-y-------z-z--zz-X---zyx--	0	77	169135	169235
  read104	 0	+FW	chr1+0000325341	-C_CGGCAAACACCACGCCCCGCGATATGGCAGGATTCATGCCGACTAATGGAAAACACACCAGATGCTGGAAAGAGATAAAGGAGAGCGTTACTGCAATACT_GT	CGGTAAATATTACGTTTCGCGATATGGTAGGATTTATGTCGATTAATGGAAAATATATCAGATGTTGGAAAGAGATAAAGGAGAGCGTTATTGTAATATT	X--z---z-zz-X-zzyX-X-------y------z---yX--z----------z-z-zY-----y--------------------X----y--z----y-	0	154	325339	325509
  read105	 0	+FW	chr1+0000238994	-C_CGGCCACACAGTGAAAGGCTGGGCTGTGAGAGCTTCGGTGGAAACCAGGCCTTCACCACTTCTTCTCCCTTCAAGCCACACACAGCTGTTGCAAGTTCCG_G-	CGGTTACATAGTGAAAGGTTGGGTTGTGAGAGTTTTGGTGGAAATTAGGTTTTTATTATTTTTTTTTTTTTTAAGTTATATATAGTTGTTGTAAGTTTCG	X--zz-Z-y---------y----y--------z--x--------zy---zz--z-zz-z--z--z-zzz--z---zz-z-z-y--y-----z-----yX-	0	118	238992	239093

Format descriptions:

  (1) Read ID (from the header columns in seq/fastq/qseq/fasta file, or a serial number of the original input)
  (2) Number of mismatches between the genomic seq and the BS read list in columns 6 and 7. The bisulfite converted sites between read Ts to genomic Cs are not included.
  (3) The strand which the read may be from (+FW, +RC, -RC, -FW)
  (4) The coordinate of the mapped position, indicating [the chromosome], [the mapped strand ("+" or "-")], and [the 0-based, 5'-end coordinate of the mapped genomic sequence on the Watson strand].
  (5) BS read sequences from 5' to 3': if the reads are uniquely mapped as they were FW reads, the original reads are shown. If the reads are uniquely mapped as they were RC reads, their reverse complements are shown.
  (6) Summarized sequence of methylated sites: the methylated CG/CHG/CHH sites are marked as X/Y/Z (upper case), whereas the unmethylated CG/CHG/CHH sites are marked as x/y/z (lower case). This column is summarised directly from Columns 6 and 7.
  (7) XS tag, 1 when read is recognized as not fully converted by bisulfite treatment, or else 0
  (8) my_region_serial, tag only for RRBS, serial id of mapped fragment
  (9) my_region_start, tag only for RRBS, start position of mapped fragment
  (10) my_region_end, tag only for RRBS, end position of mapped fragment

####Tips:

Removing adapter is recommended.

If you don't know what's your parameter, please ask the person who generate the library for you.

If you are too shy to ask for it, you can try to de novo motif finding tools (such as DME and MEME) find the enriched pattern in 1000 reads.

Of course, you can also use other tools (such as cutadapt ) to remove adaptor first.
It's always better to use a wider range for fragment length.

For example, if 95% of reads come from fragments with length range [50bp, 250bp], you'd better choose [40bp, 300bp].
Fewer mismatches for the 'local alignment' mode.

As the 'local alignment', the bad sequenced bases are usually trimmed, and would not be considered by the parameter "-m". It is suggested to user fewer mismatches for the 'local alignment' mode.

(3) bs_seeker2-call_methylation.py

This module calls methylation levels from the mapping result.

####Usage:

    $ python bs_seeker2-call_methylation.py -h
    Options:
      -h, --help            show this help message and exit
      -i INFILE, --input=INFILE
                            BAM output from bs_seeker2-align.py
      -d DBPATH, --db=DBPATH
                            Path to the reference genome library (generated in
                            preprocessing genome) [Default: ~/install
                            /BSseeker2/bs_utils/reference_genomes]
      -o OUTFILE, --output-prefix=OUTFILE
                            The output prefix to create ATCGmap and wiggle files
                            [INFILE]
      --sorted              Specify when the input bam file is already sorted, the
                            sorting step will be skipped [Default: False]
      --wig=OUTFILE         The output .wig file [INFILE.wig]
      --CGmap=OUTFILE       The output .CGmap file [INFILE.CGmap]
      --ATCGmap=OUTFILE     The output .ATCGmap file [INFILE.ATCGmap]
      -x, --rm-SX           Removed reads with tag 'XS:i:1', which would be
                            considered as not fully converted by bisulfite
                            treatment [Default: False]
      --rm-CCGG             Removed sites located in CCGG, avoiding the bias
                            introduced by artificial DNA methylation status
                            'XS:i:1', which would be considered as not fully
                            converted by bisulfite treatment [Default: False]
      --rm-overlap          Removed one mate if two mates are overlapped, for
                            paired-end data [Default: False]
      --txt                 Show CGmap and ATCGmap in .gz [Default: False]
      -r READ_NO, --read-no=READ_NO
                            The least number of reads covering one site to be
                            shown in wig file [Default: 1]
      -v, --version         show version of BS-Seeker2

####Example :

-For WGBS (whole genome bisulfite sequencing):

    python bs_seeker2-call_methylation.py -i WGBS.bam -o output --db <BSseeker2_path>/bs_utils/reference_genomes/genome.fa_bowtie/

-For RRBS:

    python bs_seeker2-call_methylation.py -i RRBS.bam -o output --db <BSseeker2_path>/bs_utils/reference_genomes/genome.fa_rrbs_40_400_bowtie2/

-For RRBS and removed un-converted reads (with tag XS=1):

    python bs_seeker2-call_methylation.py -x -i RRBS.bam -o output --db <BSseeker2_path>/bs_utils/reference_genomes/genome.fa_rrbs_75_280_bowtie2/

-For RRBS and only show sites covered by at least 10 reads in WIG file:

    python bs_seeker2-call_methylation.py -r 10 -i RRBS.bam -o output --db <BSseeker2_path>/bs_utils/reference_genomes/genome.fa_rrbs_75_280_bowtie2/

The folder “genome.fa_rrbs_40_500_bowtie2” is built in the first step

####Output files:

wig file

Sample:

  variableStep chrom=chr1
  3000419	0.000000
  3000423	-0.2
  3000440	0.000000
  3000588	0.5
  3000593	-0.000000


  Format descriptions:
  WIG file format. Negative value for 2nd column indicate a Cytosine on minus strand.

CGmap file

Sample:

  chr1	G	3000851	CHH	CC	0.1	1	10
  chr1	C	3001624	CHG	CA	0.0	0	9
  chr1	C	3001631	CG	CG	1.0	5	5

Format descriptions:

  (1) chromosome
  (2) nucleotide on Watson (+) strand
  (3) position
  (4) context (CG/CHG/CHH)
  (5) dinucleotide-context (CA/CC/CG/CT)
  (6) methylation-level = #_of_C / (#_of_C + #_of_T).
  (7) #_of_C (methylated C, the count of reads showing C here)
  (8) = #_of_C + #_of_T (all Cytosines, the count of reads showing C or T here)

ATCGmap file

Sample:

  chr1	T	3009410	--	--	0	10	0	0	0	0	0	0	0	0	na
  chr1	C	3009411	CHH	CC	0	10	0	0	0	0	0	0	0	0	0.0
  chr1	C	3009412	CHG	CC	0	10	0	0	0	0	0	0	0	0	0.0
  chr1	C	3009413	CG	CG	0	10	50	0	0	0	0	0	0	0	0.83

Format descriptions:

  (1) chromosome
  (2) nucleotide on Watson (+) strand
  (3) position
  (4) context (CG/CHG/CHH)
  (5) dinucleotide-context (CA/CC/CG/CT)

  (6) - (10) plus strand
  (6) # of reads from Watson strand mapped here, support A on Watson strand
  (7) # of reads from Watson strand mapped here, support T on Watson strand
  (8) # of reads from Watson strand mapped here, support C on Watson strand
  (9) # of reads from Watson strand mapped here, support G on Watson strand
  (10) # of reads from Watson strand mapped here, support N

  (11) - (15) minus strand
  (11) # of reads from Crick strand mapped here, support A on Watson strand and T on Crick strand
  (12) # of reads from Crick strand mapped here, support T on Watson strand and A on Crick strand
  (13) # of reads from Crick strand mapped here, support C on Watson strand and G on Crick strand
  (14) # of reads from Crick strand mapped here, support G on Watson strand and C on Crick strand
  (15) # of reads from Crick strand mapped here, support N

  (16) methylation_level = #C/(#C+#T) = C8/(C7+C8) for Watson strand, =C14/(C11+C14) for Crick strand;
  "nan" means none reads support C/T at this position.

Contact Information

If you still have questions on BS-Seeker 2, or you find bugs when using BS-Seeker 2, or you have suggestions, please write email to Weilong Guo.

Questions & Answers

###(1) Performance

####QA1.1

Q: "It takes me days to do the alignment for one lane" ... (Speed-up your alignment)

A: Yes, alignment is a time-consuming work, especially because the sequencing depth is increasing. An efficient way to align is :

i. cut the original sequence file into multiple small pieces;

    Ex: split -l 4000000 input.fq

ii. align them in parallel;
iii. merge all the BAM files into a single one before running "bs-seeker2_call-methylation.py" (user "samtools merge" command).

    Ex: samtools merge out.bam in1.bam in2.bam in3.bam

####QA1.2

Q: "I would run lots of BS-Seeker2 at the same time on cluster (multiple nodes), how could I reduce the disk load?"

A: For bowtie/bowtie2, you can specify the parameter "--bt--mm"/"--bt2--mm" to use the memory-mapped I/O.

####QA1.3

Q: "How could I specify more threads/CPU"?

A: By default, BS-Seeker2 will create two bowtie/bowtie2 processes for directional library (four for un-directional library), and each process would run with 2 threads. User can change the number of total threads using parameter "--bt-p"/"--bt2-p". For example, "--bt-p 4" will require 8 CPUs in total.

####QA1.4

Q: "I check my storage using $df –Th. and /tmp storage using 100%. Why these happening?"

A: You can solve it by specifying the parameter "--temp_dir=<your_path>". By default, BS-Seeker2 will save the temporary files under /tmp, and delete them when finishing. If your system's storage is not enough, try to replace <your_path> by another folder with enough space. Also don't forget to delete the files be saved in your /tmp folders, which was failed to be deleted as the previous process exit improperly.

###(2) Input/Output formats

####QA2.1

Q: Is the read sequence in BAM/SAM file is the same as my original one?

A: NO. They are different for several reasons.

i. For RRBS, some reads are short because of trimming of the adapters
ii. For read mapping on Crick (-) strand, the reads are in fact the complementary of the original sequence, opposite both in nucleotides and direction

####QA2.2

Q: In CGmap files, why some lines shown "--" but not a motif (CG/CHG/CHH), for example:

chr01   C       4303711 --      CC      0.0     0       2
chr01   C       4303712 --      CN      0.0     0       2

A: In this example, the site 4303713 is "N" in genome, thus we could not decide the explict pattern.

####QA2.3

Q: Can BS Seeker 2 accept gzipped INPUT files?

A: From v2.0.5, BS-Seeker2 is able to support input file in gzipped format, with file name end in ".gz".

####QA2.4

Q: Each of my CGmap files has between 1,000 and 2,000 positions at which the nucleotide is given without a motif, but instead just "--" for example:

    chr01   C       4303711 --      CC      0.0     0       2
    chr01   C       4303712 --      CN      0.0     0       2

A: That's because chr1:4303713 on reference genome is 'N'. BS-Seeker2 can not tell it as "CHG" or "CHH".

###(3) "Pysam" package related problem

####QA3.1

Q: I'm normal account user for Linux(Cluster). I can't install "pysam". I get following error massages:

    $ python setup.py install
    running install
    error: can't create or remove files in install directory
    The following error occurred while trying to add or remove files in the
    installation directory:
        [Errno 13] Permission denied: '/usr/lib64/python2.6/site-packages/test-easy-install-26802.write-test'
    ...

A: You can ask the administrator of your cluster to install pysam. If you don't want to bother him/her, you might need to build your own python, and then install the "pysam" package. The following script could be helpful for you.

    mkdir ~/install
    cd ~/install/

    # install python
    wget http://www.python.org/ftp/python/2.7.4/Python-2.7.4.tgz # download the python from websites
    tar zxvf Python-2.7.4.tgz # decompress
    cd Python-2.7.4
    ./configure --prefix=`pwd`
    make
    make install

    # Add the path of Python to $PATH
    #  Please add the following line to file ~/.bashrc

        export PATH=~/install/Python-2.7.4:$PATH

    # save the ~/.bashrc file
    source ~/.bashrc

    # install pysam package
    wget https://pysam.googlecode.com/files/pysam-0.7.4.tar.gz
    tar zxvf pysam-0.7.4.tar.gz
    cd pysam-0.7.4
    python setup.py build
    python setup.py install
    # re-login the shell after finish installing pysam

    # install BS-Seeker2
    wget https://github.com/BSSeeker/BSseeker2/archive/master.zip
    mv master BSSeeker2.zip
    unzip BSSeeker2.zip
    cd BSseeker2-master/

####QA3.2

Q: I came up with the errors

    Traceback (most recent call last):
      File "bs_seeker2-align.py", line 390, in <module>
        options.Output_multiple_hit
      File "bs_align/bs_pair_end.py", line 904, in bs_pair_end
        output_genome = output_genome_1, rnext = mapped_chr, pnext = mapped_location_2)
      File "bs_align/output.py", line 112, in store2
        a.rnext = rnext if rnext == -1 else self.chrom_ids[rnext]
    AttributeError: 'csamtools.AlignedRead' object has no attribute 'rnext'

A: Your pysam seems out of date. I would use pysam version 0.6.x.

####QA3.3

Q: I came up with the following error:

    Traceback (most recent call last):
      File "BSseeker2/bs_seeker2-align.py", line 279, in <module>
        options.Output_multiple_hit
      File "BSseeker2/bs_align/bs_rrbs.py", line 210, in bs_rrbs
        seq=l[8]
    IndexError: list index out of range

A: It is very likely that your input file is in a wrong format.

####QA3.4

Q: When running bs_seeker2-call_methylation.py with -x option, an error occurred as following:

    Traceback (most recent call last):
      File "/BSseeker2/bs_seeker2-call_methylation.py", line 144, in <module>
        if ( (options.RM_SX) and (dict(pr.alignment.tags)["XS"] == 1) ):
      File "csamtools.pyx", line 2530, in csamtools.AlignedRead.tags.__get__ (pysam/csamtools.c:22827)
    OverflowError: unsigned byte integer is less than minimum

A: This error is related with pysam version. Testing using pysam v0.6.x would not have such error. People reports such error when using pysam v0.7.4. We haven't test other pysam versions, and are very glad if you could tell us whether it works on other versions.

####QA3.5

Q: What's my pysam version?

A: Open python interpreter, and enter the following commands:

    >>import pysam
    >>pysam.__version__

###(4) Configuration of BS-Seeker2

####QA4.1

Q: Can I add the path of BS-Seeker2's *.py to the $PATH, so I can call BS-Seeker2 from anywhere?

A: If you're using the "python" from path "/usr/bin/python", you can directly add the path of BS-Seeker2 in file "~~/.bash_profile" (bash) or "~~/.profile" (other shell) or "~/.bashrc" (per-interactive-shell startup). But if you are using python under other directories, you might need to modify BS-Seeker2's script first. For example, if your python path is "/my_python/python", please change the first line in "bs_seeker-build.py", "bs_seeker-align.py" and "bs_seeker-call_methylation.py" to

    #!/my_python/python

Then add

    export PATH=/path/to/BS-Seeker2/:$PATH

to file "~/.bash_profile" (e.g.), and source the file:

    source  ~/.bash_profile

Then you can use BS-Seeker2 globally by typing:

    bs_seeker_build.py -h
    bs_seeker-align.py -h
    bs_seeker-call_methylation.py -h

####QA4.2

Q: I used the following command:

    python bs_seeker2-align.py -i input.fastq -g genome.fa --aligner=bowtie2 -o output.txt

However, I receive the following error:

    Traceback (most recent call last):
      File "bs_seeker2-align.py", line 336, in <module>
        options.Output_multiple_hit
      File "bs_align/bs_single_end.py", line 280, in bs_single_end
        'output_file' : CG2A} ])
      File "bs_utils/utils.py", line 332, in run_in_parallel
        for i, proc in enumerate([subprocess.Popen(args = shlex.split(cmd), stdout = stdout) for cmd, stdout in commands]):
      File "Python-2.6.9/Lib/subprocess.py", line 623, in __init__
        errread, errwrite)
      File "Python-2.6.9/Lib/subprocess.py", line 1141, in _execute_child
        raise child_exception
    OSError: [Errno 2] No such file or directory

A: This error message indicate that you haven't install bowtie2, or you haven't made bowtie2 been included in $PATH.

###(5) Unique alignment

####QA5.1

Q: If I want to only keep alignments that map uniquely, is this an argument I should supply directly to Bowtie2 (via BS Seeker 2's command line option), or is this an option that's available in BS Seeker 2 itself?

A: BS-Seeker2 reports unique alignment by default already. If you want to know how many reads could have multiple hits, run BS-Seeker2 with parameter "--multiple-hit".

###(6) Paired-end sequencing alignment

####QA6.1

Q: What should I do if the two mates have overlaps? Ex: fragment length=150bp, two mates are in length of 100bp

A: I suggest a pre-step for merging two overlapped reads into one. Such tools include SeqPrep, Stitch, etc.

####QA6.2

Q: Any recommendation for mapping paired-end BS-seq data?

A: For paired-end BS-seq data, mapping each mate in single-end mode is recommended.

For methylC-seq or RRBS library, you can run following commands:

    bs_seeker-align.py -i mate_1.fq -o mate_1.bam ....           # align the mate 1 as single-end mode
    Antisense.py -i mate_2.fq -o mate_2.anti.fq                  # convert the mate 2 to antisense sequences
    bs_seeker-align.py -i mate_2.anti.fq -o mate_2.bam ....      # align the mate 2 as single-end mode
    samtools merge merge.bam mate_1.bam mate_2.bam               # merge the bam files together
    bs_seeker2-call_methylation.py -i merge.bam --rm-overlap ... # call the methylation levels

For PBAT library, you can run following commands:

    Antisense.py -i mate_1.fq -o mate_1.anti.fq                  # convert the mate 1 to antisense sequences
    bs_seeker-align.py -i mate_1.anti.fq -o mate_1.bam ....      # align the mate 1 as single-end mode
    bs_seeker-align.py -i mate_2.fq -o mate_2.bam ....           # align the mate 2 as single-end mode
    samtools merge merge.bam mate_1.bam mate_2.bam               # merge the bam files together
    bs_seeker2-call_methylation.py -i merge.bam --rm-overlap ... # call the methylation levels

####QA6.3

Q: If the two mates in paired-end library have overlaps, will BS-Seeker2 remove the overlapped regions?

A: You can specify the parameter "--rm-overlap" when running "bs_seeker2-call_methylation.py".

    Mate1 :       ACCGCGTTGATCGAGTACGTACGTGGGTC
    Mate2 :                  GCTCATGCATGCACCCAGCGGATTACCGA
    Overlapped regions :     ==================

When specifying the parameter "--rm-overlap", the nucleotides within the overlapped regions will only be counted once.

###(7) Adapter related issue

####QA7.1

Q: What's the algorithm to remove the adapter?

A: BS-Seeker2 has built-in algorithm for removing the adapter, which is developed by Weilong Guo.

First, if the adapter was provided as "AGATCGGAAGAGCACACGTC", only the first 10bp would be used.
Second, we use semi-local alignment strategy for removing the adapters.
Exmaple:

    Read :       ACCGCGTTGATCGAGTACGTACGTGGGTC
    Adapter :    ....................ACGTGGGTCCCG

    no_mismatch : the maximum number allowed for mismatches

    Algorithm: (allowing 1 mismatch)
    -Step 1:
      ACCGCGTTGATCGAGTACGTACGTGGGTC
      ||XX
      ACGTGGGTCCCG
    -Step 2:
      ACCGCGTTGATCGAGTACGTACGTGGGTC
       X||X
      .ACGTGGGTCCCG
    -Step 3:
      ACCGCGTTGATCGAGTACGTACGTGGGTC
        XX
      ..ACGTGGGTCCCG
    -Step ...
    -Step N:
      ACCGCGTTGATCGAGTACGTACGTGGGTC
                          |||||||||
      ....................ACGTGGGTCCCG
    Success & return!

Third, we also removed the synthesized bases at the end of RRBS fragments.
Take the "C-CGG" cutting site as example,

    - - C|U G G - - =>cut=> - - C      =>add=> - - C|C G =>sequencing
    - - G G C|C - -         - - G G C          - - G G C

In our algorithm, the "CG" in "--CCG" (upper strand) was trimmed, in order to get accurate methylation level.

####QA7.2

Q: For RRBS library, the methylation levels of C at 5'-CCGG-3' sites are biased. Do BS-Seeker2 provides function for avoiding such bias?

A: From the version v2.0.7 or later, BS-Seeker2 provide parameter "--rm-CCGG" in "bs_seeker2-call-methylation.py". For RRBS library, the orginal sequences would be cut as sticky ends: 5'-CGGNNNN.....NNNNC-3' 3'-CNNNN.....NNNNGGC-5' Then artificial nucleotides will be added : 5'-CGGNNNN.....NNNNCcg-3' 3'-cgCNNNN.....NNNNGGC-5' Thus, the status of artificial cytosine will cause the bias. The parameter "--rm-CCGG" will remove all the "5'-CCGG-3'" sites in the outputs.

Name		Name	Last commit message	Last commit date
Latest commit History 43 Commits
.idea		.idea
bs_align		bs_align
bs_index		bs_index
bs_utils		bs_utils
galaxy		galaxy
AUTHORS		AUTHORS
Antisense.py		Antisense.py
FilterReads.py		FilterReads.py
LICENSE		LICENSE
README.md		README.md
RELEASE_NOTES		RELEASE_NOTES
bs_seeker2-align.py		bs_seeker2-align.py
bs_seeker2-build.py		bs_seeker2-build.py
bs_seeker2-call_methylation.py		bs_seeker2-call_methylation.py

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Repository files navigation

BS-Seeker2

(0) FilterReads.py

(1) bs_seeker2-build.py

(2) bs_seeker2-align.py

(3) bs_seeker2-call_methylation.py

Contact Information

Questions & Answers

About

Releases

Packages

Languages

License

BGI-SZ/BSseeker2

Folders and files

Latest commit

History

Repository files navigation

BS-Seeker2

(0) FilterReads.py

(1) bs_seeker2-build.py

(2) bs_seeker2-align.py

(3) bs_seeker2-call_methylation.py

Contact Information

Questions & Answers

About

Resources

License

Stars

Watchers

Forks

Releases

Packages 0

Languages

Packages