This software is still under development
Linux macOS
Requirements: A compiler that supports C++11 standard (tested with g++ version 4.7.2 or higher) and CMake version 3.1 or greater.
CMake version 3.1 or greater must be installed in a way that HFold can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:
cmake --version
If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.
Easiest way is to install homebrew and use that to install CMake.
To do so, run the following from a terminal to install homebrew:
/usr/bin/ruby -e "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install)"
When that finishes, run the following from a terminal to install CMake.
brew install cmake
Run from a terminal
wget http://www.cmake.org/files/v3.8/cmake-3.8.2.tar.gz
tar xzf cmake-3.8.2.tar.gz
cd cmake-3.8.2
./configure
make
make install
- Download the repository and extract the files onto your system.
- From a command line in the root directory (where this README.md is) run
cmake -H. -Bbuild
cmake --build build
If you need to specify a specific compiler, such as g++, you can instead run something like
cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build
This can be useful if you are getting errors about your compiler not having C++11 features.
Usage: DinoKnot [sequence1] [sequence2] [options]
Read RNA and DNA sequences from cmdline; predict minimum\nfree energy and optimum structure
--s1 Specify the first sequence
--r1 Specify the pseuodoknot-free restricted structure for sequence 1 (Will not generate other hotspots)
--s2 Specify the second sequence that the first sequence is interacting with
--r2 Specify the pseuodoknot-free restricted structure for sequence 2 (Will not generate other hotspots)
--t1 Change the type for sequence 1 to 1 (DNA) or 2 (PMO) (default is RNA)
--t2 Change the type for sequence 2 to 1 (DNA) or 2 (PMO) (default is RNA)
-p --pen Specify the penalty for the interactions between the sequences
-n --opt Specify the number of suboptimal structures to output (default is hotspot-num*hotspot-num)
-i --input-file Specify the input file
-o --output-file Specify the path to file to output the results to
-d --dir Specify the directory for which each results will have a file
--hotspot-num Specify the max number of hotspots per sequence (default is 20)
--hotspot-only Specify the path to file to output the hotspots to
Remarks:
Required arguments:
1. --s1 <sequence1>, --s2 <sequence2>
or
2. -i </path/to/file>
if -i is provided with just a file name without a path, it is assuming the file is in the diretory where the executable is called
if -o is provided with just a file name without a path, the output file will be generated in the diretory where the executable is called
--pen are mainly used when we try to tune the optimal penalty. It is currently set to 22.96551130344778 for RNA-RNA interactions (homo-dimers), 34.14979695798525 for DNA-DNA interactions (homo-dimers) and 166.0 for hybrid interactions (hetero-dimers). Change this at your own risk.
Sequence requirements:
containing only characters GCAUT
assume you are in the directory where the DinoKnot executable is located
./DinoKnot -i "file.txt" --t2 1
./DinoKnot -i "file.txt" --t2 2 -o "outputfile.txt"
./DinoKnot -i "inputfile.txt" --t2 1 -o "outputfile.txt"
./DinoKnot --s1 "GCAACGAUGACAUACAUCGCUAGUCGACGC" --r1 "(____________________________)" --s2 "GCAACGAUGACAUACAUCGCUAGUCGACGCGCAACGAUGACAUACAUCGCUAGUCGACGC" --r2 "(__________________________________________________________)"
./DinoKnot --s1 "GCAACGAUGACAUACAUCGCUAGUCGACGC" --s2 "ACGATTGTGCATCAGCTGA" --t2 2
./DinoKnot --s1 "GCAACGAUGACAUACAUCGCUAGUCGACGC" --r1 "(____________________________)" --s2 "GCAACGAUGACAUACAUCGCUAGUCGACGCGCAACGAUGACAUACAUCGCUAGUCGACGC" --r2 "(__________________________________________________________)" --t2 2 -o "outputfile.txt"
./DinoKnot --s1 GCAACGAUGACAUACAUCGCUAGUCGACGC --r1 (____________________________) --s2 GCAACGAUGACAUACAUCGCUAGUCGACGCGCAACGAUGACAUACAUCGCUAGUCGACGC --r2 (__________________________________________________________) -o file.txt
./DinoKnot --s1 "GCAACGAUGACAUACAUCGCUAGUCGACGC" --s2 "GCAACGAUGACAUACAUCGCUAGUCGACGCGCAACGAUGACAUACAUCGCUAGUCGACGC" --hotspot-only file.txt --hotspot-num 7
./DinoKnot --s1 "GCAACGAUGACAUACAUCGCUAGUCGACGC" --s2 "GCAACGAUGACAUACAUCGCUAGUCGACGCGCAACGAUGACAUACAUCGCUAGUCGACGC" --dir /home/username/Desktop/some_folder
./DinoKnot --s1 "GCAACGAUGACAUACAUCGCUAGUCGACGC" --r1 "(____________________________)" --s2 "GCAACGAUGACAUACAUCGCUAGUCGACGCGCAACGAUGACAUACAUCGCUAGUCGACGC" --r2 "(__________________________________________________________)"
Seq: GCAACGAUGACAUACAUCGCUAGUCGACGCXXXXXGCAACGAUGACAUACAUCGCUAGUCGACGCGCAACGAUGACAUACAUCGCUAGUCGACGC
Restricted_0: (____________________________).....(__________________________________________________________)
Result_0: ....(((((.....(((((...(((((([[.....]]..[[[[[.....]]]]]...))))))......))))).....)))))........... (-16.6)
./DinoKnot --s1 "GCAACGAUGACAUACAUCGCUAGUCGACGC" --s2 "GCAACGAUGACAUACAUCGCUAGUCGACGCGCAACGAUGACAUACAUCGCUAGUCGACGC" --hotspot-only file.txt --hotspot-num 7
Seq1_hotspot_0: ____(((((_____)))))___________(-2.32)
Seq1_hotspot_1: ____((((______________))))____(-1.4)
Seq1_hotspot_2: ____((((_______))))___________(-1.11)
Seq1_hotspot_3: _______((((___________))))____(-0.56)
Seq1_hotspot_4: ____(((_________)))___________(-0.32)
---------------
Seq2_hotspot_0: ______________________((((((________________________))))))__(-5.1)
Seq2_hotspot_1: ______________(((((_______________)))))_____________________(-2.65)
Seq2_hotspot_2: ______________________(((((__________________________)))))__(-2.59)
Seq2_hotspot_3: __________________((((((________________________))))))______(-2.46)
Seq2_hotspot_4: __________________________________(((((_____)))))___________(-2.32)
Seq2_hotspot_5: ____(((((_____)))))_________________________________________(-2.32)
Seq2_hotspot_6: _________________(((________)))_____________________________(-2)
For any errors when using DinoKnot, report errors to mateo2@ualberta.ca Thank you