Merge pull request #1339 from broadinstitute/lk-remove-warp-email-fro…

…m-docs Removed WARP email from docs and replaced with link to WARP issues.
broadinstitute · Jul 18, 2024 · 16d9ae6 · 16d9ae6
2 parents 25a9839 + 1bf735d
commit 16d9ae6
Show file tree

Hide file tree

Showing 27 changed files with 75 additions and 69 deletions.
diff --git a/website/blog/2021-11-09-blog1.md b/website/blog/2021-11-09-blog1.md
@@ -40,7 +40,7 @@ We recognize that some researchers might want to perform reblocking independent
 
 If you’re curious as to whether your WARP pipeline output is a reblocked GVCF, just look at the filename suffix; a reblocked GVCF will have the `.rb.g.vcf` ending. 
 
-As always, if you have any questions about working with the updated workflows, [file an issue in WARP](https://github.com/broadinstitute/warp/issues) or reach out to [the WARP team](mailto:warp-pipelines-help@broadinstitute.org ).
+As always, if you have any questions about working with the updated workflows, [file an issue in WARP](https://github.com/broadinstitute/warp/issues).
 
 ## Additional resources
 Learn more about the reblocking tool on the [GATK Support website](https://gatk.broadinstitute.org/hc/en-us/articles/4405443600667). 

diff --git a/website/docs/About_WARP/TestingPipelines.md b/website/docs/About_WARP/TestingPipelines.md
@@ -27,4 +27,4 @@ A PR will initiate a pipeline test if it contains changes to the main workflow W
 
 ## Contact us with questions about testing
 
-If you have questions about the WARP testing process, please reach out to [the WARP team](mailto:warp-pipelines-help@broadinstitute.org).
+If you have questions about the WARP testing process, please [file an issue in WARP](https://github.com/broadinstitute/warp/issues).
diff --git a/website/docs/Pipelines/ATAC/README.md b/website/docs/Pipelines/ATAC/README.md
@@ -8,7 +8,7 @@ slug: /Pipelines/ATAC/README
 
 | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [2.0.0](https://github.com/broadinstitute/warp/releases) | May, 2024 | Kaylee Mathews | Please file GitHub issues in warp or contact [the WARP team](mailto:warp-pipelines-help@broadinstitute.org) |
+| [2.0.0](https://github.com/broadinstitute/warp/releases) | May, 2024 | Kaylee Mathews | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 
 ## Introduction to the ATAC workflow

diff --git a/website/docs/Pipelines/BuildIndices_Pipeline/README.md b/website/docs/Pipelines/BuildIndices_Pipeline/README.md
@@ -7,7 +7,7 @@ slug: /Pipelines/BuildIndices_Pipeline/README
 
 | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [BuildIndices_v3.0.0](https://github.com/broadinstitute/warp/releases) | December, 2023 | Kaylee Mathews | Please file GitHub issues in warp or contact [documentation authors](mailto:warp-pipelines-help@broadinstitute.org) |
+| [BuildIndices_v3.0.0](https://github.com/broadinstitute/warp/releases) | December, 2023 | Kaylee Mathews | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 ![BuildIndices_diagram](./buildindices_diagram.png)
 
@@ -121,8 +121,8 @@ Degatano, K.; Awdeh, A.; Dingman, W.; Grant, G.; Khajouei, F.; Kiernan, E.; Konw
 ## Consortia support
 This pipeline is supported by the [BRAIN Initiative](https://braininitiative.nih.gov/) (BICCN and BICAN). 
 
-If your organization also uses this pipeline, we would like to list you! Please reach out to us by contacting the [WARP Pipeline Development team](mailto:warp-pipelines-help@broadinstitute.org).
+If your organization also uses this pipeline, we would like to list you! Please reach out to us by [filing an issue in WARP](https://github.com/broadinstitute/warp/issues).
 
 ## Feedback
 
-Please help us make our tools better by contacting the [WARP Pipelines Team](mailto:warp-pipelines-help@broadinstitute.org) for pipeline-related suggestions or questions.
+Please help us make our tools better by [filing an issue in WARP](https://github.com/broadinstitute/warp/issues) for pipeline-related suggestions or questions.
diff --git a/website/docs/Pipelines/CEMBA_MethylC_Seq_Pipeline/README.md b/website/docs/Pipelines/CEMBA_MethylC_Seq_Pipeline/README.md
@@ -7,7 +7,7 @@ slug: /Pipelines/CEMBA_MethylC_Seq_Pipeline/README
 
 | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [CEMBA_v1.1.6](https://github.com/broadinstitute/warp/releases) | December, 2023 | [Elizabeth Kiernan](mailto:ekiernan@broadinstitute.org) | Please file GitHub issues in warp or contact [the WARP team](mailto:warp-pipelines-help@broadinstitute.org) |
+| [CEMBA_v1.1.6](https://github.com/broadinstitute/warp/releases) | December, 2023 | Elizabeth Kiernan| Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 ![CEMBA](./CEMBA.png)
 
@@ -190,11 +190,11 @@ Degatano, K.; Awdeh, A.; Dingman, W.; Grant, G.; Khajouei, F.; Kiernan, E.; Konw
 ## Consortia Support
 This pipeline is supported and used by the [BRAIN Initiative Cell Census Network](https://biccn.org/) (BICCN). 
 
-If your organization also uses this pipeline, we would love to list you! Please reach out to us by contacting [the WARP team](mailto:warp-pipelines-help@broadinstitute.org).
+If your organization also uses this pipeline, we would love to list you! Please reach out to us by [filing an issue in WARP](https://github.com/broadinstitute/warp/issues).
 
 
 ## Have Suggestions?
 
-Please help us make our tools better by contacting [the WARP team](mailto:warp-pipelines-help@broadinstitute.org) for pipeline-related suggestions or questions.
+Please help us make our tools better by [filing an issue in WARP](https://github.com/broadinstitute/warp/issues); we welcome pipeline-related suggestions or questions.
 
 
diff --git a/website/docs/Pipelines/Exome_Germline_Single_Sample_Pipeline/README.md b/website/docs/Pipelines/Exome_Germline_Single_Sample_Pipeline/README.md
@@ -7,7 +7,7 @@ slug: /Pipelines/Exome_Germline_Single_Sample_Pipeline/README
 
 | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [ExomeGermlineSingleSample_v3.1.19](https://github.com/broadinstitute/warp/releases?q=ExomeGermlineSingleSample_v3.0.0&expanded=true) | March, 2024 | [Elizabeth Kiernan](mailto:ekiernan@broadinstitute.org) | Please file GitHub issues in WARP or contact [the WARP team](mailto:warp-pipelines-help@broadinstitute.org) |
+| [ExomeGermlineSingleSample_v3.1.19](https://github.com/broadinstitute/warp/releases?q=ExomeGermlineSingleSample_v3.0.0&expanded=true) | March, 2024 | Elizabeth Kiernan | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 
 The Exome Germline Single Sample pipeline implements data pre-processing and initial variant calling according to the GATK Best Practices for germline SNP and Indel discovery in human exome sequencing data.

diff --git a/website/docs/Pipelines/Genomic_Data_Commons_Whole_Genome_Somatic/README.md b/website/docs/Pipelines/Genomic_Data_Commons_Whole_Genome_Somatic/README.md
@@ -7,7 +7,7 @@ slug: /Pipelines/Genomic_Data_Commons_Whole_Genome_Somatic/README
 
 | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [GDCWholeGenomeSomaticSingleSample_v1.3.1](https://github.com/broadinstitute/warp/releases) | January, 2024 | [Elizabeth Kiernan](mailto:ekiernan@broadinstitute.org) | Please file GitHub issues in warp or contact [the WARP team](mailto:warp-pipelines-help@broadinstitute.org) |
+| [GDCWholeGenomeSomaticSingleSample_v1.3.1](https://github.com/broadinstitute/warp/releases) | January, 2024 | Elizabeth Kiernan | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 
 ## Introduction to the GDC Whole Genome Somatic Single Sample pipeline
@@ -121,7 +121,7 @@ If you use the GDC Pipeline in your research, please consider citing our preprin
 Degatano, K.; Awdeh, A.; Dingman, W.; Grant, G.; Khajouei, F.; Kiernan, E.; Konwar, K.; Mathews, K.; Palis, K.; Petrillo, N.; Van der Auwera, G.; Wang, C.; Way, J.; Pipelines, W. WDL Analysis Research Pipelines: Cloud-Optimized Workflows for Biological Data Processing and Reproducible Analysis. Preprints 2024, 2024012131. https://doi.org/10.20944/preprints202401.2131.v1
 
 ## Contact us
-Please help us make our tools better by contacting [the WARP team](mailto:warp-pipelines-help@broadinstitute.org) for pipeline-related suggestions or questions.
+Please help us make our tools better by [filing an issue in WARP](https://github.com/broadinstitute/warp/issues); we welcome pipeline-related suggestions or questions.
 
 ## Licensing
 

diff --git a/website/docs/Pipelines/Illumina_Genotyping_Arrays_Pipeline/README.md b/website/docs/Pipelines/Illumina_Genotyping_Arrays_Pipeline/README.md
@@ -7,7 +7,7 @@ slug: /Pipelines/Illumina_Genotyping_Arrays_Pipeline/README
 
 | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [Version 1.12.17](https://github.com/broadinstitute/warp/releases) | March, 2024 | [Elizabeth Kiernan](mailto:ekiernan@broadinstitute.org) | Please file GitHub issues in warp or contact [the WARP team](mailto:warp-pipelines-help@broadinstitute.org) |
+| [Version 1.12.17](https://github.com/broadinstitute/warp/releases) | March, 2024 | Elizabeth Kiernan | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 ![The Illumina Genotyping Array Pipeline](./IlluminaGenotyping.png)
 
@@ -245,7 +245,7 @@ Degatano, K.; Awdeh, A.; Dingman, W.; Grant, G.; Khajouei, F.; Kiernan, E.; Konw
 
 ## Feedback and questions
 
-Please help us make our tools better by contacting [the WARP team](mailto:warp-pipelines-help@broadinstitute.org) for pipeline-related suggestions or questions.
+Please help us make our tools better by [filing an issue in WARP](https://github.com/broadinstitute/warp/issues); we welcome pipeline-related suggestions or questions.
 
 
 
diff --git a/website/docs/Pipelines/Imputation_Pipeline/README.md b/website/docs/Pipelines/Imputation_Pipeline/README.md
@@ -7,7 +7,7 @@ slug: /Pipelines/Imputation_Pipeline/README
 
 | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [Imputation_v1.1.12](https://github.com/broadinstitute/warp/releases?q=Imputation_v1.0.0&expanded=true) | February, 2024 | [Elizabeth Kiernan](mailto:ekiernan@broadinstitute.org) | Please file GitHub issues in warp or contact [the WARP team](mailto:warp-pipelines-help@broadinstitute.org) |
+| [Imputation_v1.1.12](https://github.com/broadinstitute/warp/releases?q=Imputation_v1.0.0&expanded=true) | February, 2024 | Elizabeth Kiernan | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 ## Introduction to the Imputation pipeline
 The Imputation pipeline imputes missing genotypes from either a multi-sample VCF or an array of single sample VCFs using a large genomic reference panel. It is based on the [Michigan Imputation Server pipeline](https://imputationserver.readthedocs.io/en/latest/pipeline/). Overall, the pipeline filters, phases, and performs imputation on a multi-sample VCF. It outputs the imputed VCF along with key imputation metrics.
@@ -147,7 +147,7 @@ Degatano, K.; Awdeh, A.; Dingman, W.; Grant, G.; Khajouei, F.; Kiernan, E.; Konw
 
 ## Contact us
 
-Help us make our tools better by contacting [the WARP team](mailto:warp-pipelines-help@broadinstitute.org) for pipeline-related suggestions or questions.
+Help us make our tools better by [filing an issue in WARP](https://github.com/broadinstitute/warp/issues); we welcome pipeline-related suggestions or questions.
 
 ## Licensing
 

diff --git a/website/docs/Pipelines/JointGenotyping/README.md b/website/docs/Pipelines/JointGenotyping/README.md
@@ -7,7 +7,7 @@ slug: /Pipelines/JointGenotyping_Pipeline/README
 
 | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [JointGenotyping_v1.6.10](https://github.com/broadinstitute/warp/releases) | February, 2024 | Elizabeth Kiernan & Kaylee Mathews | Please file GitHub issues in WARP or contact [documentation authors](mailto:warp-pipelines-help@broadinstitute.org) |
+| [JointGenotyping_v1.6.10](https://github.com/broadinstitute/warp/releases) | February, 2024 | Elizabeth Kiernan & Kaylee Mathews | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 ## Introduction to the JointGenotyping workflow
 
@@ -246,4 +246,4 @@ Degatano, K.; Awdeh, A.; Dingman, W.; Grant, G.; Khajouei, F.; Kiernan, E.; Konw
 
 ## Feedback
 
-Please help us make our tools better by contacting the [WARP Pipelines Team](mailto:warp-pipelines-help@broadinstitute.org) for pipeline-related suggestions or questions.
+Please help us make our tools better by [filing an issue in WARP](https://github.com/broadinstitute/warp/issues); we welcome pipeline-related suggestions or questions.
diff --git a/website/docs/Pipelines/Multiome_Pipeline/README.md b/website/docs/Pipelines/Multiome_Pipeline/README.md
@@ -7,7 +7,7 @@ slug: /Pipelines/Multiome_Pipeline/README
 
 | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [Multiome v5.0.0](https://github.com/broadinstitute/warp/releases) | May, 2024 | Kaylee Mathews | Please file GitHub issues in warp or contact the [WARP Pipeline Development team](mailto:warp-pipelines-help@broadinstitute.org) |
+| [Multiome v5.1.0](https://github.com/broadinstitute/warp/releases) | July, 2024 | Kaylee Mathews | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 ![Multiome_diagram](./multiome_diagram.png)
 
@@ -68,18 +68,18 @@ Multiome can be deployed using [Cromwell](https://cromwell.readthedocs.io/en/sta
 | emptydrops_lower | Optional threshold for UMIs for the Optimus (GEX) pipeline that empty drops tool should consider for determining cell; data below threshold is not removed; default is "100". | Integer |
 | force_no_check | Optional boolean for the Optimus (GEX) pipeline indicating if the pipeline should perform checks; default is "false". | Boolean |
 | ignore_r1_read_length | Optional boolean for the Optimus (GEX) pipeline indicating if the pipeline should ignore barcode chemistry check; if "true", the workflow will not ensure the `10x_chemistry_version` input matches the chemistry in the read 1 FASTQ; default is "false". | Boolean |
-| star_strand_mode | Optional string for the Optimus (GEX) pipeline for performing STARsolo alignment on forward stranded, reverse stranded, or unstranded data; default is "Forward".                                                                                          | String |
-| count_exons | Optional boolean for the Optimus (GEX) pipeline indicating if the workflow should calculate exon counts **when in single-nucleus (sn_rna) mode**; if "true" in sc_rna mode, the workflow will return an error; default is "false".                         | Boolean |
-| soloMultiMappers | Optional string describing whether or not the Optimus (GEX) pipeline should run STARsolo with the `--soloMultiMappers` flag.                                                                                                                               | String |
-| atac_r1_fastq | Array of read 1 paired-end FASTQ files representing a single 10x multiome ATAC library.                                                                                                                                                                    | Array[File] |
-| atac_r2_fastq | Array of barcodes FASTQ files representing a single 10x multiome ATAC library.                                                                                                                                                                             | Array[File] |
-| atac_r3_fastq | Array of read 2 paired-end FASTQ files representing a single 10x multiome ATAC library.                                                                                                                                                                    | Array[File] |
-| tar_bwa_reference | TAR file containing the reference index files for BWA-mem alignment for the ATAC pipeline.                                                                                                                                                                 | File | 
-| chrom_sizes | File containing the genome chromosome sizes; used to calculate ATAC fragment file metrics.                                                                                                                                                                 | File |
-| adapter_seq_read1 | Optional string describing the adapter sequence for ATAC read 1 paired-end reads to be used during adapter trimming with Cutadapt; default is "GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG".                                                                        | String |
-| adapter_seq_read3 | Optional string describing the adapter sequence for ATAC read 2 paired-end reads to be used during adapter trimming with Cutadapt; default is "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG".                                                                         | String |
-| run_cellbender | Optional boolean used to determine if the Optimus (GEX) pipeline should run CellBender on the output gene expression h5ad file, `h5ad_output_file_gex`; default is "false".                                                                                | Boolean |
-| vm_size | String defining the Azure virtual machine family for the workflow (default: "Standard_M128s").                                                                                                                                                                   | String |
+| star_strand_mode | Optional string for the Optimus (GEX) pipeline for performing STARsolo alignment on forward stranded, reverse stranded, or unstranded data; default is "Forward". | String |
+| count_exons | Optional boolean for the Optimus (GEX) pipeline indicating if the workflow should calculate exon counts **when in single-nucleus (sn_rna) mode**; if "true" in sc_rna mode, the workflow will return an error; default is "false".  | Boolean |
+| soloMultiMappers | Optional string describing whether or not the Optimus (GEX) pipeline should run STARsolo with the `--soloMultiMappers` flag. | String |
+| atac_r1_fastq | Array of read 1 paired-end FASTQ files representing a single 10x multiome ATAC library. | Array[File] |
+| atac_r2_fastq | Array of barcodes FASTQ files representing a single 10x multiome ATAC library. | Array[File] |
+| atac_r3_fastq | Array of read 2 paired-end FASTQ files representing a single 10x multiome ATAC library. | Array[File] |
+| tar_bwa_reference | TAR file containing the reference index files for BWA-mem alignment for the ATAC pipeline.  | File | 
+| chrom_sizes | File containing the genome chromosome sizes; used to calculate ATAC fragment file metrics. | File |
+| adapter_seq_read1 | Optional string describing the adapter sequence for ATAC read 1 paired-end reads to be used during adapter trimming with Cutadapt; default is "GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG". | String |
+| adapter_seq_read3 | Optional string describing the adapter sequence for ATAC read 2 paired-end reads to be used during adapter trimming with Cutadapt; default is "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG". | String |
+| run_cellbender | Optional boolean used to determine if the Optimus (GEX) pipeline should run CellBender on the output gene expression h5ad file, `h5ad_output_file_gex`; default is "false".  | Boolean |
+| vm_size | String defining the Azure virtual machine family for the workflow (default: "Standard_M128s"). | String |
 
 
 #### Sample inputs for analyses in a Terra Workspace
@@ -151,11 +151,11 @@ Degatano, K.; Awdeh, A.; Dingman, W.; Grant, G.; Khajouei, F.; Kiernan, E.; Konw
 ## Consortia support
 This pipeline is supported by the [BRAIN Initiative](https://braininitiative.nih.gov/) (BICCN and BICAN). 
 
-If your organization also uses this pipeline, we would like to list you! Please reach out to us by contacting the [WARP Pipeline Development team](mailto:warp-pipelines-help@broadinstitute.org).
+If your organization also uses this pipeline, we would like to list you! Please reach out to us by [filing an issue in WARP](https://github.com/broadinstitute/warp/issues).
 
 ## Acknowledgements
 We are immensely grateful to the members of the BRAIN Initiative (BICAN Sequencing Working Group) and SCORCH for their invaluable and exceptional contributions to this pipeline. Our heartfelt appreciation goes to Alex Dobin, Aparna Bhaduri, Alec Wysoker, Anish Chakka, Brian Herb, Daofeng Li, Fenna Krienen, Guo-Long Zuo, Jeff Goldy, Kai Zhang, Khalid Shakir, Bo Li, Mariano Gabitto, Michael DeBerardine, Mengyi Song, Melissa Goldman, Nelson Johansen, James Nemesh, and Theresa Hodges for their unwavering dedication and remarkable efforts. 
 
 ## Feedback
 
-Please help us make our tools better by contacting the [WARP Pipeline Development team](mailto:warp-pipelines-help@broadinstitute.org) for pipeline-related suggestions or questions.
+Please help us make our tools better by [filing an issue in WARP](https://github.com/broadinstitute/warp/issues); we welcome pipeline-related suggestions or questions.