nucleotide-count uses xtest

exercises/practice/nucleotide-count/nucleotide-count.spec.js

@@ -53,23 +53,23 @@ describe("count all nucleotides in a strand", () => {
     expect(countNucleotides("")).toEqual([0, 0, 0, 0]);
   });
 
-  test("can count one nucleotide in single-character input", () => {
+  xtest("can count one nucleotide in single-character input", () => {
     expect(countNucleotides("G")).toEqual([0, 0, 1, 0]);
   });
 
-  test("strand with repeated nucleotide", () => {
+  xtest("strand with repeated nucleotide", () => {
     expect(countNucleotides("GGGGGGG")).toEqual([0, 0, 7, 0]);
   });
 
-  test("strand with multiple nucleotides", () => {
+  xtest("strand with multiple nucleotides", () => {
     expect(
       countNucleotides(
         "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
       )
     ).toEqual([20, 12, 17, 21]);
   });
 
-  test("strand with invalid nucleotides", () => {
+  xtest("strand with invalid nucleotides", () => {
     expect(countNucleotides("AGXXACT")).toEqual([-1, -1, -1, -1]);
   });
 });