Fix find_nams Python binding

ksahlin · Oct 2, 2024 · 30adee4 · 30adee4
1 parent b684bbf
commit 30adee4
Show file tree

Hide file tree

Showing 2 changed files with 4 additions and 4 deletions.
diff --git a/src/python/strobealign.cpp b/src/python/strobealign.cpp
@@ -160,8 +160,8 @@ NB_MODULE(strobealign_extension, m_) {
     nb::bind_vector<std::vector<Nam>>(m, "NamVector");
 
     m.def("randstrobes_query", &randstrobes_query);
-    m.def("find_nams", [](const QueryRandstrobeVector &query_randstrobes, const StrobemerIndex& index) -> std::vector<Nam> {
-        auto [nonrepetitive_fraction, n_hits, nams] = find_nams(query_randstrobes, index);
+    m.def("find_nams", [](const QueryRandstrobeVector &query_randstrobes, const StrobemerIndex& index, bool use_mcs) -> std::vector<Nam> {
+        auto [nonrepetitive_fraction, n_hits, nams] = find_nams(query_randstrobes, index, use_mcs);
         return nams;
-    });
+    }, nb::arg("query_randstrobes"), nb::arg("index"), nb::arg("use_mcs"));
 }
diff --git a/tests/test_bindings.py b/tests/test_bindings.py
@@ -34,7 +34,7 @@ def test_indexing_and_nams_finding():
     # Find NAMs for a single query sequence
     query = "TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG"
     randstrobes = strobealign.randstrobes_query(query, index_parameters)
-    nams = strobealign.find_nams(randstrobes, index)
+    nams = strobealign.find_nams(randstrobes, index, use_mcs=False)
     assert nams
     for nam in nams:
         ref = refs[nam.reference_index].sequence