Move some compression-related tests to separate module

tests/test_commandline.py

@@ -75,10 +75,6 @@ def test_example(run):
     run("-N -b ADAPTER", "example.fa", "example.fa")
 
 
-def test_compressed_fasta(run):
-    run("", "simple.fasta", "simple.fasta.gz")
-
-
 def test_small(run):
     run("-a TTAGACATATCTCCGTCG", "small.fastq", "small.fastq")
 
@@ -130,11 +126,6 @@ def test_discard_untrimmed(run):
     run("-b CAAGAT --discard-untrimmed", "discard-untrimmed.fastq", "small.fastq")
 
 
-def test_extensiontxtgz(run):
-    """automatic recognition of "_sequence.txt.gz" extension"""
-    run("-b TTAGACATATCTCCGTCG", "s_1_sequence.txt", "s_1_sequence.txt.gz")
-
-
 def test_minimum_length(run):
     """-m/--minimum-length"""
     stats = run("-m 5 -a TTAGACATATCTCCGTCG", "minlen.fa", "lengths.fa")
@@ -335,11 +326,6 @@ def test_action_crop(run):
     )
 
 
-def test_gz_multiblock(run):
-    """compressed gz file with multiple blocks (created by concatenating two .gz files)"""
-    run("-b TTAGACATATCTCCGTCG", "small.fastq", "multiblock.fastq.gz")
-
-
 def test_read_wildcard(run):
     """test wildcards in reads"""
     run("--match-read-wildcards -b ACGTACGT", "wildcard.fa", "wildcard.fa")
@@ -544,37 +530,6 @@ def test_adapter_with_u(run):
     run("-a GCCGAACUUCUUAGACUGCCUUAAGGACGU", "illumina.fastq", "illumina.fastq.gz")
 
 
-def test_bzip2_input(run, cores):
-    run(
-        ["--cores", str(cores), "-a", "TTAGACATATCTCCGTCG"],
-        "small.fastq",
-        "small.fastq.bz2",
-    )
-
-
-@pytest.mark.parametrize("extension", ["bz2", "xz", "gz"])
-def test_compressed_output(tmp_path, cores, extension):
-    out_path = str(tmp_path / ("small.fastq." + extension))
-    params = [
-        "--cores",
-        str(cores),
-        "-a",
-        "TTAGACATATCTCCGTCG",
-        "-o",
-        out_path,
-        datapath("small.fastq"),
-    ]
-    main(params)
-
-
-def test_bzip2_multiblock(run):
-    run("-b TTAGACATATCTCCGTCG", "small.fastq", "multiblock.fastq.bz2")
-
-
-def test_xz(run):
-    run("-b TTAGACATATCTCCGTCG", "small.fastq", "small.fastq.xz")
-
-
 def test_no_args():
     with pytest.raises(SystemExit):
         main([])
@@ -930,26 +885,9 @@ def test_discard_casava(run):
     assert stats.filtered["casava_filtered"] == 1
 
 
-def test_underscore(run):
-    """File name ending in _fastq.gz (issue #275)"""
-    run("-b TTAGACATATCTCCGTCG", "small.fastq", "underscore_fastq.gz")
-
-
 def test_cores_autodetect(run):
     # Just make sure that it runs; functionality is not tested
-    run("--cores 0 -b TTAGACATATCTCCGTCG", "small.fastq", "underscore_fastq.gz")
-
-
-def test_write_compressed_fastq(cores, tmp_path):
-    main(
-        [
-            "--cores",
-            str(cores),
-            "-o",
-            str(tmp_path / "out.fastq.gz"),
-            datapath("small.fastq"),
-        ]
-    )
+    run("--cores 0 -b TTAGACATATCTCCGTCG", "small.fastq", "small.fastq.gz")
 
 
 def test_minimal_report(run):

tests/test_compression.py

@@ -0,0 +1,66 @@
+import pytest
+
+from cutadapt.cli import main
+from utils import assert_files_equal, datapath, cutpath
+
+
+def test_gz_multiblock(run):
+    """compressed gz file with multiple blocks (created by concatenating two .gz files)"""
+    run("-b TTAGACATATCTCCGTCG", "small.fastq", "multiblock.fastq.gz")
+
+
+def test_extensiontxtgz(run):
+    """automatic recognition of "_sequence.txt.gz" extension"""
+    run("-b TTAGACATATCTCCGTCG", "s_1_sequence.txt", "s_1_sequence.txt.gz")
+
+
+def test_compressed_fasta(run):
+    run("", "simple.fasta", "simple.fasta.gz")
+
+
+def test_write_compressed_fastq(cores, tmp_path):
+    main(
+        [
+            "--cores",
+            str(cores),
+            "-o",
+            str(tmp_path / "out.fastq.gz"),
+            datapath("small.fastq"),
+        ]
+    )
+
+
+@pytest.mark.parametrize("extension", ["bz2", "xz", "gz"])
+def test_compressed_output(tmp_path, cores, extension):
+    out_path = str(tmp_path / ("small.fastq." + extension))
+    params = [
+        "--cores",
+        str(cores),
+        "-a",
+        "TTAGACATATCTCCGTCG",
+        "-o",
+        out_path,
+        datapath("small.fastq"),
+    ]
+    main(params)
+
+
+def test_bzip2_multiblock(run):
+    run("-b TTAGACATATCTCCGTCG", "small.fastq", "multiblock.fastq.bz2")
+
+
+def test_xz(run):
+    run("-b TTAGACATATCTCCGTCG", "small.fastq", "small.fastq.xz")
+
+
+def test_bzip2_input(run, cores):
+    run(
+        ["--cores", str(cores), "-a", "TTAGACATATCTCCGTCG"],
+        "small.fastq",
+        "small.fastq.bz2",
+    )
+
+
+def test_underscore(run):
+    """File name ending in _fastq.gz (issue #275)"""
+    run("-b TTAGACATATCTCCGTCG", "small.fastq", "underscore_fastq.gz")