-
Notifications
You must be signed in to change notification settings - Fork 4
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
Showing
16 changed files
with
186 additions
and
43 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,59 @@ | ||
{ | ||
"title": "Real-time tracking of yellow fever virus prM-E region evolution", | ||
"maintainers": [ | ||
{"name": "John SJ Anderson", "url": "https://bedford.io/team/john-sj-anderson/"}, | ||
{"name": "the Nextstrain team", "url": "https://nextstrain.org/team"} | ||
], | ||
"data_provenance": [ | ||
{ | ||
"name": "GenBank", | ||
"url": "https://www.ncbi.nlm.nih.gov/genbank/" | ||
} | ||
], | ||
"build_url": "https://github.com/nextstrain/yellow-fever", | ||
"colorings": [ | ||
{ | ||
"key": "gt", | ||
"title": "Genotype", | ||
"type": "categorical" | ||
}, | ||
{ | ||
"key": "clade", | ||
"title": "Genotype (via Nextclade tree)", | ||
"type": "categorical" | ||
}, | ||
{ | ||
"key": "region", | ||
"title": "Region", | ||
"type": "categorical" | ||
}, | ||
{ | ||
"key": "country", | ||
"title": "Country", | ||
"type": "categorical" | ||
}, | ||
{ | ||
"key": "host", | ||
"title": "Host", | ||
"type": "categorical" | ||
} | ||
], | ||
"geo_resolutions": [ | ||
"country", | ||
"region" | ||
], | ||
"display_defaults": { | ||
"map_triplicate": true, | ||
"color_by": "region" | ||
}, | ||
"filters": [ | ||
"clade", | ||
"region", | ||
"country", | ||
"author", | ||
"host" | ||
], | ||
"metadata_columns": [ | ||
"author" | ||
] | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
File renamed without changes.
Empty file.
File renamed without changes.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
##sequence-region prM-E 1 672 | ||
NC_002031.1 feature source 1 672 . + . gene=nuc | ||
NC_002031.1 feature gene 1 333 . + . gene_name=prM | ||
NC_002031.1 feature gene 109 333 . + . gene_name=M | ||
NC_002031.1 feature gene 334 672 . + . gene_name=E |
Empty file.
File renamed without changes.
File renamed without changes.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,13 @@ | ||
> prM-E region (genome 641-1312, 672 nt) | ||
CCAAGAGAGGAGCCAGATGACATTGATTGCTGGTGCTATGGGGTGGAAAACGTTAGAGTC | ||
GCATATGGTAAGTGTGACTCAGCAGGCAGGTCTAGGAGGTCAAGAAGGGCCATTGACTTG | ||
CCTACGCATGAAAACCATGGTTTGAAGACCCGGCAAGAAAAATGGATGACTGGAAGAATG | ||
GGTGAAAGGCAACTCCAAAAGATTGAGAGATGGCTCGTGAGGAACCCCTTTTTTGCAGTG | ||
ACAGCTCTGACCATTGCCTACCTTGTGGGAAGCAACATGACGCAACGAGTCGTGATTGCC | ||
CTACTGGTCTTGGCTGTTGGTCCGGCCTACTCAGCTCACTGCATTGGAATTACTGACAGG | ||
GATTTCATTGAGGGGGTGCATGGAGGAACTTGGGTTTCAGCTACCCTGGAGCAAGACAAG | ||
TGTGTCACTGTTATGGCCCCTGACAAGCCTTCATTGGACATCTCACTAGAGACAGTAGCC | ||
ATTGATGGACCTGCTGAGGCGAGGAAAGTGTGTTACAATGCAGTTCTCACTCATGTGAAG | ||
ATTAATGACAAGTGCCCCAGCACTGGAGAGGCCCACCTAGCTGAAGAGAACGAAGGGGAC | ||
AATGCGTGCAAGCGCACTTATTCTGATAGAGGCTGGGGCAATGGCTGTGGCCTATTTGGG | ||
AAAGGGAGCATT |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters