Skip to content
This repository has been archived by the owner on Aug 28, 2024. It is now read-only.

oicr-gsi/wgsPipeline

BranchesTags

Repository files navigation

wgsPipeline

Wrapper workflow for the WGS Analysis Pipeline

Overview

Dependencies

Usage

Cromwell

java -jar cromwell.jar run wgsPipeline.wdl --inputs inputs.json

Inputs

Required workflow parameters:

Parameter Value Description
bwaMemMetas Array[bwaMemMeta] ReadGroups for bwaMemMeta
rawBamQCMetas Array[bamQCMeta] Metadata for the raw bamQC run
processedBamQCMetas Array[bamQCMeta] Metadata for the processed bamQC run
bcl2fastq.mismatches Int Number of mismatches to allow in the barcodes (usually, 1)
bcl2fastq.modules String The modules to load when running the workflow. This should include bcl2fastq and the helper scripts.
bwaMem.runBwaMem_bwaRef String The reference genome to align the sample with by BWA
bwaMem.runBwaMem_modules String Required environment modules
rawBamQC.bamQCMetrics_workflowVersion String Workflow version string
rawBamQC.bamQCMetrics_refSizesBed String Path to human genome BED reference with chromosome sizes
rawBamQC.bamQCMetrics_refFasta String Path to human genome FASTA reference
bamMergePreprocessing.baseQualityScoreRecalibration_knownSites Array[String] Array of VCF with known polymorphic sites used to exclude regions around known polymorphisms from analysis.
bamMergePreprocessing.indelRealign_knownAlleles Array[String] Array of input VCF files with known indels.
bamMergePreprocessing.realignerTargetCreator_knownIndels Array[String] Array of input VCF files with known indels.
bamMergePreprocessing.intervalsToParallelizeByString String Comma separated list of intervals to split by (e.g. chr1,chr2,chr3+chr4).
bamMergePreprocessing.reference String Path to reference file.
callability.normalMinCoverage Int Normal must have at least this coverage to be considered callable.
callability.tumorMinCoverage Int Tumor must have at least this coverage to be considered callable.
callability.intervalFile File The interval file of regions to calculate callability on.
processedBamQC.bamQCMetrics_workflowVersion String Workflow version string
processedBamQC.bamQCMetrics_refSizesBed String Path to human genome BED reference with chromosome sizes
processedBamQC.bamQCMetrics_refFasta String Path to human genome FASTA reference

Optional workflow parameters:

Parameter Value Default Description
doBcl2fastq Boolean true Whether to use fastqs or bcls
bcl2fastqMetas Array[bcl2fastqMeta]? None Samples, lanes, and runDirectory for bcl2fastq
fastqInputs Array[FastqInput]? None Name and list of fastqs

Optional task parameters:

Parameter Value Default Description
bcl2fastq.process_threads Int 8 The number of processing threads to use when running BCL2FASTQ
bcl2fastq.process_temporaryDirectory String "." A directory where bcl2fastq can dump massive amounts of garbage while running.
bcl2fastq.process_memory Int 32 The memory for the BCL2FASTQ process in GB.
bcl2fastq.process_ignoreMissingPositions Boolean false Flag passed to bcl2fastq, allows missing or corrupt positions files.
bcl2fastq.process_ignoreMissingFilter Boolean false Flag passed to bcl2fastq, allows missing or corrupt filter files.
bcl2fastq.process_ignoreMissingBcls Boolean false Flag passed to bcl2fastq, allows missing bcl files.
bcl2fastq.process_extraOptions String "" Any other options that will be passed directly to bcl2fastq.
bcl2fastq.process_bcl2fastqJail String "bcl2fastq-jail" The name ro path of the BCL2FASTQ wrapper script executable.
bcl2fastq.process_bcl2fastq String "bcl2fastq" The name or path of the BCL2FASTQ executable.
bcl2fastq.basesMask String? None An Illumina bases mask string to use. If absent, the one written by the instrument will be used.
bcl2fastq.timeout Int 40 The maximum number of hours this workflow can run for.
fastQC.secondMateZip_timeout Int 1 Timeout, in hours, needed to override imposed limits.
fastQC.secondMateZip_jobMemory Int 2 Memory allocated to this task.
fastQC.secondMateHtml_timeout Int 1 Timeout, in hours, needed to override imposed limits.
fastQC.secondMateHtml_jobMemory Int 2 Memory allocated to this task.
fastQC.secondMateFastQC_modules String "perl/5.28 java/8 fastqc/0.11.8" Names and versions of required modules.
fastQC.secondMateFastQC_timeout Int 20 Timeout in hours, needed to override imposed limits.
fastQC.secondMateFastQC_jobMemory Int 6 Memory allocated to fastqc.
fastQC.firstMateZip_timeout Int 1 Timeout, in hours, needed to override imposed limits.
fastQC.firstMateZip_jobMemory Int 2 Memory allocated to this task.
fastQC.firstMateHtml_timeout Int 1 Timeout, in hours, needed to override imposed limits.
fastQC.firstMateHtml_jobMemory Int 2 Memory allocated to this task.
fastQC.firstMateFastQC_modules String "perl/5.28 java/8 fastqc/0.11.8" Names and versions of required modules.
fastQC.firstMateFastQC_timeout Int 20 Timeout in hours, needed to override imposed limits.
fastQC.firstMateFastQC_jobMemory Int 6 Memory allocated to fastqc.
fastQC.outputFileNamePrefix String "" Output prefix, customizable. Default is the first file's basename.
fastQC.r1Suffix String "_R1" Suffix for R1 file.
fastQC.r2Suffix String "_R2" Suffix for R2 file.
bwaMem.adapterTrimmingLog_timeout Int 48 Hours before task timeout
bwaMem.adapterTrimmingLog_jobMemory Int 12 Memory allocated indexing job
bwaMem.indexBam_timeout Int 48 Hours before task timeout
bwaMem.indexBam_modules String "samtools/1.9" Modules for running indexing job
bwaMem.indexBam_jobMemory Int 12 Memory allocated indexing job
bwaMem.bamMerge_timeout Int 72 Hours before task timeout
bwaMem.bamMerge_modules String "samtools/1.9" Required environment modules
bwaMem.bamMerge_jobMemory Int 32 Memory allocated indexing job
bwaMem.runBwaMem_timeout Int 96 Hours before task timeout
bwaMem.runBwaMem_jobMemory Int 32 Memory allocated for this job
bwaMem.runBwaMem_threads Int 8 Requested CPU threads
bwaMem.runBwaMem_addParam String? None Additional BWA parameters
bwaMem.adapterTrimming_timeout Int 48 Hours before task timeout
bwaMem.adapterTrimming_jobMemory Int 16 Memory allocated for this job
bwaMem.adapterTrimming_addParam String? None Additional cutadapt parameters
bwaMem.adapterTrimming_modules String "cutadapt/1.8.3" Required environment modules
bwaMem.slicerR2_timeout Int 48 Hours before task timeout
bwaMem.slicerR2_jobMemory Int 16 Memory allocated for this job
bwaMem.slicerR2_modules String "slicer/0.3.0" Required environment modules
bwaMem.slicerR1_timeout Int 48 Hours before task timeout
bwaMem.slicerR1_jobMemory Int 16 Memory allocated for this job
bwaMem.slicerR1_modules String "slicer/0.3.0" Required environment modules
bwaMem.countChunkSize_timeout Int 48 Hours before task timeout
bwaMem.countChunkSize_jobMemory Int 16 Memory allocated for this job
bwaMem.outputFileNamePrefix String "output" Prefix for output file
bwaMem.numChunk Int 1 number of chunks to split fastq file [1, no splitting]
bwaMem.doTrim Boolean false if true, adapters will be trimmed before alignment
bwaMem.trimMinLength Int 1 minimum length of reads to keep [1]
bwaMem.trimMinQuality Int 0 minimum quality of read ends to keep [0]
bwaMem.adapter1 String "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" adapter sequence to trim from read 1 [AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC]
bwaMem.adapter2 String "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" adapter sequence to trim from read 2 [AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT]
rawBamQC.collateResults_timeout Int 1 hours before task timeout
rawBamQC.collateResults_threads Int 4 Requested CPU threads
rawBamQC.collateResults_jobMemory Int 8 Memory allocated for this job
rawBamQC.collateResults_modules String "python/3.6" required environment modules
rawBamQC.cumulativeDistToHistogram_timeout Int 1 hours before task timeout
rawBamQC.cumulativeDistToHistogram_threads Int 4 Requested CPU threads
rawBamQC.cumulativeDistToHistogram_jobMemory Int 8 Memory allocated for this job
rawBamQC.cumulativeDistToHistogram_modules String "python/3.6" required environment modules
rawBamQC.runMosdepth_timeout Int 4 hours before task timeout
rawBamQC.runMosdepth_threads Int 4 Requested CPU threads
rawBamQC.runMosdepth_jobMemory Int 16 Memory allocated for this job
rawBamQC.runMosdepth_modules String "mosdepth/0.2.9" required environment modules
rawBamQC.bamQCMetrics_timeout Int 4 hours before task timeout
rawBamQC.bamQCMetrics_threads Int 4 Requested CPU threads
rawBamQC.bamQCMetrics_jobMemory Int 16 Memory allocated for this job
rawBamQC.bamQCMetrics_modules String "bam-qc-metrics/0.2.5" required environment modules
rawBamQC.bamQCMetrics_normalInsertMax Int 1500 Maximum of expected insert size range
rawBamQC.markDuplicates_timeout Int 4 hours before task timeout
rawBamQC.markDuplicates_threads Int 4 Requested CPU threads
rawBamQC.markDuplicates_jobMemory Int 16 Memory allocated for this job
rawBamQC.markDuplicates_modules String "picard/2.21.2" required environment modules
rawBamQC.markDuplicates_picardMaxMemMb Int 6000 Memory requirement in MB for running Picard JAR
rawBamQC.markDuplicates_opticalDuplicatePixelDistance Int 100 Maximum offset between optical duplicate clusters
rawBamQC.downsampleRegion_timeout Int 4 hours before task timeout
rawBamQC.downsampleRegion_threads Int 4 Requested CPU threads
rawBamQC.downsampleRegion_jobMemory Int 16 Memory allocated for this job
rawBamQC.downsampleRegion_modules String "samtools/1.9" required environment modules
rawBamQC.downsample_timeout Int 4 hours before task timeout
rawBamQC.downsample_threads Int 4 Requested CPU threads
rawBamQC.downsample_jobMemory Int 16 Memory allocated for this job
rawBamQC.downsample_modules String "samtools/1.9" required environment modules
rawBamQC.downsample_randomSeed Int 42 Random seed for pre-downsampling (if any)
rawBamQC.downsample_downsampleSuffix String "downsampled.bam" Suffix for output file
rawBamQC.findDownsampleParamsMarkDup_timeout Int 4 hours before task timeout
rawBamQC.findDownsampleParamsMarkDup_threads Int 4 Requested CPU threads
rawBamQC.findDownsampleParamsMarkDup_jobMemory Int 16 Memory allocated for this job
rawBamQC.findDownsampleParamsMarkDup_modules String "python/3.6" required environment modules
rawBamQC.findDownsampleParamsMarkDup_customRegions String "" Custom downsample regions; overrides chromosome and interval parameters
rawBamQC.findDownsampleParamsMarkDup_intervalStart Int 100000 Start of interval in each chromosome, for very large BAMs
rawBamQC.findDownsampleParamsMarkDup_baseInterval Int 15000 Base width of interval in each chromosome, for very large BAMs
rawBamQC.findDownsampleParamsMarkDup_chromosomes Array[String] ["chr12", "chr13", "chrXII", "chrXIII"] Array of chromosome identifiers for downsampled subset
rawBamQC.findDownsampleParamsMarkDup_threshold Int 10000000 Minimum number of reads to conduct downsampling
rawBamQC.findDownsampleParams_timeout Int 4 hours before task timeout
rawBamQC.findDownsampleParams_threads Int 4 Requested CPU threads
rawBamQC.findDownsampleParams_jobMemory Int 16 Memory allocated for this job
rawBamQC.findDownsampleParams_modules String "python/3.6" required environment modules
rawBamQC.findDownsampleParams_preDSMultiplier Float 1.5 Determines target size for pre-downsampled set (if any). Must have (preDSMultiplier) < (minReadsRelative).
rawBamQC.findDownsampleParams_precision Int 8 Number of decimal places in fraction for pre-downsampling
rawBamQC.findDownsampleParams_minReadsRelative Int 2 Minimum value of (inputReads)/(targetReads) to allow pre-downsampling
rawBamQC.findDownsampleParams_minReadsAbsolute Int 10000 Minimum value of targetReads to allow pre-downsampling
rawBamQC.findDownsampleParams_targetReads Int 100000 Desired number of reads in downsampled output
rawBamQC.indexBamFile_timeout Int 4 hours before task timeout
rawBamQC.indexBamFile_threads Int 4 Requested CPU threads
rawBamQC.indexBamFile_jobMemory Int 16 Memory allocated for this job
rawBamQC.indexBamFile_modules String "samtools/1.9" required environment modules
rawBamQC.countInputReads_timeout Int 4 hours before task timeout
rawBamQC.countInputReads_threads Int 4 Requested CPU threads
rawBamQC.countInputReads_jobMemory Int 16 Memory allocated for this job
rawBamQC.countInputReads_modules String "samtools/1.9" required environment modules
rawBamQC.updateMetadata_timeout Int 4 hours before task timeout
rawBamQC.updateMetadata_threads Int 4 Requested CPU threads
rawBamQC.updateMetadata_jobMemory Int 16 Memory allocated for this job
rawBamQC.updateMetadata_modules String "python/3.6" required environment modules
rawBamQC.filter_timeout Int 4 hours before task timeout
rawBamQC.filter_threads Int 4 Requested CPU threads
rawBamQC.filter_jobMemory Int 16 Memory allocated for this job
rawBamQC.filter_modules String "samtools/1.9" required environment modules
rawBamQC.filter_minQuality Int 30 Minimum alignment quality to pass filter
rawBamQC.outputFileNamePrefix String "bamQC" Prefix for output files
bamMergePreprocessing.mergeSplitByIntervalBams_modules String "gatk/4.1.6.0" Environment module name and version to load (space separated) before command execution.
bamMergePreprocessing.mergeSplitByIntervalBams_timeout Int 6 Maximum amount of time (in hours) the task can run for.
bamMergePreprocessing.mergeSplitByIntervalBams_cores Int 1 The number of cores to allocate to the job.
bamMergePreprocessing.mergeSplitByIntervalBams_overhead Int 6 Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
bamMergePreprocessing.mergeSplitByIntervalBams_jobMemory Int 24 Memory allocated to job (in GB).
bamMergePreprocessing.mergeSplitByIntervalBams_additionalParams String? None Additional parameters to pass to GATK MergeSamFiles.
bamMergePreprocessing.collectFilesBySample_modules String "python/3.7" Environment module name and version to load (space separated) before command execution.
bamMergePreprocessing.collectFilesBySample_timeout Int 1 Maximum amount of time (in hours) the task can run for.
bamMergePreprocessing.collectFilesBySample_cores Int 1 The number of cores to allocate to the job.
bamMergePreprocessing.collectFilesBySample_jobMemory Int 1 Memory allocated to job (in GB).
bamMergePreprocessing.applyBaseQualityScoreRecalibration_modules String "gatk/4.1.6.0" Environment module name and version to load (space separated) before command execution.
bamMergePreprocessing.applyBaseQualityScoreRecalibration_timeout Int 6 Maximum amount of time (in hours) the task can run for.
bamMergePreprocessing.applyBaseQualityScoreRecalibration_cores Int 1 The number of cores to allocate to the job.
bamMergePreprocessing.applyBaseQualityScoreRecalibration_overhead Int 6 Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
bamMergePreprocessing.applyBaseQualityScoreRecalibration_jobMemory Int 24 Memory allocated to job (in GB).
bamMergePreprocessing.applyBaseQualityScoreRecalibration_additionalParams String? None Additional parameters to pass to GATK ApplyBQSR.
bamMergePreprocessing.applyBaseQualityScoreRecalibration_suffix String ".recalibrated" Suffix to use for recalibrated bams.
bamMergePreprocessing.analyzeCovariates_modules String "gatk/4.1.6.0" Environment module name and version to load (space separated) before command execution.
bamMergePreprocessing.analyzeCovariates_timeout Int 6 Maximum amount of time (in hours) the task can run for.
bamMergePreprocessing.analyzeCovariates_cores Int 1 The number of cores to allocate to the job.
bamMergePreprocessing.analyzeCovariates_overhead Int 6 Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
bamMergePreprocessing.analyzeCovariates_jobMemory Int 24 Memory allocated to job (in GB).
bamMergePreprocessing.analyzeCovariates_outputFileName String "gatk.recalibration.pdf" Recalibration report file name.
bamMergePreprocessing.analyzeCovariates_additionalParams String? None Additional parameters to pass to GATK AnalyzeCovariates
bamMergePreprocessing.gatherBQSRReports_modules String "gatk/4.1.6.0" Environment module name and version to load (space separated) before command execution.
bamMergePreprocessing.gatherBQSRReports_timeout Int 6 Maximum amount of time (in hours) the task can run for.
bamMergePreprocessing.gatherBQSRReports_cores Int 1 The number of cores to allocate to the job.
bamMergePreprocessing.gatherBQSRReports_overhead Int 6 Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
bamMergePreprocessing.gatherBQSRReports_jobMemory Int 24 Memory allocated to job (in GB).
bamMergePreprocessing.gatherBQSRReports_outputFileName String "gatk.recalibration.csv" Recalibration table file name.
bamMergePreprocessing.gatherBQSRReports_additionalParams String? None Additional parameters to pass to GATK GatherBQSRReports.
bamMergePreprocessing.baseQualityScoreRecalibration_modules String "gatk/4.1.6.0" Environment module name and version to load (space separated) before command execution.
bamMergePreprocessing.baseQualityScoreRecalibration_timeout Int 6 Maximum amount of time (in hours) the task can run for.
bamMergePreprocessing.baseQualityScoreRecalibration_cores Int 1 The number of cores to allocate to the job.
bamMergePreprocessing.baseQualityScoreRecalibration_overhead Int 6 Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
bamMergePreprocessing.baseQualityScoreRecalibration_jobMemory Int 24 Memory allocated to job (in GB).
bamMergePreprocessing.baseQualityScoreRecalibration_outputFileName String "gatk.recalibration.csv" Recalibration table file name.
bamMergePreprocessing.baseQualityScoreRecalibration_additionalParams String? None Additional parameters to pass to GATK BaseRecalibrator.
bamMergePreprocessing.baseQualityScoreRecalibration_intervals Array[String] [] One or more genomic intervals over which to operate.
bamMergePreprocessing.indelRealign_gatkJar String "$GATK_ROOT/GenomeAnalysisTK.jar" Path to GATK jar.
bamMergePreprocessing.indelRealign_modules String "python/3.7 gatk/3.6-0" Environment module name and version to load (space separated) before command execution.
bamMergePreprocessing.indelRealign_timeout Int 6 Maximum amount of time (in hours) the task can run for.
bamMergePreprocessing.indelRealign_cores Int 1 The number of cores to allocate to the job.
bamMergePreprocessing.indelRealign_overhead Int 6 Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
bamMergePreprocessing.indelRealign_jobMemory Int 24 Memory allocated to job (in GB).
bamMergePreprocessing.indelRealign_additionalParams String? None Additional parameters to pass to GATK IndelRealigner.
bamMergePreprocessing.realignerTargetCreator_gatkJar String "$GATK_ROOT/GenomeAnalysisTK.jar" Path to GATK jar.
bamMergePreprocessing.realignerTargetCreator_modules String "gatk/3.6-0" Environment module name and version to load (space separated) before command execution.
bamMergePreprocessing.realignerTargetCreator_timeout Int 6 Maximum amount of time (in hours) the task can run for.
bamMergePreprocessing.realignerTargetCreator_cores Int 1 The number of cores to allocate to the job.
bamMergePreprocessing.realignerTargetCreator_overhead Int 6 Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
bamMergePreprocessing.realignerTargetCreator_jobMemory Int 24 Memory allocated to job (in GB).
bamMergePreprocessing.realignerTargetCreator_additionalParams String? None Additional parameters to pass to GATK RealignerTargetCreator.
bamMergePreprocessing.realignerTargetCreator_downsamplingType String? None Type of read downsampling to employ at a given locus (NONE
bamMergePreprocessing.preprocessBam_defaultRuntimeAttributes DefaultRuntimeAttributes {"memory": 24, "overhead": 6, "cores": 1, "timeout": 6, "modules": "samtools/1.9 gatk/4.1.6.0"} Default runtime attributes (memory in GB, overhead in GB, cores in cpu count, timeout in hours, modules are environment modules to load before the task executes).
bamMergePreprocessing.preprocessBam_splitNCigarReadsAdditionalParams String? None Additional parameters to pass to GATK SplitNCigarReads.
bamMergePreprocessing.preprocessBam_readFilters Array[String] [] SplitNCigarReads read filters
bamMergePreprocessing.preprocessBam_refactorCigarString Boolean false SplitNCigarReads refactor cigar string?
bamMergePreprocessing.preprocessBam_splitNCigarReadsSuffix String ".split" Suffix to use for SplitNCigarReads bams.
bamMergePreprocessing.preprocessBam_markDuplicatesAdditionalParams String? None Additional parameters to pass to GATK MarkDuplicates.
bamMergePreprocessing.preprocessBam_opticalDuplicatePixelDistance Int 100 MarkDuplicates optical distance.
bamMergePreprocessing.preprocessBam_removeDuplicates Boolean false MarkDuplicates remove duplicates?
bamMergePreprocessing.preprocessBam_markDuplicatesSuffix String ".deduped" Suffix to use for duplicate marked bams.
bamMergePreprocessing.preprocessBam_filterAdditionalParams String? None Additional parameters to pass to samtools.
bamMergePreprocessing.preprocessBam_minMapQuality Int? None Samtools minimum mapping quality filter to apply.
bamMergePreprocessing.preprocessBam_filterFlags Int 260 Samtools filter flags to apply.
bamMergePreprocessing.preprocessBam_filterSuffix String ".filter" Suffix to use for filtered bams.
bamMergePreprocessing.preprocessBam_temporaryWorkingDir String "" Where to write out intermediary bam files. Only the final preprocessed bam will be written to task working directory if this is set to local tmp.
bamMergePreprocessing.splitStringToArray_modules String "python/3.7" Environment module name and version to load (space separated) before command execution.
bamMergePreprocessing.splitStringToArray_timeout Int 1 Maximum amount of time (in hours) the task can run for.
bamMergePreprocessing.splitStringToArray_cores Int 1 The number of cores to allocate to the job.
bamMergePreprocessing.splitStringToArray_jobMemory Int 1 Memory allocated to job (in GB).
bamMergePreprocessing.splitStringToArray_recordSeparator String "+" Interval interval group separator - this can be used to combine multiple intervals into one group.
bamMergePreprocessing.splitStringToArray_lineSeparator String "," Interval group separator - these are the intervals to split by.
bamMergePreprocessing.doFilter Boolean true Enable/disable Samtools filtering.
bamMergePreprocessing.doMarkDuplicates Boolean true Enable/disable GATK4 MarkDuplicates.
bamMergePreprocessing.doSplitNCigarReads Boolean false Enable/disable GATK4 SplitNCigarReads.
bamMergePreprocessing.doIndelRealignment Boolean true Enable/disable GATK3 RealignerTargetCreator + IndelRealigner.
bamMergePreprocessing.doBqsr Boolean true Enable/disable GATK4 BQSR.
bamMergePreprocessing.preprocessingBamRuntimeAttributes Array[RuntimeAttributes] [] Interval specific runtime attributes to use as overrides for the defaults.
bamMergePreprocessing.applyBaseQualityScoreRecalibration.outputFileName String basename(bam,".bam") Output files will be prefixed with this.
callability.calculateCallability_modules String "mosdepth/0.2.9 bedtools/2.27 python/3.7" Environment module name and version to load (space separated) before command execution.
callability.calculateCallability_timeout Int 12 Maximum amount of time (in hours) the task can run for.
callability.calculateCallability_cores Int 1 The number of cores to allocate to the job.
callability.calculateCallability_jobMemory Int 8 Memory allocated to job (in GB).
callability.calculateCallability_outputFileName String "callability_metrics.json" Output callability metrics file name.
callability.calculateCallability_outputFileNamePrefix String? None Output files will be prefixed with this.
callability.calculateCallability_threads Int 4 The number of threads to run mosdepth with.
insertSizeMetrics.collectInsertSizeMetrics_timeout Int 12 Maximum amount of time (in hours) the task can run for.
insertSizeMetrics.collectInsertSizeMetrics_modules String "picard/2.21.2 rstats/3.6" Environment module names and version to load (space separated) before command execution.
insertSizeMetrics.collectInsertSizeMetrics_jobMemory Int 18 Memory (in GB) allocated for job.
insertSizeMetrics.collectInsertSizeMetrics_minimumPercent Float 0.5 Discard any data categories (out of FR, TANDEM, RF) when generating the histogram (Range: 0 to 1).
insertSizeMetrics.collectInsertSizeMetrics_picardJar String "$PICARD_ROOT/picard.jar" The picard jar to use.
wgsMetrics.collectWGSmetrics_timeout Int 24 Maximum amount of time (in hours) the task can run for.
wgsMetrics.collectWGSmetrics_modules String "picard/2.21.2 hg19/p13" Environment module names and version to load (space separated) before command execution
wgsMetrics.collectWGSmetrics_coverageCap Int 500 Coverage cap, picard parameter
wgsMetrics.collectWGSmetrics_jobMemory Int 18 memory allocated for Job
wgsMetrics.collectWGSmetrics_filter String "LENIENT" Picard filter to use
wgsMetrics.collectWGSmetrics_metricTag String "WGS" metric tag is used as a file extension for output
wgsMetrics.collectWGSmetrics_refFasta String "$HG19_ROOT/hg19_random.fa" Path to the reference fasta
wgsMetrics.collectWGSmetrics_picardJar String "$PICARD_ROOT/picard.jar" Picard jar file to use
processedBamQC.collateResults_timeout Int 1 hours before task timeout
processedBamQC.collateResults_threads Int 4 Requested CPU threads
processedBamQC.collateResults_jobMemory Int 8 Memory allocated for this job
processedBamQC.collateResults_modules String "python/3.6" required environment modules
processedBamQC.cumulativeDistToHistogram_timeout Int 1 hours before task timeout
processedBamQC.cumulativeDistToHistogram_threads Int 4 Requested CPU threads
processedBamQC.cumulativeDistToHistogram_jobMemory Int 8 Memory allocated for this job
processedBamQC.cumulativeDistToHistogram_modules String "python/3.6" required environment modules
processedBamQC.runMosdepth_timeout Int 4 hours before task timeout
processedBamQC.runMosdepth_threads Int 4 Requested CPU threads
processedBamQC.runMosdepth_jobMemory Int 16 Memory allocated for this job
processedBamQC.runMosdepth_modules String "mosdepth/0.2.9" required environment modules
processedBamQC.bamQCMetrics_timeout Int 4 hours before task timeout
processedBamQC.bamQCMetrics_threads Int 4 Requested CPU threads
processedBamQC.bamQCMetrics_jobMemory Int 16 Memory allocated for this job
processedBamQC.bamQCMetrics_modules String "bam-qc-metrics/0.2.5" required environment modules
processedBamQC.bamQCMetrics_normalInsertMax Int 1500 Maximum of expected insert size range
processedBamQC.markDuplicates_timeout Int 4 hours before task timeout
processedBamQC.markDuplicates_threads Int 4 Requested CPU threads
processedBamQC.markDuplicates_jobMemory Int 16 Memory allocated for this job
processedBamQC.markDuplicates_modules String "picard/2.21.2" required environment modules
processedBamQC.markDuplicates_picardMaxMemMb Int 6000 Memory requirement in MB for running Picard JAR
processedBamQC.markDuplicates_opticalDuplicatePixelDistance Int 100 Maximum offset between optical duplicate clusters
processedBamQC.downsampleRegion_timeout Int 4 hours before task timeout
processedBamQC.downsampleRegion_threads Int 4 Requested CPU threads
processedBamQC.downsampleRegion_jobMemory Int 16 Memory allocated for this job
processedBamQC.downsampleRegion_modules String "samtools/1.9" required environment modules
processedBamQC.downsample_timeout Int 4 hours before task timeout
processedBamQC.downsample_threads Int 4 Requested CPU threads
processedBamQC.downsample_jobMemory Int 16 Memory allocated for this job
processedBamQC.downsample_modules String "samtools/1.9" required environment modules
processedBamQC.downsample_randomSeed Int 42 Random seed for pre-downsampling (if any)
processedBamQC.downsample_downsampleSuffix String "downsampled.bam" Suffix for output file
processedBamQC.findDownsampleParamsMarkDup_timeout Int 4 hours before task timeout
processedBamQC.findDownsampleParamsMarkDup_threads Int 4 Requested CPU threads
processedBamQC.findDownsampleParamsMarkDup_jobMemory Int 16 Memory allocated for this job
processedBamQC.findDownsampleParamsMarkDup_modules String "python/3.6" required environment modules
processedBamQC.findDownsampleParamsMarkDup_customRegions String "" Custom downsample regions; overrides chromosome and interval parameters
processedBamQC.findDownsampleParamsMarkDup_intervalStart Int 100000 Start of interval in each chromosome, for very large BAMs
processedBamQC.findDownsampleParamsMarkDup_baseInterval Int 15000 Base width of interval in each chromosome, for very large BAMs
processedBamQC.findDownsampleParamsMarkDup_chromosomes Array[String] ["chr12", "chr13", "chrXII", "chrXIII"] Array of chromosome identifiers for downsampled subset
processedBamQC.findDownsampleParamsMarkDup_threshold Int 10000000 Minimum number of reads to conduct downsampling
processedBamQC.findDownsampleParams_timeout Int 4 hours before task timeout
processedBamQC.findDownsampleParams_threads Int 4 Requested CPU threads
processedBamQC.findDownsampleParams_jobMemory Int 16 Memory allocated for this job
processedBamQC.findDownsampleParams_modules String "python/3.6" required environment modules
processedBamQC.findDownsampleParams_preDSMultiplier Float 1.5 Determines target size for pre-downsampled set (if any). Must have (preDSMultiplier) < (minReadsRelative).
processedBamQC.findDownsampleParams_precision Int 8 Number of decimal places in fraction for pre-downsampling
processedBamQC.findDownsampleParams_minReadsRelative Int 2 Minimum value of (inputReads)/(targetReads) to allow pre-downsampling
processedBamQC.findDownsampleParams_minReadsAbsolute Int 10000 Minimum value of targetReads to allow pre-downsampling
processedBamQC.findDownsampleParams_targetReads Int 100000 Desired number of reads in downsampled output
processedBamQC.indexBamFile_timeout Int 4 hours before task timeout
processedBamQC.indexBamFile_threads Int 4 Requested CPU threads
processedBamQC.indexBamFile_jobMemory Int 16 Memory allocated for this job
processedBamQC.indexBamFile_modules String "samtools/1.9" required environment modules
processedBamQC.countInputReads_timeout Int 4 hours before task timeout
processedBamQC.countInputReads_threads Int 4 Requested CPU threads
processedBamQC.countInputReads_jobMemory Int 16 Memory allocated for this job
processedBamQC.countInputReads_modules String "samtools/1.9" required environment modules
processedBamQC.updateMetadata_timeout Int 4 hours before task timeout
processedBamQC.updateMetadata_threads Int 4 Requested CPU threads
processedBamQC.updateMetadata_jobMemory Int 16 Memory allocated for this job
processedBamQC.updateMetadata_modules String "python/3.6" required environment modules
processedBamQC.filter_timeout Int 4 hours before task timeout
processedBamQC.filter_threads Int 4 Requested CPU threads
processedBamQC.filter_jobMemory Int 16 Memory allocated for this job
processedBamQC.filter_modules String "samtools/1.9" required environment modules
processedBamQC.filter_minQuality Int 30 Minimum alignment quality to pass filter
processedBamQC.outputFileNamePrefix String "bamQC" Prefix for output files

Outputs

Output Type Description
fastQC_html_report_R1 Array[File?] HTML report for the first mate fastq file.
fastQC_zip_bundle_R1 Array[File?] zipped report from FastQC for the first mate reads.
fastQC_html_report_R2 Array[File?] HTML report for read second mate fastq file.
fastQC_zip_bundle_R2 Array[File?] zipped report from FastQC for the second mate reads.
bwaMem_log Array[File?] a summary log file for adapter trimming.
bwaMem_cutAdaptAllLogs Array[File?] a file containing all logs for adapter trimming for each fastq chunk.
rawBamQC_result Array[File] JSON file of collated results.
bamMergePreprocessing_recalibrationReport File? Recalibration report pdf (if BQSR enabled).
bamMergePreprocessing_recalibrationTable File? Recalibration csv that was used by BQSR (if BQSR enabled).
callability_callabilityMetrics File Json file with pass, fail and callability percent (# of pass bases / # total bases).
insertSizeMetrics_insertSizeMetrics Array[File] Metrics about the insert size distribution (see https://broadinstitute.github.io/picard/picard-metric-definitions.html#InsertSizeMetrics).
insertSizeMetrics_histogramReport Array[File] Insert size distribution plot.
wgsMetrics_outputWGSMetrics Array[File] Metrics about the fractions of reads that pass base and mapping-quality filters as well as coverage (read-depth) levels (see https://broadinstitute.github.io/picard/picard-metric-definitions.html#CollectWgsMetrics.WgsMetrics).
processedBamQC_result Array[File] JSON file of collated results.

Niassa + Cromwell

This WDL workflow is wrapped in a Niassa workflow (https://github.com/oicr-gsi/pipedev/tree/master/pipedev-niassa-cromwell-workflow) so that it can used with the Niassa metadata tracking system (https://github.com/oicr-gsi/niassa).

  • Building
mvn clean install
  • Testing
mvn clean verify \
-Djava_opts="-Xmx1g -XX:+UseG1GC -XX:+UseStringDeduplication" \
-DrunTestThreads=2 \
-DskipITs=false \
-DskipRunITs=false \
-DworkingDirectory=/path/to/tmp/ \
-DschedulingHost=niassa_oozie_host \
-DwebserviceUrl=http://niassa-url:8080 \
-DwebserviceUser=niassa_user \
-DwebservicePassword=niassa_user_password \
-Dcromwell-host=http://cromwell-url:8000

Support

For support, please file an issue on the Github project or send an email to gsi@oicr.on.ca .

Generated with generate-markdown-readme (https://github.com/oicr-gsi/gsi-wdl-tools/)

About

No description or website provided.

Topics

workflow

Resources

Readme
Activity
Custom properties

Stars

0 stars

Watchers

3 watching

Forks

0 forks
Report repository

Releases

No releases published

Packages

No packages published

Contributors 2

  •  
  •