Lk pd 2727 mitochondria (#1350)

Updated warp-tools docker for mitochondrial metrics
broadinstitute · Aug 7, 2024 · 2b75a2e · 2b75a2e
1 parent f1076b8
commit 2b75a2e
Show file tree

Hide file tree

Showing 18 changed files with 62 additions and 154 deletions.
diff --git a/pipeline_versions.txt b/pipeline_versions.txt
@@ -1,15 +1,15 @@
 Pipeline Name	Version	Date of Last Commit
-Multiome	 5.4.1	2024-08-02 
+Multiome	 5.5.0	2024-08-06 
 MultiSampleSmartSeq2SingleNucleus	 1.4.2	2024-08-25-02 
 BuildIndices	 3.0.0	2023-12-06 
 MultiSampleSmartSeq2	 2.2.21	2023-04-19 
 SmartSeq2SingleSample	 5.1.20	2023-04-19 
 scATAC	 1.3.2	2023-08-03 
-SlideSeq	 3.3.1	2024-08-02 
+SlideSeq	 3.4.0	2024-08-06 
 snm3C	 4.0.2	2024-07-09 
-PairedTag	 1.4.1	2024-08-02 
-Optimus	 7.5.1	2024-08-02 
-atac	 2.2.2	2024-08-02 
+PairedTag	 1.5.0	2024-08-06 
+Optimus	 7.6.0	2024-08-06 
+atac	 2.2.3	2024-08-02 
 ExomeReprocessing	 3.2.2	2024-08-02 
 ExternalExomeReprocessing	 3.2.2	2024-08-02 
 ExternalWholeGenomeReprocessing	 2.2.2	2024-08-02 

diff --git a/pipelines/skylab/atac/atac.changelog.md b/pipelines/skylab/atac/atac.changelog.md
@@ -1,5 +1,10 @@
+# 2.2.3
+2024-08-02 (Date of Last Commit)
+
+* Updated the warp-tools docker which now includes new metric calculations for mitochondria reads; this does not impact the ATAC workflow
+
 # 2.2.2
-2024-08-02 (Dat of Last Commit)
+2024-08-02 (Date of Last Commit)
 
 * The ubuntu_16_0_4 docker image version was pinned instead of using the latest tag; this does not affect the outputs of the pipeline
 

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
@@ -46,15 +46,15 @@ workflow ATAC {
     String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"
   }
 
-  String pipeline_version = "2.2.2"
+  String pipeline_version = "2.2.3"
 
   # Determine docker prefix based on cloud provider
   String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/"
   String acr_docker_prefix = "dsppipelinedev.azurecr.io/"
   String docker_prefix = if cloud_provider == "gcp" then gcr_docker_prefix else acr_docker_prefix
 
   # Docker image names
-  String warp_tools_2_1_0 = "warp-tools:2.1.0"
+  String warp_tools_2_2_0 = "warp-tools:2.2.0"
   String cutadapt_docker = "cutadapt:1.0.0-4.4-1686752919"
   String samtools_docker = "samtools-dist-bwa:3.0.0"
   String upstools_docker = "upstools:1.0.0-2023.03.03-1704300311"
@@ -96,7 +96,7 @@ workflow ATAC {
       output_base_name = input_id,
       num_output_files = GetNumSplits.ranks_per_node_out,
       whitelist = whitelist,
-      docker_path = docker_prefix + warp_tools_2_1_0
+      docker_path = docker_prefix + warp_tools_2_2_0
   }
 
   scatter(idx in range(length(SplitFastq.fastq_R1_output_array))) {

diff --git a/pipelines/skylab/multiome/Multiome.changelog.md b/pipelines/skylab/multiome/Multiome.changelog.md
@@ -1,3 +1,8 @@
+# 5.5.0
+2024-08-06 (Date of Last Commit)
+
+* Updated the warp-tools docker to calculate mitochondrial reads from unique reads in cell and gene metrics; these metrics are in the cell and gene metrics CSV as well as h5ad
+
 # 5.4.1
 2024-08-02 (Date of Last Commit)
 

diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
@@ -9,7 +9,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow Multiome {
 
-    String pipeline_version = "5.4.1"
+    String pipeline_version = "5.5.0"
 
 
     input {

diff --git a/pipelines/skylab/optimus/Optimus.changelog.md b/pipelines/skylab/optimus/Optimus.changelog.md
@@ -1,10 +1,15 @@
+# 7.6.0
+2024-08-06 (Date of Last Commit)
+
+* Updated the warp-tools docker to calculate mitochondrial reads from unique reads in cell and gene metrics; these metrics are in the cell and gene metrics CSV as well as h5ad
+
 # 7.5.1
-2024-08-02 (Dat of Last Commit)
+2024-08-02 (Date of Last Commit)
 
 * The ubuntu_16_0_4 docker image version was pinned instead of using the latest tag; this does not affect the outputs of the pipeline
 
 # 7.5.0
-2024-07-25 (Dat of Last Commit)
+2024-07-25 (Date of Last Commit)
 
 * Updated the warp-tools docker image to add TSO metrics to the output h5ad and metric CSV files
 * Update the library-level metrics to include new TSO metrics and NHashID descriptor

diff --git a/pipelines/skylab/optimus/Optimus.wdl b/pipelines/skylab/optimus/Optimus.wdl
@@ -71,7 +71,7 @@ workflow Optimus {
   # version of this pipeline
 
 
-  String pipeline_version = "7.5.1"
+  String pipeline_version = "7.6.0"
 
 
   # this is used to scatter matched [r1_fastq, r2_fastq, i1_fastq] arrays
@@ -91,7 +91,7 @@ workflow Optimus {
   String pytools_docker = "pytools:1.0.0-1661263730"
   String empty_drops_docker = "empty-drops:1.0.1-4.2"
   String star_docker = "star:1.0.1-2.7.11a-1692706072"
-  String warp_tools_docker_2_1_1 = "warp-tools:2.1.1"
+  String warp_tools_docker_2_2_0 = "warp-tools:2.2.0"
   String star_merge_docker = "star-merge-npz:1.2"
 
   #TODO how do we handle these?
@@ -166,7 +166,7 @@ workflow Optimus {
       chemistry = tenx_chemistry_version,
       sample_id = input_id,
       read_struct = read_struct,
-      warp_tools_docker_path = docker_prefix + warp_tools_docker_2_1_1
+      warp_tools_docker_path = docker_prefix + warp_tools_docker_2_2_0
   }
 
   scatter(idx in range(length(SplitFastq.fastq_R1_output_array))) {
@@ -198,7 +198,7 @@ workflow Optimus {
       mt_genes = mt_genes,
       original_gtf = annotations_gtf,
       input_id = input_id,
-      warp_tools_docker_path = docker_prefix + warp_tools_docker_2_1_1
+      warp_tools_docker_path = docker_prefix + warp_tools_docker_2_2_0
   }
 
   call Metrics.CalculateCellMetrics as CellMetrics {
@@ -207,7 +207,7 @@ workflow Optimus {
       mt_genes = mt_genes,
       original_gtf = annotations_gtf,
       input_id = input_id,
-      warp_tools_docker_path = docker_prefix + warp_tools_docker_2_1_1
+      warp_tools_docker_path = docker_prefix + warp_tools_docker_2_2_0
   }
 
   call StarAlign.MergeStarOutput as MergeStarOutputs {
@@ -254,7 +254,7 @@ workflow Optimus {
         empty_drops_result = RunEmptyDrops.empty_drops_result,
         counting_mode = counting_mode,
         pipeline_version = "Optimus_v~{pipeline_version}",
-        warp_tools_docker_path = docker_prefix + warp_tools_docker_2_1_1
+        warp_tools_docker_path = docker_prefix + warp_tools_docker_2_2_0
     }
   }
   if (count_exons  && counting_mode=="sn_rna") {
@@ -290,7 +290,7 @@ workflow Optimus {
         cell_id_exon = MergeStarOutputsExons.row_index,
         gene_id_exon = MergeStarOutputsExons.col_index,
         pipeline_version = "Optimus_v~{pipeline_version}",
-        warp_tools_docker_path = docker_prefix + warp_tools_docker_2_1_1
+        warp_tools_docker_path = docker_prefix + warp_tools_docker_2_2_0
     }
   }
 

diff --git a/pipelines/skylab/optimus/documentation/Bam_tags.md b/pipelines/skylab/optimus/documentation/Bam_tags.md