feat!: exact matches in assignment

config/example_assignment_bwa.yaml

@@ -0,0 +1,27 @@
+---
+global: # generall configs effecting one or multiple parts
+  threads: 1
+  assignments:
+    split_number: 1 # number of files fastq should be split for parallelization
+assignments:
+  exampleAssignment: # name of an example assignment (can be any string)
+    bc_length: 15
+    alignment_tool:
+      tool: bwa # bwa or exact
+      configs:
+        min_mapping_quality: 1 # integer >=0 Please use 1 when you have oligos that differ by 1 base in your reference/design file
+        sequence_length: # sequence length of design excluding adapters.
+          min: 166
+          max: 175
+        alignment_start: # start of an alignment in the reference. Here using 15 bp adapters. Can be different when using adapter free approaches
+          min: 1 # integer
+          max: 3 # integer
+    FW:
+      - resources/Assignment_BasiC/R1.fastq.gz
+    BC:
+      - resources/Assignment_BasiC/R2.fastq.gz
+    REV:
+      - resources/Assignment_BasiC/R3.fastq.gz
+    reference: resources/design.fa
+    configs:
+      default: {} # name of an example filtering config

config/example_assignment_exact_lazy.yaml

@@ -0,0 +1,24 @@
+---
+global: # generall configs effecting one or multiple parts
+  threads: 1
+  assignments:
+    split_number: 1 # number of files fastq should be split for parallelization
+assignments:
+  exampleAssignment: # name of an example assignment (can be any string)
+    bc_length: 15
+    alignment_tool:
+      tool: exact # bwa or exact
+      configs:
+        sequence_length: 170 # sequence length of design excluding adapters.
+        alignment_start: 1 # start of the alignment in the reference
+    FW:
+      - resources/Assignment_BasiC/R1.fastq.gz
+    BC:
+      - resources/Assignment_BasiC/R2.fastq.gz
+    REV:
+      - resources/Assignment_BasiC/R3.fastq.gz
+    reference: resources/design.fa
+    configs:
+      lazy: # name of an example filtering config
+        min_support: 2 # default 3
+        fraction: 0.6 # default 0.75

config/example_assignment_exact_linker.yaml

@@ -0,0 +1,22 @@
+---
+global: # generall configs effecting one or multiple parts
+  threads: 1
+  assignments:
+    split_number: 1 # number of files fastq should be split for parallelization
+assignments:
+  exampleAssignment: # name of an example assignment (can be any string)
+    bc_length: 20
+    BC_rev_comp: true
+    linker: TCTAGACCGTCACTAACTAACAGTGGGTACCC
+    alignment_tool:
+      tool: exact # bwa or exact
+      configs:
+        sequence_length: 170 # sequence length of design excluding adapters.
+        alignment_start: 1 # start of the alignment in the reference
+    FW:
+      - resources/Assignment_BasiC/R1.fastq.gz
+    REV:
+      - resources/Assignment_BasiC/R3.fastq.gz
+    reference: resources/design.fa
+    configs:
+      default: {} # name of an example filtering config

config/example_config.yaml

@@ -1,18 +1,23 @@
 ---
-global:  # generall configs effecting one or multiple parts
+global: # generall configs effecting one or multiple parts
   threads: 1
   assignments:
-    split_number: 1  # number of files fastq should be split for parallelization
+    split_number: 1 # number of files fastq should be split for parallelization
 assignments:
-  exampleAssignment:  # name of an example assignment (can be any string)
+  exampleAssignment: # name of an example assignment (can be any string)
     bc_length: 15
-    sequence_length:  # sequence length of design excluding adapters.
-      min: 195
-      max: 205
-    alignment_start:  # start of an alignment in the reference. Here using 15 bp adapters. Can be different when using adapter free approaches
-      min: 15  # integer
-      max: 17  # integer
-    min_mapping_quality: 1  # integer >=0 Please use 1 when you have oligos that differ by 1 base in your reference/design file
+    alignment_tool:
+      tool: exact # bwa or exact
+      configs:
+        sequence_length: 170 # sequence length of design excluding adapters.
+        alignment_start: 1 # start of the alignment in the reference
+        # min_mapping_quality: 1  # integer >=0 Please use 1 when you have oligos that differ by 1 base in your reference/design file
+        # sequence_length:  # sequence length of design excluding adapters.
+        #   min: 195
+        #   max: 205
+        # alignment_start:  # start of an alignment in the reference. Here using 15 bp adapters. Can be different when using adapter free approaches
+        #   min: 15  # integer
+        #   max: 17  # integer
     FW:
       - resources/Assignment_BasiC/R1.fastq.gz
     BC:
@@ -21,9 +26,7 @@ assignments:
       - resources/Assignment_BasiC/R3.fastq.gz
     reference: resources/design.fa
     configs:
-      exampleAssignmentConfig:  # name of an example filtering config
-        min_support: 3
-        fraction: 0.7
+      default: {} # name of an example filtering config
 experiments:
   exampleCount:
     bc_length: 15
@@ -38,24 +41,8 @@ experiments:
       fromWorkflow:
         type: config
         assignment_name: exampleAssignment
-        assignment_config: exampleAssignmentConfig
+        assignment_config: default
     design_file: resources/design.fa
-    label_file: resources/labels.tsv  # optional
+    label_file: resources/labels.tsv # optional
     configs:
-      exampleConfig:
-        filter:
-          bc_threshold: 10
-          DNA:
-            min_counts: 1
-          RNA:
-            min_counts: 1
-        sampling:  # optional, just for benmarking
-          DNA:
-            total: 30000000
-            threshold: 300
-          RNA:
-            total: 50000000
-            threshold: 300
-    variants:  # optional
-      map: resources/variant_map.tsv
-      min_barcodes: [5, 10]  # min BC for ref and alt sequence
+      default: {} # name of an example filtering config

config/sbatch.yml

@@ -27,7 +27,7 @@ assignment_fastq_split:
   threads: 1
   mem: 10G
   queue: medium
-assignment_mapping:
+assignment_mapping_bwa:
   time: "0-02:00"
   threads: 30
   mem: 10G
@@ -46,6 +46,11 @@ assignment_collectBCs:
   threads: 20
   mem: 10G
   queue: medium
+assignment_mapping_exact:
+  time: "0-01:00"
+  threads: 1
+  mem: 10G
+  queue: debug
 assignment_statistic_totalCounts:
   time: "0-01:00"
   threads: 1
@@ -81,12 +86,16 @@ counts_umi_raw_counts:
   mem: 6G
   queue: "medium"
 counts_noUMI_create_BAM:
-  time: "4-00:00"
+  time: 4-00:00
   mem: 12G
-  queue: "medium"
+  queue: medium
+counts_filter_counts:
+  time: 0-02:00
+  queue: medium
 counts_final_counts_samplerer:
   mem: 20G
   queue: medium
+
 #########################
 ### (ASSIGNED) COUNTS ###
 #########################
@@ -133,6 +142,9 @@ statistic_counts_barcode_base_composition:
   time: "1-00:00"
   queue: "medium"
   mem: 20G
+statistic_counts_table:
+  time: 0-02:00
+  queue: medium
 
 #############################
 ### Statistic/correlation ###

docs/assignment.rst

@@ -32,6 +32,24 @@ Example file:
     >CRS4
     TTAGACCGCCCTTTACCCCGAGAAAACTCAGCTACACACTC
 
+Config File
+-----------
+Multiple mapping strategies are implemented to find the corresponding CRS sequence for each read. The mapping strategy can be chosen in the config file (bwa mem or exact matches). The config file also defines the filtering of the mapping results. The config file is a yaml file.
+
+Example of an assignment file using bwa and the standard filtering:
+
+.. literalinclude:: ../configs/example_assignment_bwa.yml
+   :language: yaml
+
+Example of an assignment file using exact matches and the with and non-default filtering of barcodes:
+
+.. literalinclude:: ../configs/example_assignment_exact_lazy.yml
+   :language: yaml
+
+Example of an assignment file using exact matches and read 1 with BC, linker and oligo (no seperate BC index read):
+
+.. literalinclude:: ../configs/example_assignment_exact_linker.yml
+   :language: yaml
 
 snakemake
 ============================
@@ -67,7 +85,7 @@ all
 assignment_attach_idx
     Extract the index sequence and add it to the header.
 assignment_bwa_ref
-   Create mapping reference for BWA from design file.
+   Create mapping reference for BWA from design file (code:`bwa` mapping approach).
 assignment_collect
     Collect mapped reads into one BAM.
 assignment_collectBCs
@@ -82,12 +100,16 @@ assignmemt_hybridFWRead_get_reads_by_cutadapt
     Get the barcode and read from the FW read using cutadapt (when no index BC read is present). Uses the paired end mode of cutadapt to write the FW and BC read.
 assignment_merge
    Merge the FW,REV and BC fastq files into one. Extract the index sequence from the middle and end of an Illumina run. Separates reads for Paired End runs. Merge/Adapter trim reads stored in BAM.
-assignment_mapping
-   Map the reads to the reference.
+assignment_mapping_bwa
+   Map the reads to the reference (code:`bwa` mapping approach).
 assignment_idx_bam
-   Index the BAM file
+   Index the BAM file (code:`bwa` mapping approach).
 assignment_flagstat
-   Run samtools flagstat. Results are in :code:`results/assignment/<assignment_name>/statistic/assignment/bam_stats.txt`
+   Run samtools flagstat. Results are in :code:`results/assignment/<assignment_name>/statistic/assignment/bam_stats.txt`  (code:`bwa` mapping approach).
+assignment_mapping_exact_reference
+    Create reference to map the exact design  (code:`exact` mapping approach).
+rule assignment_mapping_exact
+    Map the reads to the reference and sort using exact match (code:`exact` mapping approach).
 assignment_getBCs
    Get the barcodes (not filtered). Results are in :code:`results/assignment/<assignment_name>/barcodes_incl_other.sorted.tsv.gz`
 assignment_statistic_totalCounts